Bu yayında bildirilen araştırma çalışmaları tarafından Ulusal Genel tıbbi Bilimler Enstitüsü Ulusal Sağlık Enstitüleri Ödülü numarası R35GM124913, Purdue Üniversitesi PI4D teşvik programı ve PVM iç rekabet altında desteklenen Temel araştırma fonları programı. İçeriği yalnızca yazarlar sorumludur ve mutlaka finansman ajanları resmi görüşlerini temsil etmiyor. Biz Koichi Kawakami Tol2 yapı, Michael Lin ASAP1 inşa etmek için teşekkür ederiz ve Leonard Zon ubi organizatörü için inşa Addgene.

Zebra balığı AAALAC onaylı bir hayvan tesiste yer alan ve tüm deneylerin Purdue hayvan bakım ve kullanım Komitesi (PACUC) tarafından onaylanmış protokolleri göre yapılmıştır.
1. Tol2 Transposon plazmid yapı hazırlık
Not: Tol2, medaka balıkta keşfedilmiştir bir transposon içinde Zebra balığı araştırma topluluk8,9yaygın olarak kullanılmıştır. Başarılı bir şekilde ağ geçidi siteye özgü rekombinasyon tabanlı klonlama sisteme kabul ve Tol2 seti10olarak da bilinir. Tol2 seti oluşturma özelleştirilmiş ifade yapıları da transgenesis verimliliğini artırırken, daha uygun bir yol sağlar. Böylece, bu sistem yararlanmak ve doğrulanmış Ubikuitin organizatörü ASAP111sürücü kullanarak her yerde ASAP1 ifade Zebra balığı çizgi oluşturmak için kolay bir karar oldu.
<ol><li>Orta giriş ASAP1 yapı oluştururken: pDONR221-ASAP1<ol>
<li>Genetik olarak kodlanmış voltaj sensör ASAP1 yapı, pcDNA3.1/Puro-CAG-ASAP1 (plazmid #52519), Addgene elde etmek. ASAP1 kodlayıcı bölge yükseltmek için sonunda 5' astar (şekil 1) attB serileri ile çevrili (attB1-ASAP1F ve attB2-ASAP1R) özelleştirilmiş primerler kullanılarak bir PCR ayarlayın. Phusion DNA polimeraz yüksek verimlilik için seçildi ve PCR koşulları daha önce yayımlanmış protokolü12tarihinde göre optimize.</li>
		<li>TAE jel düzenli bir pipet ile 200 µL ipuçlarını kullanarak bir %1 50 µL PCR ürünleri yüklemek ve Elektroforez 160 V adlı bir yatay jel tankı yaklaşık 30 dk için gerçekleştirin.</li>
		<li>Jel UV transilluminator altında kontrol (353 nm), tüketim bıçak/neşter UV transilluminator altında daha önce yayımlanmış13,14olarak kullanarak istenen bant dışarı ve DNA içeren jel örneği temiz 1.5 mL microcentrifuge koymak tüp.</li>
		<li>Jel arıtma ASAP1 PCR ürünleri için gerçekleştirin. Ticari DNA jel arıtma seti üreticisinin öğretim takip uygulayarak çıkarılan jel DNA'da yeniden elde etmek ve su 20 µL DNA elute. Bir örnek olarak 1 µL al ve bir Spektrofotometre kullanarak DNA toplama ölçmek. Boş denetim15su kullanarak yazılım yönergeleri akışı.</li>
		<li>Almak 100 ng, saf PCR ürünü ve 150 ile karıştırmak pDONR221 plazmid TE 10 µL içinde ng tampon (10 mM Tris, 1 mM EDTA pH 8.0)16. BP Clonase II 2 µL tepki içine ekleyin ve reaksiyon oda sıcaklığında gecede kuluçkaya.</li>
		<li>İkinci gününde, İndinavir K 1 µL tepki ekleyin ve tepki için 30 dk 37 ° C'de kuluçkaya.</li>
		<li>Dönüştürme gerçekleştirmek. Reaksiyon aktarmak ve yetkili E. coli hücreleri ve hücreleri 30 dk için buz üzerinde kuluçkaya Top10 50 µL ile karıştırın. O zaman, 1 dk. 42 ° C su banyosu tepki tüpüne hemen tüpü çıkarması ve 2 min için buz üzerinde kuluçkaya transfer. Daha sonra tüp 37 ° C shaker koyun ve 1 h için kuluçkaya.</li>
		<li>Tüp çıkar ve hücreleri sefaloridin LB plaka üzerine plaka. Daha sonra plaka gecede (16-18 h) 37 ° C'de kuluçkaya</li>
		<li>Tek ve iyi ayrı kolonileri alın ve onları 14 mL hücre kültür tüpleri ile 3 mL LB orta içine aşılamak. Onları gecede bir shaker (dönüş / dakika) 250 rpm'lik dönüş hızı ile 37 ° C'de kültür.</li>
		<li>Onun öğretim el ile17takip bir ticari miniprep kit kullanarak miniprep gerçekleştirin.</li>
		<li>3-4 Plazmid dizi Sanger ile M13F ve M13R sıralama primerler kullanılarak olumlu pDONR221-ASAP1 tanımlamak için sıralama klonlar.</li>
	</ol>
</li>
	<li>Mikroenjeksiyon Tol2 yapı oluştururken: pDestTol2 -ubi-ASAP1<ol>
<li>Nasıl yapılacağını pDONR221-ASAP1 klon ve ölçü onun DNA toplama bir Spektrofotometre aşağıdaki boş bir kontrol gibi15su kullanarak yazılım yönergesi kullanarak doğrulanmadı seçin.</li>
		<li>PDONR221-ASAP1 100 µg alıp Tol2 kit 5 uçlu plazmid 100 µg ile karıştırın (pENTR5'_ubi, Addgene #27320), 100 µg p3E-polyA (Tol2 kit #302) ve pDestTol2pA2 150 µg (Tol2 kit #394). 8 µL için toplam ses seviyesini ayarlamak bir 1.5 mL microcentrifuge TE tampon (10 mM Tris, 1 mM EDTA, pH 8.0) kullanarak tüp ve mix de bir 2-5 s kısa girdap tarafından. O zaman, LR Clonase II plus 2 µL ekleyin ve reaksiyon oda sıcaklığında gecede kuluçkaya.</li>
		<li>İkinci gün, İndinavir K 1 µL 10 µL pipet kullanarak tepki ekleyin ve tepki için 30 dk 37 ° C'de kuluçkaya.</li>
		<li>Dönüştürme gerçekleştirmek ve olumlu klonlar (adımları 1.1.7-11) açıklandığı gibi tanımlar.</li>
		<li>Ölçü sıralama DNA konsantrasyon pDestTol2-ubi-ASAP1 klon (şekil 1B) Spektrofotometre15kullanarak doğrulanmadı. Genellikle 200ng/µL bölgedir.</li>
	</ol>
</li>
</ol>2. Tol2 Transposase mRNA ve enjeksiyon çözüm hazırlamak
<ol><li>Steril aşılama döngü kullanarak çizgi E. coli gliserol stokunun pCS2FA-transposase plazmid (Tol2 kit #396) (ile 100 µg/mL Ampisilin) LB plaka üzerine. Plaka bir kuluçka 37 ° C'de gecede kuluçkaya. Ertesi gün, bir koloni almak ve bunu LB (100 µg/mL Ampisilin) 3 mL steril 10 µL pipet ucu kullanarak aşılamak. Bir shaker 250 rpm'lik dönüş hızı ile 37 ° C'de gecede kültür.</li>
	<li>Miniprep onun kullanım kılavuzu takip bir ticari miniprep kit kullanarak E. coli kültür gerçekleştirin. Plazmid DNA TE arabellek 30-50 µL 1 dakika santrifüj 14.000 RPM tarafından elute ve onun DNA toplama bir Spektrofotometre ile ölçmek.</li>
	<li>Plazmid ile değil ben 1-2 µg endonükleaz linearize ve temizleme seti değil ben sonra onun kullanım kılavuzu aşağıdaki DNA ile DNA sindirim arındırmak. DNA su 5 µL 1 dakikadır 14.000 rpm centrifuging tarafından elute. Beklenen konsantrasyon ilgili 200-300 ng/µL.</li>
	<li>Vitro transkripsiyon gerçekleştirmek ile değil ben pCS2FA-transposase bir ticari SP6 transkripsiyon kit kullanarak DNA şablon olarak doğrusallaştırılmış.</li>
	<li>Reaksiyon tamamlandıktan sonra üreticinin yönergelerini izleyerek bir ticari RNA temizlik kullanarak mRNA kit Tol2 transposase arındırmak. Son olarak, mRNA RNAase ücretsiz 20 µL suya elute ve bir Spektrofotometre RNA konsantrasyon ölçmek. Beklenen konsantrasyon ilgili 1-3 µg / µL. örnekleri gerekirse-80 ° C dondurucuda saklanabilir.</li>
	<li>20 ng/µL pDestTol2 -ubikarıştırılarak mikroenjeksiyon çözüm hazırlamak-ASAP1 ve Tol2 transposase mRNA (100 ng/µL) pipetting tarafından microcentrifuge tüp içinde. Nükleik asit önlemek için bozulması tekrarlanan çözdürme ve tüp başına refreezing, aliquot 6 µL neden olduğu ve-80 ° C dondurucu ileride kullanmak üzere saklayın.</li>
</ol>3. mikroenjeksiyon
<ol><li>4-6 üreme tankları en az 2 kadın ve 2 erkek ile öğleden sonra enjeksiyon önce ayarlayın. Bu balık öğleden sonra beslenmelidir değil. Bu adımı balık atık miktarını azaltmak ve ertesi sabah da ikna etmek üreme yanıt için yardımcı olurken, onları temizlemek için zaman kazandırır.</li>
	<li>Ertesi sabah, hazırlanan enjeksiyon çözümü kaldırmak (pDestTol2 -ubi-ASAP1 yapı ve Tol2 mRNA)-80 ° C dondurucu gelen ve buz üzerinde yerleştirin.</li>
	<li>Bölücüler tankları ıslah balık çekin ve çiftleşmek balık sağlar. Genel olarak, Balık bölücü çekerek sonra 20-30 dakika içinde yumurta yatıyordu. Aksi takdirde, 1-2 saat daha bekle. Biraz balık hiç yumurtalarını değil. Bu durumda, bu deney balık embriyo koleksiyonu için yineleyin.</li>
	<li>Beklerken, iğneler Forseps ile veya bir hassas görev silecek kırarak eğimli kenarı oluşturmak bir açıyla kırık ucu hazırlanmış olduğundan emin olun.<ol>
<li>Aşağıdaki parametreleri kullanarak bir micropipette çektirmenin kapiller camdan Needles çekin: 545; ısı Çekme 60; hızı 80; zaman 250; basınç 500. Forseps tutarak bir açı yaklaşık 45 ° bir diseksiyon kapsamla (çapı tahmini için göz-adet cetvel) altında Forseps ile iğne kır. İstenen iğne çapları microinjector ayarlarına bağlı olarak değişken olabilir, ama daha küçük çaplı embriyo ölümleri azaltmak için tercih edilir.</li>
	</ol>
</li>
	<li>Bir kez balık yumurta atılmıştır var, onları bir 10-cm çapında Petri kabına toplamak ve diseksiyon kapsama getir. Tüm anormal embriyo kaldırmak ve atık balık.</li>
	<li>Damlalıklı döllenmiş embriyo içine hazırlanan % 3 özel enjeksiyon kalıp. Embriyo tutmak yardımcı olmak için fazla suyu kaldırın.</li>
	<li>Bir kez tüm satırları uygun embriyo ile dolu, aynı yöne doğru yatay olarak yaklaşık 45 ° açı bu iğne tek hücreleri tüm yüz onları yeniden düzenleyin. Bu enjeksiyon daha sonra çok daha kolay yapacaktır.</li>
	<li>Eldiven giyerken, 20 µL yükleme damlalıklı kullanın İpucu ve buz üzerinde tüp hazır yapı 5 µL kaldırın.</li>
	<li>Dikkatle ta uzantılar gibi ipucu yakın reaktif elde olarak için başladığı için kırık kılcal tüp arka uç ucunu takın. Hala hava kabarcıkları Eğer ucunu kırmak emin iğne sallamak.</li>
	<li>İğne mikroenjeksiyon iğne bağı düz yerleştirin ve iğne yerinde kalır kadar dikkatlice sıkın. Yaklaşık 45 ° açıyla ayarlayın.</li>
	<li>Bir kez iğne hazırlanan ve bağlı, mikroskop ve gaz basınç tankı açın. Ticari CO2 Tanklar bu amaç için genel olarak iyi. Enjeksiyon hacmi holding ve ejeksiyon basınç ayarlanır: yaklaşık 0,5 psi tutmak için ve fırlatma için 30 psi. Çözüm, zaman pedal basarak çıkar ki kontrol ettiğinizden emin olun.</li>
	<li>Mineral yağ, bir damla ile bir sahne mikrometre kullanarak ayarlayın birim ve çözüm için ~ 150 µm çapında akışını (yaklaşık 2 nL). Arka basınç iğne damla küçük bir miktar izin verir emin olun. Yeterince geri dönüş basıncı varsa, kılcal eylem iğne girin ve mRNA yok etmek için sıvı neden olur.</li>
	<li>İğne kalibre edilmiş bir kez inşa döllenmiş embriyolar tek hücre enjekte başlar. Not: Bu uygulama, sabır ve incelik, hücre zarının delmek sabit varlık nedeniyle büyük bir miktar alır. Bu çözüm değil sarısı transgenik Zebra balığı üretmek için hücre içine enjekte etmek önemlidir. Bu morpholino enjeksiyon farklıdır. Hangi tarafta iğne hücrenin yapı hücreye gider sürece girer önemli değil. Transgenesis hücre yerine sarısı içine enjekte başarı oranı çok düşük olacaktır. Tek hücreli sahne enjeksiyon da önemlidir veya somatik chimera balık-ecek var olmak mahluk. Bu germ hücreleri girmeden transgene olasılığını azaltacaktır.</li>
	<li>Jel çentik kenarına embriyo yerine tutar ve iğne embriyo hareket ettirmeden basınç uygulamak izin veren bir destek sağlamak için kullanın. İğne ucu tek hücrede olduğunda, çözüm istenilen miktarda serbest bırakmak için pedal basın. Tüm embriyoların için bu adımları tekrarlayın.</li>
	<li>Rapor tamamlandığında, enjekte embriyo onları balık sistem su ve bir tek kullanımlık 3.4 mL transfer pipet ile özel çentik dışarı durulama etiketli bir tabak içine aktarın. Embriyo geliştirmek izin bir 28.5 ° C kuluçka makinesi içinde saklayın. Kontrol sırt ölü balık embriyo kaldırma gün ve % 0.1 Metilen mavisi balık suda su yerine.</li>
	<li>Yaklaşık 6-8 saat sonra enjeksiyon, enjekte almak 10 tek embriyo balık ve sert çocuk yöntemi18kullanarak onlardan genomik DNA hazırlamak.</li>
	<li>Ertesi sabah, diseksiyon mikroskop GFP ve sigara sarısı dokularda gösterilen embriyo dışarı sıralamak için bir Floresan ışık kaynağı ile kullanın. Bu balık embriyoların enjekte yapı içermelidir.</li>
	<li>Tol2 tüketim tahlil19daha önce açıklandığı gibi transposon etkinliği denetlemek için gerçekleştirin. Eksize plazmid tespit edilebilir, enjekte tutmak balık embriyo ve onları yetiştirmek. Eğer hiçbir eksize plazmid bulmak, Tol2 mRNA sentezi ve mikroenjeksiyon işlemi Tol2 tüketim testin pozitif sonuçlar elde kadar yineleyin.</li>
</ol>4. transgenik ASAP1 balık, Tg kurun (UBI: ASAP1)
<ol><li>Yetişkinliğe enjekte balık (F0 üretimi) Zebra balığı kitap20daha önce açıklandığı gibi kaldırın. Bu genellikle yaklaşık 4 ay sürer.</li>
	<li>Bir tek yetişkin F0 balık almak ve cinsiyet wildtype balık karşısında tek bir çapraz. Islah daha sonra gün sonra balık embriyo toplamak. Toplanan balık embriyo 28.5 ° C kuluçka balık su % 0,1 Metilen mavisi ile tutun.</li>
	<li>Üçüncü günde, floresan diseksiyon mikroskop altında balık embriyo GFP filtre ile kontrol edin. Eğer var birisi yeşil balık embriyo sıralamak ve onları yetişkinliğe F1 nesil transgenik balık, Tg olarak yetiştirmek (UBI: ASAP1). Not: mikrop-line genetik chimeras ebeveyn F0 balık çoğu bu yana Mendel oranı beklenmez.</li>
	<li>Tek F1 yetişkin balık wildtype balık ile çapraz ve balık embriyo toplamak. Yeşil balık embriyo sıralamak ve onları yetişkinliğe F2 nesil balık olarak yetiştirmek. Not: Yeşil ve yeşil balık embriyo 1:1 yakın olup olmadığını tek bir transgene olmalıdır.</li>
	<li>Tümör kötü huylu periferik sinir kılıfı Tümörü (MPNST) gibi elektrik potansiyel değişiklikleri görüntülemek için F2 nesil Tg çapraz (UBI: ASAP1) rpl35hi258/wt balık ile balık. Bu görünür tümör içinde 6-8 ay yaşlı yetişkin21,22bulunmak başlatmak bilinmektedir.</li>
</ol>5. görüntüleme
<ol><li>Zebra balığı embriyo resim, birden çok F2 nesil kurucusu balık almak ve onları wildtype balık bireysel çiftleri ile çapraz için. Kılavuzu23evreleme Zebra balığı göre farklı istenen gelişim aşamalarında balık embriyo toplamak.</li>
	<li>Balık embriyo erken dönemlerinde için soyma ve chorions dikkatlice 10 cm çapında Petri kabına balık sistem su ile bir diseksiyon kapsamı altında bir çift forseps kullanarak embriyoların kaldırma.</li>
	<li>Concaved cam slayt üzerine birkaç balık embriyo 3.4 mL tek kullanımlık transfer pipet kullanarak % 3 methylcellulose ile aktarın. Bir floresan diseksiyon kapsamı altında bir iğne kullanarak hücresel GFP etkinliğini görüntülemek için istenen konumlara embriyo ayarlayın.</li>
	<li>Balık embriyo (12 somite sahne büyük) hareketli aşamaları için % 0.05 tricaine mesylate balık embriyo slaytlara aktarmadan önce anestezi için kullanın. Kısaca, yüzme ve beden denge kaybı durdurulana kadar balık embriyo %0,05 tricaine mesylate balık su içine ortaya. Ayrıca, slayt üzerinde %0,05 tricaine mesylate methylcellulose ile bir damla ekleyin.</li>
	<li>Az 12 somite sahne balık için embriyo, epi-floresan mikroskop bileşik bir uyumlu kamera ve yazılım ile görüntüleme için kullanın. 12 somite sahne balık embriyolar daha eski için Floresans diseksiyon mikroskop kullanın.</li>
	<li>Tümör hücre voltajı resim, ilk balık MPNST tümörler ile tanımlamak için. O zaman, %0.05 tricaine mesylate balıkla anestezi. Bütün Dağı görüntüleme için balık 10 cm çapında Petri kabına koymak. Tümör hücre elektrik etkinliğini görüntülemek için balık tümörler dışarı bütün Dağı görüntüleme sonra disseke.</li>
</ol>

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

Yazarlar ifşa gerek yok.

Her ne kadar cep ve doku düzeyinde elektrik faaliyetleri sırasında embriyonik geliştirme ve insan hastalık uzun zaman önce keşfedildi, vivo içinde dinamik elektrik değişiklikleri ve biyolojik rolleri hala büyük ölçüde bilinmeyen kalır. Büyük zorluklardan biri görselleştirmek ve elektrik değişiklikleri ölçmek etmektir. Yama kelepçe teknoloji bir mola-tek hücre izlemek için geçer ancak birçok hücrelerinin oluşan oldukları için uygulama omurgalı embriyolar için sınırlıdır. Ge?...

Bioelectricity endojen elektrik iyon kanalları ve hücre zarının1üzerinde bulunan pompalar aracılı sinyalleşme için ifade eder. Hücresel membran ve eşleşmiş Elektrik potansiyeli ve geçerli değişiklikleri, iyonik değişim süreçleri telaşlı nöronal ve kas hücrelerinin sinyal için gereklidir. Buna ek olarak, bioelectricity ve iyon degradeler çeşitli enerji depolama, biyosentezi ve metaboliti ulaşım da dahil olmak üzere diğer önemli Biyolojik işlevleri var. Biyoelektrik sinyal Ayrıca embriyonik Desen oluşumu, vücut eksenleri, hücre döngüsü ve hücre farklılaşması1gibi bir düzenleyici olarak keşfedilmiştir. Böylece, bu tür sinyal yanlış düzenlenmesi neden pek çok insan Konjenital hastalıklar anlamak için önemlidir. Yama kelepçe yaygın tek hücreleri kaydetmek için kullanılmıştır, aynı anda birden fazla hücreleri embriyonik gelişim içinde vivosırasında izleme için ideal hala uzak olsa da. Ayrıca, voltaj duyarlı küçük moleküller de vivo içinde uygulamalar nedeniyle onların özelliklerine, hassasiyetleri ve toksisite için ideal değildir.
Çeşitli oluşturulması genetik olarak bu sorunu aşmak için yeni bir mekanizma floresan voltaj göstergelerinin (GEVIs) Teklifler kodlanmış ve düz-se bile onlar aslında sinir izlemek için istenmeyen embriyonik gelişim, eğitim kolay uygulama sağlar 2,3hücreleri. Şu anda mevcut GEVIs biri hız sensörü aksiyon potansiyelleri 1'in (ASAP1)4. Voltaj duyarlı fosfataz ve dairesel yayın derlenemiyor yeşil flüoresan protein bir gerilim algılamalı etki alanının hücre dışı bir döngü oluşur. Bu nedenle, ASAP1 hücresel elektrik potansiyel değişiklikleri görselleştirme sağlar (Polarizasyon: parlak yeşil; depolarizasyon: koyu yeşil). ASAP1 2 ms açık ve kapalı Kinetik vardır ve subthreshold olası değişiklik4izleyebilirsiniz. Böylece, bu genetik aracı gerçek zamanlı biyo-elektrik canlı hücrelerde izleme etkinliğinin yeni düzeyi sağlar. Daha fazla bioelectricity embriyonik geliştirme ve birçok insan hastalıkları, kanser gibi rollerini anlamak hastalık tedavi ve korunma için kritik olan temel mekanizmaları, yeni ışık tutacak.
Zebra balığı gelişim biyolojisi ve insan hastalıkları kanser5,6dahil olmak üzere çalışmaya güçlü bir hayvan modeli kanıtlanmıştır. Onlar % 70 orthologous genler insanlarla paylaşmak ve onlar-si olmak benzer omurgalı Biyoloji7. Zebra balığı nispeten kolay bakım, yumurta, uysal genetik, kolay transgenesis ve saydam dış embriyonik geliştirme, hangi yapmak onları vivo içinde görüntüleme5,6için üstün bir sistemi büyük debriyaj boyutunu sağlar. Bir büyük satırların kaynağı olan mutant balık zaten mevcut ve tam sıralı genom, Zebra balığı bilimsel keşif nispeten sınırsız bir dizi sağlayacaktır.
Hücreleri vivo içinde gerçek zamanlı elektriksel aktivitesinin araştırmak için Zebra balığı modeli sistemi ve ASAP1 avantajlarından yararlanın. Bu yazıda nasıl flüoresan gerilim Biyoalgılayıcı ASAP1 Tol2 transposon transgenesis kullanarak Zebra balığı genom dahil tarif ve hücresel elektriksel aktivite sırasında embriyonik gelişim, Balık larva hareketi ve canlı tümör görselleştirmek .

<table>
	<tbody>
		<tr>
			<td>14mL cell culture tubes</td>
			<td>VWR</td>
			<td>60818-725</td>
			<td>E.Coli culture</td>
		</tr>
		<tr>
			<td>Agarose electrophoresis tank</td>
			<td>Thermo Scientific</td>
			<td>Owl B2</td>
			<td>DNA eletrophoresis</td>
		</tr>
		<tr>
			<td>Agarose RA</td>
			<td>Amresco</td>
			<td>N605-500G</td>
			<td>For making the injection gels</td>
		</tr>
		<tr>
			<td>Attb1-ASAP1-F primer</td>
			<td>IDT DNA</td>
			<td>GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAGACGACTGTGAGGTATGAACA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Attb2-ASAP1-R primer</td>
			<td>IDT DNA</td>
			<td>GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGGTTACCACTTCAAGTTGTTTCTTCTGTGAAGCCA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Bright field dissection scope</td>
			<td>Nikon</td>
			<td>SMZ 745</td>
			<td>Dechorionation, microinjection, mounting</td>
		</tr>
		<tr>
			<td>Color camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRc</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Concave slide</td>
			<td>VWR</td>
			<td>48336-001</td>
			<td>For holding fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>Disposable transfer pipette 3.4 ml</td>
			<td>Thermo Scientific</td>
			<td>13-711-9AM</td>
			<td>Fish embryos and water transfer</td>
		</tr>
		<tr>
			<td>Endonuclease enzyme, Not I</td>
			<td>NEB</td>
			<td>R0189L</td>
			<td>For linearizing plasmid DNA</td>
		</tr>
		<tr>
			<td>Epifuorescent compound scope</td>
			<td>Zeiss</td>
			<td>Axio Imager.A2</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Epifuorescent stereo dissection scope</td>
			<td>Zeiss</td>
			<td>Stereo Discovery.V12</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Fluorescent light source</td>
			<td>Lumen dynamics</td>
			<td>X-cite seris 120</td>
			<td>Light source for fluorescence microscopes</td>
		</tr>
		<tr>
			<td>Forceps #5</td>
			<td>WPI</td>
			<td>500342</td>
			<td>Dechorionation and needle breaking</td>
		</tr>
		<tr>
			<td>Gateway BP Clonase II Enzyme mix</td>
			<td>Thermo Scientific</td>
			<td>11789020</td>
			<td>Gateway BP recombination cloning</td>
		</tr>
		<tr>
			<td>Gateway LR Clonase II Plus enzyme</td>
			<td>Thermo Scientific</td>
			<td>12538120</td>
			<td>Gateway LR recombination cloning</td>
		</tr>
		<tr>
			<td>Gel DNA Recovery Kit</td>
			<td>Zymo Research</td>
			<td>D4002</td>
			<td>DNA gel purification</td>
		</tr>
		<tr>
			<td>Loading tip</td>
			<td>Eppendorf</td>
			<td>930001007</td>
			<td>For loading injection solution into capilary needles</td>
		</tr>
		<tr>
			<td>Methylcellulose (1600cPs)</td>
			<td>Alfa Aesar</td>
			<td>43146</td>
			<td>Fish embryo mounting</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Sigma-Aldrich</td>
			<td>M9140</td>
			<td>Suppresses fungal outbreaks in Petri dishes</td>
		</tr>
		<tr>
			<td>Microinjection mold</td>
			<td>Adaptive Science Tools</td>
			<td>TU-1</td>
			<td>To prepare agaorse mold tray for holding fish embryos during injection</td>
		</tr>
		<tr>
			<td>Microinjector</td>
			<td>WPI</td>
			<td>Pneumatic Picopump PV820</td>
			<td>Microinjection injector</td>
		</tr>
		<tr>
			<td>Micro-manipulator</td>
			<td>WPI</td>
			<td>Microinjector mm33 rechts</td>
			<td>Microinjection operation</td>
		</tr>
		<tr>
			<td>Micropipette puller</td>
			<td>Sutter instrument</td>
			<td>P-1000</td>
			<td>For preparing capillary needle</td>
		</tr>
		<tr>
			<td>Mineral oil</td>
			<td>Amresco</td>
			<td>J217-500ml</td>
			<td>For calibrating injection volume</td>
		</tr>
		<tr>
			<td>mMESSAGE mMACHINE SP6 Transcription Kit</td>
			<td>Thermo Scientific</td>
			<td>AM1340</td>
			<td>mRNA in vitro transcription</td>
		</tr>
		<tr>
			<td>Monocolor camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRm</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4020</td>
			<td>Prepare small amount of plasmid DNA</td>
		</tr>
		<tr>
			<td>Plastic Petri dishes</td>
			<td>VWR</td>
			<td>25384-088</td>
			<td>For holding fish or fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>RNA Clean &#38; Concentrator-5</td>
			<td>Zymo Research</td>
			<td>R1015</td>
			<td>mRNA cleaning after in vitro transcription</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>NanoDrop 2000</td>
			<td>For measuring DNA and RNA concentrations</td>
		</tr>
		<tr>
			<td>Stage Micrometer</td>
			<td>Am Scope</td>
			<td>MR100</td>
			<td>Microinjection volume calibration</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td>Bio-Rad</td>
			<td>T100</td>
			<td>DNA amplification for gene cloning</td>
		</tr>
		<tr>
			<td>Thin wall glass capillaries</td>
			<td>WPI</td>
			<td>TW100F-4</td>
			<td>Raw glass for making cappilary needle</td>
		</tr>
		<tr>
			<td>Tol2-exL1 primer</td>
			<td>IDT DNA</td>
			<td>GCACAACACCAGAAATGCCCTC</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>Tol2-exR primer</td>
			<td>IDT DNA</td>
			<td>ACCCTCACTAAAGGGAACAAAAG</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>TOP10 Chemically Competent E. coli</td>
			<td>Thermo Scientific</td>
			<td>C404006</td>
			<td>Used for transformation during gene cloning</td>
		</tr>
		<tr>
			<td>Tricaine mesylate</td>
			<td>Sigma-Aldrich</td>
			<td>A5040</td>
			<td>For anesthetizing fish or fish embryos</td>
		</tr>
		<tr>
			<td>UV trans-illuminator 302nm</td>
			<td>UVP</td>
			<td>M-20V</td>
			<td>DNA visualization</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Thermo Scientific</td>
			<td>2853</td>
			<td>For transformation process of gene cloning</td>
		</tr>
	</tbody>
</table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

Bioelectricity, endojen elektrik iyon kanalları tarafından aracılı sinyalleşme ve hücre zarı üzerinde bulunan pompalar oynar gibi telaşlı nöronal ve kas hücrelerinin süreçleri ve birçok diğer biyolojik süreçler, sinyal önemli roller embriyonik gelişimsel desenlendirme. Ancak, in vivo omurgalı embriyogenez elektrik etkinliğini izleme için bir ihtiyaç vardır. Genetik olarak kodlanmış floresan voltaj göstergelerinin (GEVIs) gelişmeler bu sorun için bir çözüm sağlamak mümkün kılmıştır. Burada, nasıl bir transgenik voltaj göstergesi Zebra balığı kurulan voltaj göstergesi, ASAP1 kullanarak oluşturulacağını açıklar (hız sensörü, Aksiyon potansiyelleri 1), örnek olarak. Tol2 kit ve her yerde birden bulunan Zebra balığı organizatörü, ubi, bu çalışmada seçildi. Biz aynı zamanda ağ geçidi siteye özgü klonlama, Tol2 transposon tabanlı Zebra balığı transgenesis ve normal epifluorescent mikroskoplar kullanarak aşamasındaki balık embriyo ve balık tümörleri için görüntüleme işlemi işlemleri açıklar. Bu balık satırını kullanarak, Zebra balığı embriyo ve balık larva hareketi sırasında hücresel elektrik voltaj değişiklikleri vardır bulundu. Ayrıca, birkaç Zebra balığı Malign periferik sinir kılıf tümörleri içinde çevresindeki normal dokuların hücreleri genellikle polarize tümör karşılaştırıldığında gözlendi.

Bir başarılı yerleştirmeye, fazla enjekte % 50 balık embriyo yeşil floresan bir dereceye somatik hücreler görüntüler ve bunların çoğu Tol2 transposon tüketim tahlil (Şekil 2) tarafından olumlu olacaktır. 2-4 nesil (floresan balık % 50, beklenen Mendel oranı gelinceye) wildtype balıkla dışı geçtikten sonra transgenik balık hücre membran potansiyeli embriyonik gelişim sırasında izlemek için görüntüleme deneme için kullanılmı?...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Zebra balığı erken embriyo ve tümör hücresel elektrik aktivitesinin görselleştirme

Burada, bir hücresel elektrik voltaj muhabir Zebra balığı çizgi embriyonik gelişim, hareket, görselleştirmek için oluşturma sürecini göstermek ve in vivobalık tümör hücreleri.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

visualization-cellular-electrical-activity-zebrafish-early-embryos

Research

JoVE Journal

Developmental Biology

8.7K Görüntüleme.  Purdue University. Burada, bir hücresel elektrik voltaj muhabir Zebra balığı çizgi embriyonik gelişim, hareket, görselleştirmek için oluşturma sürecini göstermek ve in vivobalık tümör hücreleri.

Video: Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological systems. In FDAP experiments, the clearance of proteins within living organisms can be measured. A protein of interest is tagged with a photoconvertible fluorescent protein, expressed in vivo and photoconverted, and the decrease in the photoconverted signal over time is monitored. The data is then fitted with an appropriate clearance model to determine the protein half-life. Importantly, the clearance kinetics of protein populations in different compartments of the organism can be examined separately by applying compartmental masks. This approach has been used to determine the intra- and extracellular half-lives of secreted signaling proteins during zebrafish development. Here, we describe a protocol for FDAP experiments in zebrafish embryos. It should be possible to use FDAP to determine the clearance kinetics of any taggable protein in any optically accessible organism.

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion FDAP

Protein levels in cells and tissues are often tightly regulated by the balance of protein production and clearance. Using Fluorescence Decay After Photoconversion (FDAP), the clearance kinetics of proteins can be experimentally measured in vivo.

Fotoçevrim sonra Floresans Bozunma kullanarak Oturma balığı Embriyolar protein stabilitesi ölçümü (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological ...

Gelişim Biyolojisi

Mechanical Vessel Injury in Zebrafish Embryos

Zebrafish (Danio rerio) embryos have proven to be a powerful model for studying a variety of developmental and disease processes. External development and optical transparency make these embryos especially amenable to microscopy, and numerous transgenic lines that label specific cell types with fluorescent proteins are available, making the zebrafish embryo an ideal system for visualizing the interaction of vascular, hematopoietic, and other cell types during injury and repair in vivo. Forward and reverse genetics in zebrafish are well developed, and pharmacological manipulation is possible. We describe a mechanical vascular injury model using micromanipulation techniques that exploits several of these features to study responses to vascular injury including hemostasis and blood vessel repair. Using a combination of video and timelapse microscopy, we demonstrate that this method of vascular injury results in measurable and reproducible responses during hemostasis and wound repair. This method provides a system for studying vascular injury and repair in detail in a whole animal model.

This article describes a method for creating a mechanical vessel injury in zebrafish embryos. This injury model provides a platform for studying hemostasis, injury-related inflammation, and wound healing in an organism ideally suited for real-time microscopy.

Zebra balığı Embriyolar Mekanik Gemi Sakatlık

Zebrafish (Danio rerio) embryos have proven to be a powerful model for studying a variety of developmental and disease processes.  External development ...

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo development due to their similar developmental process. Although genetic factors are known to affect early embryonic development, the discovery of such factors has been a serious challenge. Microarray technology allows quantitative measurement and gene expression profiling of transcript levels on a genome-wide basis. One of the main decisions that have to be made when planning a microarray experiment is whether to use a one- or two-color approach. Two-color design increases technical replication, minimizes variability, improves sensitivity and accuracy as well as allows having loop designs, defining the common reference samples. Although microarray is a powerful biological tool, there are potential pitfalls that can attenuate its power. Hence, in this technical paper we demonstrate an optimized protocol for RNA extraction, amplification, labeling, hybridization of the labeled amplified RNA to the array, array scanning and data analysis using the two-color analysis strategy.

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Microarray technology allows quantitative measurement and gene expression profiling of transcripts on a genome-wide basis. Therefore, this protocol provides an optimized technical procedure in a two-color custom made bovine array using Day 7 bovine embryos to demonstrate the feasibility of using low amount of total RNA.

Transcriptome Profil<em&gt; In-vivo</emİki renkli Mikroarray Platformu Kullanma&gt; Üretilen Sığır pre-implantasyon Embriyolar

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo ...

Isolation and Characterization of Single Cells from Zebrafish Embryos

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been described at the morphological level, little is known about the molecular basis of cellular changes that occur as the organism develops. With recent advancements in microfluidics and multiplexing technologies, it is now possible to characterize gene expression in single cells. This allows for investigation of heterogeneity between individual cells of specific cell populations to identify and classify cell subtypes, characterize intermediate states that occur during cell differentiation, and explore differential cellular responses to stimuli. This study describes a protocol to isolate viable, single cells from zebrafish embryos for high throughput multiplexing assays. This method may be rapidly applied to any zebrafish embryonic cell type with fluorescent markers. An extension of this method may also be used in combination with high throughput sequencing technologies to fully characterize the transcriptome of single cells. As proof of principle, the relative abundance of cardiac differentiation markers was assessed in isolated, single cells derived from nkx2.5 positive cardiac progenitors. By evaluation of gene expression at the single cell level and at a single time point, the data support a model in which cardiac progenitors coexist with differentiating progeny. The method and work flow described here is broadly applicable to the zebrafish research community, requiring only a labeled transgenic fish line and access to microfluidics technologies.

This protocol describes a method for isolating single cells from zebrafish embryos, enriching for cells of interest, capturing zebrafish cells in microfluidic based single cell multiplex systems, and assessing gene expression from single cells.

İzolasyon ve Zebra balığı Embriyolar gelen Tek Hücre Karakterizasyonu

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos. 
Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

Canlı Zebra balığı Embriyolarında Biosense Motor Nöron Membranı Potansiyeli

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and zebrafish embryos. Our system comprises a chamber featuring a simple setup that is nevertheless robust to induce and maintain a specific oxygen concentration and temperature in any experimental solution of choice. The presented system is very cost-effective but highly functional, it allows induction and sustainment of hypoxia for direct experiments in vivo and for various time periods up to 48 h.
To monitor and study the effects of hypoxia, we have employed two methods - measurement of levels of hypoxia-inducible factor 1alpha (HIF-1&#945;) in whole embryos or specific tissues and determination of retinal stem cell proliferation by 5-ethynyl-2&#8242;-deoxyuridine (EdU) incorporation into the DNA. HIF-1&#945; levels can serve as a general hypoxia marker in the whole embryo or tissue of choice, here embryonic retina. EdU incorporation into the proliferating cells of embryonic retina is a specific output of hypoxia induction. Thus, we have shown that hypoxic embryonic retinal progenitors decrease proliferation within 1 h of incubation under 5% oxygen of both frog and zebrafish embryos.
Once mastered, our setup can be employed for use with small aquatic model organisms, for direct in vivo experiments, any given time period and under normal, hypoxic or hyperoxic oxygen concentration or under any other given gas mixture.

We introduce a novel hypoxic chamber system for use with aquatic organisms such as frog and zebrafish embryos. Our system is simple, robust, cost-effective and allows the induction and sustainment of hypoxia in vivo and for up to 48 h. We present 2 reproducible methods to monitor the effectiveness of hypoxia.

Kurbağa ve Zebra balığı Embriyolarında Hipoksinin İndüklenmesi

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Multi-Photon Time Lapse Imaging to Visualize Development in Real-time: Visualization of Migrating Neural Crest Cells in Zebrafish Embryos

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to numerous cell types throughout the body. Understanding the biology of the neural crest has been limited, reflecting a lack of genetically tractable models that can be studied in vivo and in real-time. Zebrafish is a particularly important developmental model for studying migratory cell populations, such as the neural crest. To examine neural crest migration into the developing eye, a combination of the advanced optical techniques of laser scanning microscopy with long wavelength multi-photon fluorescence excitation was implemented to capture high-resolution, three-dimensional, real-time videos of the developing eye in transgenic zebrafish embryos, namely Tg(sox10:EGFP) and Tg(foxd3:GFP), as sox10 and foxd3 have been shown in numerous animal models to regulate early neural crest differentiation and likely represent markers for neural crest cells. Multi-photon time-lapse imaging was used to discern the behavior and migratory patterns of two neural crest cell populations contributing to early eye development. This protocol provides information for generating time-lapse videos during zebrafish neural crest migration, as an example, and can be further applied to visualize the early development of many structures in the zebrafish and other model organisms.

A combination of the advanced optical techniques of laser scanning microscopy with long wavelength multi-photon fluorescence excitation was implemented to capture high-resolution, three-dimensional, real-time imaging of neural crest migration in Tg(sox10:EGFP) and Tg(foxd3:GFP) zebrafish embryos.

Geliştirme gerçek zamanlı olarak görselleştirmek için çoklu foton zaman atlamalı görüntüleme: nöral Crest hücrelerde geçirme Zebra balığı embriyo görselleştirme

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is the formation of the transient organizers, the node and notochordal plate, from cells that have passed through the primitive streak. The proper formation of these signaling centers is essential for the development of the body plan and techniques to visualize them are of high interest to mouse developmental biologists. The node and notochordal plate lie on the ventral surface of gastrulating mouse embryos around embryonic day (E) 7.5 of development. The node is a cup-shaped structure whose cells possess a single slender cilium each. The proper subcellular localization and rotation of the cilia in the node pit determines left-right asymmetry. The notochordal plate cells also possess single cilia albeit shorter than those of the node cells. The notochordal plate forms the notochord which acts as an important signaling organizer for somitogenesis and neural patterning. Because the cells of the node and notochordal plate are transiently present on the surface and possess cilia, they can be visualized using scanning electron microscopy (SEM). Among other techniques used to visualize these structures at the cellular level is whole mount immunofluorescence (WMIF) using the antibodies against the proteins that are highly expressed in the node and notochordal plate. In this report, we describe our optimized protocols to perform SEM and WMIF of the node and notochordal plate in developing mouse embryos to help in the assessment of tissue shape and cellular organization in wild-type and gastrulation mutant embryos.

The node and notochordal plate are transient signaling organizers in developing mouse embryos that can be visualized using several techniques. Here, we describe in detail how to perform two of the techniques to study their structure and morphogenesis: 1) scanning electron microscopy (SEM); and 2) whole mount immunofluorescence (WMIF).

Düğüm ve Notochordal plaka Gastrulating fare embriyo Tarama elektron mikroskobu ve bütün Dağı ayirt kullanarak görselleştirme

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Whole Mount Immunohistochemistry in Zebrafish Embryos and Larvae

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. Although many immunohistochemistry protocols have been optimized for mammalian tissue and tissue sections, these protocols often require modification and optimization for non-mammalian model organisms. Zebrafish are increasingly used as a model system in basic, biomedical, and translational research to investigate the molecular, genetic, and cell biological mechanisms of developmental processes. Zebrafish offer many advantages as a model system but also require modified techniques for optimal protein detection. Here, we provide our protocol for whole-mount fluorescence immunohistochemistry in zebrafish embryos and larvae. This protocol additionally describes several different mounting strategies that can be employed and an overview of the advantages and disadvantages each strategy provides. We also describe modifications to this protocol to allow detection of chromogenic substrates in whole mount tissue and fluorescence detection in sectioned larval tissue. This protocol is broadly applicable to the study of many developmental stages and embryonic structures.

Here, we present a protocol for fluorescent antibody-mediated detection of proteins in whole preparations of zebrafish embryos and larvae.

Zebrabalığı Embriyoları ve Larvalarında Tüm Mount Immunohistochemistry

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. ...

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs during early development are technically challenging due to the limiting cell number. Moreover, many approaches require a miRNA of interest to be defined in assays such as northern blotting, microarray, and qPCR. Therefore, the expression of many miRNAs and their isoforms have not been studied during early development. Here, we demonstrate a protocol for small RNA sequencing of sorted cells from early mouse embryos to enable relatively unbiased profiling of miRNAs in early populations of neural crest cells. We overcome the challenges of low cell input and size selection during library preparation using amplification and gel-based purification. We identify embryonic age as a variable accounting for variation between replicates and stage-matched mouse embryos must be used to accurately profile miRNAs in biological replicates. Our results suggest that this method can be broadly applied to profile the expression of miRNAs from other lineages of cells. In summary, this protocol can be used to study how miRNAs regulate developmental programs in different cell lineages of the early mouse embryo.

We describe a technique for profiling microRNAs in early mouse embryos. This protocol overcomes the challenge of low cell input and small RNA enrichment. This assay can be used to analyze changes in miRNA expression over time in different cell lineages of the early mouse embryo.

Erken Fare Embriyolarından Sıralama için Küçük RNA Kütüphanelerinin Hazırlanması

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs ...