Name: visualization of cellular electrical activity in zebrafish early embryos and tumors
Uploaded: 2018-04-25T14:00:00
Description: Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

The research work reported in this publication was supported by the National Institute of General Medical Sciences of the National Institutes of Health under the Award Number R35GM124913, Purdue University PI4D incentive program, and PVM Internal Competitive Basic Research Funds Program. The content is solely the responsibility of the authors and does not necessarily represent the official views of the funding agents. We thank Koichi Kawakami for the Tol2 construct, Michael Lin for the ASAP1 construct, and Leonard Zon for the ubi promoter construct through Addgene.

The zebrafish are housed in an AAALAC-approved animal facility, and all experiments were carried out according to the protocols approved by the Purdue Animal Care and Use Committee (PACUC).
1. Tol2 Transposon Plasmid Construct Preparation
NOTE: Tol2, a transposon that was discovered in medaka fish, has widely been used in the zebrafish research community8,9. It has been successfully adopted to the Gateway site...

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

Although the cellular and tissue level electrical activities during embryonic development and human disease were discovered a long time ago, the in vivo dynamic electrical changes and their biological roles still remain largely unknown. One of the major challenges is to visualize and quantify the electrical changes. Patch clamp technology is a break-through for tracking single cells, but its application to vertebrate embryos is limited because they are composed of many cells. The current chemical voltage dyes ar...

Bioelectricity refers to endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane1. Ionic exchanges across the cellular membrane, and the coupled electrical potential and current changes, are essential for signaling processes of excitable neuronal and muscular cells. In addition, bioelectricity and ion gradients have a variety of other important biological functions including energy storage, biosynthesis, and metabolite transportation. Bioelectrical signaling was also discovered as a regulator of embryonic pattern formation, such as body axes, the cell cycle, and cell differentiation1. Thus, it is critical for understanding many human congenital diseases that result from the mis-regulation of this type of signaling. Although patch clamp has been&#160;widely used for recording single cells, it is still far from ideal for the simultaneous monitoring of multiple cells during embryonic development in vivo. Furthermore, voltage sensitive small molecules are also not ideal for in vivo applications due to their specificities, sensitivities, and toxicities.
The creation of a variety of genetically encoded fluorescent voltage indicators (GEVIs) offers a new mechanism to overcome this issue, and allows for easy application to study embryonic development, even though they were originally intended for monitoring neural cells2,3. One of the currently available GEVIs is the Accelerated Sensor of Action Potentials 1 (ASAP1)4. It is composed of an extracellular loop of a voltage-sensing domain of voltage sensitive phosphatase and a circularly permuted green fluorescent protein. Therefore, ASAP1 allows visualization of cellular electric potential changes (polarization: bright green; depolarization: dark green). ASAP1 has 2 ms on-and-off kinetics, and can track subthreshold potential change4. Thus, this genetic tool allows for a new level of efficacy in real-time bioelectric monitoring in live cells. Further understanding of the roles of bioelectricity in embryonic development and many human diseases, such as cancer, will shed new light on the underlying mechanisms, which is critical for disease treatment and prevention.
Zebrafish have been proven a powerful animal model to study developmental biology and human diseases including cancer5,6. They share 70% orthologous genes with humans, and they have similar vertebrate biology7. Zebrafish provide relatively easy care, a large clutch size of eggs, tractable genetics, easy transgenesis, and transparent external embryonic development, which make them a superior system for in vivo imaging5,6. With a large source of mutant fish lines already present and a fully sequenced genome, zebrafish will provide a relatively&#160;unlimited range of scientific discovery.
To investigate the in vivo real-time electrical activity of cells, we take advantage of the zebrafish model system and ASAP1. In this paper, we describe how to incorporate the fluorescent voltage biosensor ASAP1 into the zebrafish genome using Tol2 transposon transgenesis, and visualize cellular electrical activity during embryonic development, fish larval movement, and in live tumor.

<table>
	<tbody>
		<tr>
			<td>14mL cell culture tubes</td>
			<td>VWR</td>
			<td>60818-725</td>
			<td>E.Coli culture</td>
		</tr>
		<tr>
			<td>Agarose electrophoresis tank</td>
			<td>Thermo Scientific</td>
			<td>Owl B2</td>
			<td>DNA eletrophoresis</td>
		</tr>
		<tr>
			<td>Agarose RA</td>
			<td>Amresco</td>
			<td>N605-500G</td>
			<td>For making the injection gels</td>
		</tr>
		<tr>
			<td>Attb1-ASAP1-F primer</td>
			<td>IDT DNA</td>
			<td>GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAGACGACTGTGAGGTATGAACA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Attb2-ASAP1-R primer</td>
			<td>IDT DNA</td>
			<td>GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGGTTACCACTTCAAGTTGTTTCTTCTGTGAAGCCA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Bright field dissection scope</td>
			<td>Nikon</td>
			<td>SMZ 745</td>
			<td>Dechorionation, microinjection, mounting</td>
		</tr>
		<tr>
			<td>Color camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRc</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Concave slide</td>
			<td>VWR</td>
			<td>48336-001</td>
			<td>For holding fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>Disposable transfer pipette 3.4 ml</td>
			<td>Thermo Scientific</td>
			<td>13-711-9AM</td>
			<td>Fish embryos and water transfer</td>
		</tr>
		<tr>
			<td>Endonuclease enzyme, Not I</td>
			<td>NEB</td>
			<td>R0189L</td>
			<td>For linearizing plasmid DNA</td>
		</tr>
		<tr>
			<td>Epifuorescent compound scope</td>
			<td>Zeiss</td>
			<td>Axio Imager.A2</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Epifuorescent stereo dissection scope</td>
			<td>Zeiss</td>
			<td>Stereo Discovery.V12</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Fluorescent light source</td>
			<td>Lumen dynamics</td>
			<td>X-cite seris 120</td>
			<td>Light source for fluorescence microscopes</td>
		</tr>
		<tr>
			<td>Forceps #5</td>
			<td>WPI</td>
			<td>500342</td>
			<td>Dechorionation and needle breaking</td>
		</tr>
		<tr>
			<td>Gateway BP Clonase II Enzyme mix</td>
			<td>Thermo Scientific</td>
			<td>11789020</td>
			<td>Gateway BP recombination cloning</td>
		</tr>
		<tr>
			<td>Gateway LR Clonase II Plus enzyme</td>
			<td>Thermo Scientific</td>
			<td>12538120</td>
			<td>Gateway LR recombination cloning</td>
		</tr>
		<tr>
			<td>Gel DNA Recovery Kit</td>
			<td>Zymo Research</td>
			<td>D4002</td>
			<td>DNA gel purification</td>
		</tr>
		<tr>
			<td>Loading tip</td>
			<td>Eppendorf</td>
			<td>930001007</td>
			<td>For loading injection solution into capilary needles</td>
		</tr>
		<tr>
			<td>Methylcellulose (1600cPs)</td>
			<td>Alfa Aesar</td>
			<td>43146</td>
			<td>Fish embryo mounting</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Sigma-Aldrich</td>
			<td>M9140</td>
			<td>Suppresses fungal outbreaks in Petri dishes</td>
		</tr>
		<tr>
			<td>Microinjection mold</td>
			<td>Adaptive Science Tools</td>
			<td>TU-1</td>
			<td>To prepare agaorse mold tray for holding fish embryos during injection</td>
		</tr>
		<tr>
			<td>Microinjector</td>
			<td>WPI</td>
			<td>Pneumatic Picopump PV820</td>
			<td>Microinjection injector</td>
		</tr>
		<tr>
			<td>Micro-manipulator</td>
			<td>WPI</td>
			<td>Microinjector mm33 rechts</td>
			<td>Microinjection operation</td>
		</tr>
		<tr>
			<td>Micropipette puller</td>
			<td>Sutter instrument</td>
			<td>P-1000</td>
			<td>For preparing capillary needle</td>
		</tr>
		<tr>
			<td>Mineral oil</td>
			<td>Amresco</td>
			<td>J217-500ml</td>
			<td>For calibrating injection volume</td>
		</tr>
		<tr>
			<td>mMESSAGE mMACHINE SP6 Transcription Kit</td>
			<td>Thermo Scientific</td>
			<td>AM1340</td>
			<td>mRNA in vitro transcription</td>
		</tr>
		<tr>
			<td>Monocolor camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRm</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4020</td>
			<td>Prepare small amount of plasmid DNA</td>
		</tr>
		<tr>
			<td>Plastic Petri dishes</td>
			<td>VWR</td>
			<td>25384-088</td>
			<td>For holding fish or fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>RNA Clean &#38; Concentrator-5</td>
			<td>Zymo Research</td>
			<td>R1015</td>
			<td>mRNA cleaning after in vitro transcription</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>NanoDrop 2000</td>
			<td>For measuring DNA and RNA concentrations</td>
		</tr>
		<tr>
			<td>Stage Micrometer</td>
			<td>Am Scope</td>
			<td>MR100</td>
			<td>Microinjection volume calibration</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td>Bio-Rad</td>
			<td>T100</td>
			<td>DNA amplification for gene cloning</td>
		</tr>
		<tr>
			<td>Thin wall glass capillaries</td>
			<td>WPI</td>
			<td>TW100F-4</td>
			<td>Raw glass for making cappilary needle</td>
		</tr>
		<tr>
			<td>Tol2-exL1 primer</td>
			<td>IDT DNA</td>
			<td>GCACAACACCAGAAATGCCCTC</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>Tol2-exR primer</td>
			<td>IDT DNA</td>
			<td>ACCCTCACTAAAGGGAACAAAAG</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>TOP10 Chemically Competent E. coli</td>
			<td>Thermo Scientific</td>
			<td>C404006</td>
			<td>Used for transformation during gene cloning</td>
		</tr>
		<tr>
			<td>Tricaine mesylate</td>
			<td>Sigma-Aldrich</td>
			<td>A5040</td>
			<td>For anesthetizing fish or fish embryos</td>
		</tr>
		<tr>
			<td>UV trans-illuminator 302nm</td>
			<td>UVP</td>
			<td>M-20V</td>
			<td>DNA visualization</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Thermo Scientific</td>
			<td>2853</td>
			<td>For transformation process of gene cloning</td>
		</tr>
	</tbody>
</table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling processes of excitable neuronal and muscular cells and many other biological processes, such as embryonic developmental patterning. However, there is a need for in vivo electrical activity monitoring in vertebrate embryogenesis. The advances of genetically encoded fluorescent voltage indicators (GEVIs) have made it possible to provide a solution for this challenge. Here, we describe how to create a transgenic voltage indicator zebrafish using the established voltage indicator, ASAP1 (Accelerated Sensor of Action Potentials 1), as an example. The Tol2 kit and a ubiquitous zebrafish promoter, ubi, were chosen in this study. We also explain&#160;the processes of Gateway site-specific cloning, Tol2 transposon-based zebrafish transgenesis, and the imaging process for early-stage fish embryos and fish tumors using regular epifluorescent microscopes. Using this fish line, we found that there are cellular electric voltage changes during zebrafish embryogenesis, and fish larval movement. Furthermore, it was observed that in a few zebrafish malignant peripheral nerve sheath tumors, the tumor cells were generally polarized compared to the surrounding normal tissues.

In a successful injection, more than 50% injected fish embryos will display some degree of green fluorescence&#160;in the somatic cells, and most of them will be positive by Tol2 transposon excise assay (Figure 2). After 2-4 generations of out-cross with wildtype fish (until the fluorescent fish reach 50%, the expected Mendelian ratio), the transgenic fish were used for the imaging experiment to track cell membrane potentials during embryonic development. Fir...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Here, we show the process of creating a cellular electric voltage reporter zebrafish line to visualize embryonic development, movement, and fish tumor cells in vivo.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

The overall goal of this procedure is to create a transgenic zebrafish line that allows the observance of cellular electrical changes during embryogenesis, larval movement, and in tumor genesis. This method could help answer key questions in the developmental biology, physiology, and cancer cell biology fields such as what are the fundamental roles of cellular electrical signaling during embryogenesis and in tumor cells? The main advantage of this technique is that it allows us to track cellular electrical signaling in vivo and in real time.After preparing Tol2 transposase mRNA and injection solution according to the text protocol, the afternoon before injection, set up four to six breeding tanks with at least two males and two females. To reduce the amount of fish waste and to induce a breeding response, avoid feeding the fish in the afternoon. The following morning, remove the prepared injection solution from the negative 80 degree Celsius freezer and place it on ice.Pull the dividers in the fish breeding tanks and allow the fish to mate. In general, fish lay eggs within 20 to 30 minutes. While waiting, using a micropipette puller with the following parameters, pull needles from capillary glass.Use a laboratory wipe to break the end of the needle and create a beveled edge. A smaller diameter is preferred for decreasing embryo mortality. Once the fish have laid eggs, collect them in a 10 centimeter diameter Petri dish.Immediately under the dissection microscope, remove all abnormal embryos and fish waste. Then pipette the fertilized embryos into a prepared 3%agarose injection mold. Remove excess water to help keep the embryos in place.Once all of the rows are filled with viable embryos, arrange them so that the single cells are all oriented at a 45 degree angle horizontally with respect to the needle. This will make injection much easier later. Next, while wearing gloves, use a 20 microliter loading pipette tip to remove five microliters of the prepared construct from the tube on ice.Carefully insert the pipette tip into the back end of the broken capillary tube to where it begins to taper to get the reagent as close to the tip as possible and expel it into the capillary. If there are still air bubbles, shake the needle making sure not to break the tip. Insert the needle straight into the micro injection needle holder and carefully tighten until the needle stays in place.Then adjust the angle to about 45 degrees. Once the needle is prepared and attached, turn on the microscope and gas pressure tank. Adjust the injection volume by using approximately 0.5 PSI for holding and 30 PSI for ejection.Check that the solution ejects from the needle when pressing the pedal. Using a stage micrometer with a drop of mineral oil, adjust the volume and flow of the solution to approximately 10 micrometers in diameter. Ensure that the back pressure allows a small amount of solution to drip out of the needle.If there is not enough back pressure, capillary action will cause liquid to enter the needle and destroy the mRNA. Once the needle is calibrated, insert the needle into the single cell of the fertilized embryos by using the edge of the gel notch to provide a backing that keeps the embryo in place and allows the needle to apply pressure without moving the embryo. Once the tip of the needle is in the single cell, press the pedal to release the desired amount of solution.It is important to inject the solution into the cell, not the yolk, for generating transgenic zebrafish. Repeat this process for all of the embryos. When completed, use a disposal 3.4 milliliter transfer pipette and fish system water to transfer the injected embryos into a labeled dish by rinsing them out of the agarose notch.Store the embryos in a 28.5 degree Celsius incubator to let them develop. Check back throughout the day to remove dead fish embryos and replace the water with 0.1%methylene blue in fish water. Around six to eight hours after injection, use 10 injected fish embryos and the hotshot method to prepare genomic DNA.The following morning, use a dissection microscope with a fluorescent light source to sort out the embryos showing GFP in the non-yolk tissues. These embryos should contain the injected construct. Perform a Tol2 excise assay to check the transposon activity as described previously.If excised plasma can be detected, keep the injected fish embryos and raise them. Otherwise, repeat the Tol2 mRNA synthesis and micro injection process until achieving positive results from the Tol2 excise assay. To image zebrafish embryos, cross-multiple F2 generation founder fish with wild type fish in individual pairs.Collect fish embryos at different desired developmental stages according to the zebrafish staging guide. For the early stage fish embryos in fish system water, under a dissection scope, use a pair of forceps to carefully peel and remove the chorions. Use a disposal transfer pipette to transfer a few embryos into a concave glass slide with 3%methylcellulose.Then using a needle underneath a dissection scope, adjust the embryos to the desired positions to view the cellular GFP activity. For embryos at the less than 12 somite stage, use an epifluorescence compound microscope with a compatible camera and software for imaging. For embryos past the 12 somite stage, use a fluorescence dissection microscope.To image tumor cell voltage, first identify fish with Malignant Peripheral Nerve Sheath Tumors or MPNST. Place the fish into a 10 centimeter diameter Petri dish and carry out whole mount imaging. Finally following imaging, dissect out the tumor before viewing the tumor cell electrical activity.In a successful injection, more than 50%of injected embryos will display some degree of GFP in the somatic cells and most of them will show a positive result from the Tol2 transposon excise assay. Here membrane potential changes were examined throughout the cell cycle during zebrafish early embryonic development. As seen in this timelapse video, the cells hyperpolarized before formation of the cleavage furrow.Moreover, different tissues showed a variety of membrane potentials in one to three-day-old fish embryos. For example, the somite and notocord were generally hyperpolarized compared to the adjacent tissues and organs. In this two-day-old fish embryo, neuromuscular electrical activities are shown during movement with color density changes corresponding to the electric signaling transduction.Bioelectrical properties of cancer cells were examined in embryos from crosses of ASAP1 reporter fish with an RPL35 mutant which is prone to spontaneous MPNST. Compared to surrounding tissues, tumor cells were more polarized. Once mastered, this micro injection technique can be done in about three hours if performed properly.While attempting this procedure, it is important to remember that the zebrafish embryos should be in the one cell stage for ideal results. With its development, this technique paves the way for researchers in the field of developmental biology and cell biology to explore in vivo electrical signaling changes in zebrafish and other model organisms. After watching this video, you should have a good understanding of how to create a transgenic zebrafish line by micro injection.

visualization-cellular-electrical-activity-zebrafish-early-embryos

Research

JoVE Journal

Developmental Biology

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological systems. In FDAP experiments, the clearance of proteins within living organisms can be measured. A protein of interest is tagged with a photoconvertible fluorescent protein, expressed in vivo and photoconverted, and the decrease in the photoconverted signal over time is monitored. The data is then fitted with an appropriate clearance model to determine the protein half-life. Importantly, the clearance kinetics of protein populations in different compartments of the organism can be examined separately by applying compartmental masks. This approach has been used to determine the intra- and extracellular half-lives of secreted signaling proteins during zebrafish development. Here, we describe a protocol for FDAP experiments in zebrafish embryos. It should be possible to use FDAP to determine the clearance kinetics of any taggable protein in any optically accessible organism.

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion FDAP

Protein levels in cells and tissues are often tightly regulated by the balance of protein production and clearance. Using Fluorescence Decay After Photoconversion (FDAP), the clearance kinetics of proteins can be experimentally measured in vivo.

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos. 
Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and zebrafish embryos. Our system comprises a chamber featuring a simple setup that is nevertheless robust to induce and maintain a specific oxygen concentration and temperature in any experimental solution of choice. The presented system is very cost-effective but highly functional, it allows induction and sustainment of hypoxia for direct experiments in vivo and for various time periods up to 48 h.
To monitor and study the effects of hypoxia, we have employed two methods - measurement of levels of hypoxia-inducible factor 1alpha (HIF-1&#945;) in whole embryos or specific tissues and determination of retinal stem cell proliferation by 5-ethynyl-2&#8242;-deoxyuridine (EdU) incorporation into the DNA. HIF-1&#945; levels can serve as a general hypoxia marker in the whole embryo or tissue of choice, here embryonic retina. EdU incorporation into the proliferating cells of embryonic retina is a specific output of hypoxia induction. Thus, we have shown that hypoxic embryonic retinal progenitors decrease proliferation within 1 h of incubation under 5% oxygen of both frog and zebrafish embryos.
Once mastered, our setup can be employed for use with small aquatic model organisms, for direct in vivo experiments, any given time period and under normal, hypoxic or hyperoxic oxygen concentration or under any other given gas mixture.

We introduce a novel hypoxic chamber system for use with aquatic organisms such as frog and zebrafish embryos. Our system is simple, robust, cost-effective and allows the induction and sustainment of hypoxia in vivo and for up to 48 h. We present 2 reproducible methods to monitor the effectiveness of hypoxia.

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Multi-Photon Time Lapse Imaging to Visualize Development in Real-time: Visualization of Migrating Neural Crest Cells in Zebrafish Embryos

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to numerous cell types throughout the body. Understanding the biology of the neural crest has been limited, reflecting a lack of genetically tractable models that can be studied in vivo and in real-time. Zebrafish is a particularly important developmental model for studying migratory cell populations, such as the neural crest. To examine neural crest migration into the developing eye, a combination of the advanced optical techniques of laser scanning microscopy with long wavelength multi-photon fluorescence excitation was implemented to capture high-resolution, three-dimensional, real-time videos of the developing eye in transgenic zebrafish embryos, namely Tg(sox10:EGFP) and Tg(foxd3:GFP), as sox10 and foxd3 have been shown in numerous animal models to regulate early neural crest differentiation and likely represent markers for neural crest cells. Multi-photon time-lapse imaging was used to discern the behavior and migratory patterns of two neural crest cell populations contributing to early eye development. This protocol provides information for generating time-lapse videos during zebrafish neural crest migration, as an example, and can be further applied to visualize the early development of many structures in the zebrafish and other model organisms.

A combination of the advanced optical techniques of laser scanning microscopy with long wavelength multi-photon fluorescence excitation was implemented to capture high-resolution, three-dimensional, real-time imaging of neural crest migration in Tg(sox10:EGFP) and Tg(foxd3:GFP) zebrafish embryos.

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is the formation of the transient organizers, the node and notochordal plate, from cells that have passed through the primitive streak. The proper formation of these signaling centers is essential for the development of the body plan and techniques to visualize them are of high interest to mouse developmental biologists. The node and notochordal plate lie on the ventral surface of gastrulating mouse embryos around embryonic day (E) 7.5 of development. The node is a cup-shaped structure whose cells possess a single slender cilium each. The proper subcellular localization and rotation of the cilia in the node pit determines left-right asymmetry. The notochordal plate cells also possess single cilia albeit shorter than those of the node cells. The notochordal plate forms the notochord which acts as an important signaling organizer for somitogenesis and neural patterning. Because the cells of the node and notochordal plate are transiently present on the surface and possess cilia, they can be visualized using scanning electron microscopy (SEM). Among other techniques used to visualize these structures at the cellular level is whole mount immunofluorescence (WMIF) using the antibodies against the proteins that are highly expressed in the node and notochordal plate. In this report, we describe our optimized protocols to perform SEM and WMIF of the node and notochordal plate in developing mouse embryos to help in the assessment of tissue shape and cellular organization in wild-type and gastrulation mutant embryos.

The node and notochordal plate are transient signaling organizers in developing mouse embryos that can be visualized using several techniques. Here, we describe in detail how to perform two of the techniques to study their structure and morphogenesis: 1) scanning electron microscopy (SEM); and 2) whole mount immunofluorescence (WMIF).

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Whole Mount Immunohistochemistry in Zebrafish Embryos and Larvae

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. Although many immunohistochemistry protocols have been optimized for mammalian tissue and tissue sections, these protocols often require modification and optimization for non-mammalian model organisms. Zebrafish are increasingly used as a model system in basic, biomedical, and translational research to investigate the molecular, genetic, and cell biological mechanisms of developmental processes. Zebrafish offer many advantages as a model system but also require modified techniques for optimal protein detection. Here, we provide our protocol for whole-mount fluorescence immunohistochemistry in zebrafish embryos and larvae. This protocol additionally describes several different mounting strategies that can be employed and an overview of the advantages and disadvantages each strategy provides. We also describe modifications to this protocol to allow detection of chromogenic substrates in whole mount tissue and fluorescence detection in sectioned larval tissue. This protocol is broadly applicable to the study of many developmental stages and embryonic structures.

Here, we present a protocol for fluorescent antibody-mediated detection of proteins in whole preparations of zebrafish embryos and larvae.

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. ...

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs during early development are technically challenging due to the limiting cell number. Moreover, many approaches require a miRNA of interest to be defined in assays such as northern blotting, microarray, and qPCR. Therefore, the expression of many miRNAs and their isoforms have not been studied during early development. Here, we demonstrate a protocol for small RNA sequencing of sorted cells from early mouse embryos to enable relatively unbiased profiling of miRNAs in early populations of neural crest cells. We overcome the challenges of low cell input and size selection during library preparation using amplification and gel-based purification. We identify embryonic age as a variable accounting for variation between replicates and stage-matched mouse embryos must be used to accurately profile miRNAs in biological replicates. Our results suggest that this method can be broadly applied to profile the expression of miRNAs from other lineages of cells. In summary, this protocol can be used to study how miRNAs regulate developmental programs in different cell lineages of the early mouse embryo.

We describe a technique for profiling microRNAs in early mouse embryos. This protocol overcomes the challenge of low cell input and small RNA enrichment. This assay can be used to analyze changes in miRNA expression over time in different cell lineages of the early mouse embryo.

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs ...

Generation of Na&#239;ve Blastoderm Explants from Zebrafish Embryos

Due to their optical clarity and rapid development, zebrafish embryos are an excellent system for examining cell behaviors and developmental processes. However, because of the complexity and redundancy of embryonic signals, it can be challenging to discern the complete role of any single signal during early embryogenesis. By explanting the animal region of the zebrafish blastoderm, relatively na&#239;ve clusters of embryonic cells are generated that can be easily cultured and manipulated ex vivo. By introducing a gene of interest by RNA injection before explantation, one can assess the effect of this molecule on gene expression, cell behaviors, and other developmental processes in relative isolation. Furthermore, cells from embryos of different genotypes or conditions can be combined in a single chimeric explant to examine cell/tissue interactions and tissue-specific gene functions. This article provides instructions for generating zebrafish blastoderm explants and demonstrates that a single signaling molecule - a Nodal ligand - is sufficient to induce germ layer formation and extension morphogenesis in otherwise na&#239;ve embryonic tissues. Due to their ability to recapitulate embryonic cell behaviors, morphogen gradients, and gene expression patterns in a simplified ex vivo system, these explants are anticipated to be of great utility to many zebrafish researchers.

Generation of Na&amp;#239;ve Blastoderm Explants from Zebrafish Embryos

Zebrafish blastoderm explants are generated by isolating embryonic cells from endogenous signaling centers within the early embryo, producing relatively na&#239;ve cell clusters easily manipulated and cultured ex vivo. This article provides instructions for making such explants and demonstrates their utility by interrogating roles for Nodal signaling during gastrulation.

Due to their optical clarity and rapid development, zebrafish embryos are an excellent system for examining cell behaviors and developmental processes. ...

Real Time and Repeated Measurement of Skeletal Muscle Growth in Individual Live Zebrafish Subjected to Altered Electrical Activity

A number of methods can be used to visualize individual cells throughout the body of live embryonic, larval or juvenile zebrafish. We show that live fish with fluorescently-marked plasma membranes can be scanned in a confocal laser scanning microscope in order to determine the volume of muscle tissue and the number of muscle fibers present. Efficient approaches for the measurement of cell number and size in live animals over time are described and validated against more arduous segmentation methods. Methods are described that permit the control of muscle electrical, and thus contractile, activity. Loss of skeletal muscle contractile activity greatly reduced muscle growth. In larvae, a protocol is described that allows reintroduction of patterned electrical-evoked contractile activity. The described methods minimize the effect of inter-individual variability and will permit analysis of the effect of electrical, genetic, drug, or environmental stimuli on a variety of cellular and physiological growth parameters in the context of the living organism. Long-term follow-up of the measured effects of a defined early-life intervention on individuals can subsequently be performed.

Optical clarity is a major advantage for cell biological and physiological work in zebrafish. Robust methods for measurement of cell growth in individual animals are described that permit novel insights into how growth of skeletal muscle and neighboring tissues are integrated with whole body growth.

A number of methods can be used to visualize individual cells throughout the body of live embryonic, larval or juvenile zebrafish. We show that live fish ...

Investigating Development with Optogenetic Signaling Manipulation in Zebrafish

Optogenetic Signaling Activation in Zebrafish Embryos

Signaling pathways orchestrate fundamental biological processes, including development, regeneration, homeostasis, and disease. Methods to experimentally manipulate signaling are required to understand how signaling is interpreted in these wide-ranging contexts. Molecular optogenetic&#160;tools can provide reversible, tunable manipulations of signaling pathway activity with a high degree of spatiotemporal control and have been applied in vitro, ex vivo, and in vivo. These tools couple light-responsive protein domains, such as the blue light homodimerizing light-oxygen-voltage sensing (LOV) domain, with signaling effectors to confer light-dependent experimental control over signaling. This protocol provides practical guidelines for using the LOV-based bone morphogenetic protein (BMP) and Nodal signaling activators bOpto-BMP and bOpto-Nodal in the optically accessible early zebrafish embryo. It describes two control experiments: A quick phenotype assay to determine appropriate experimental conditions, and an immunofluorescence assay to directly assess signaling. Together, these control experiments can help establish a pipeline for using optogenetic tools in early zebrafish embryos. These strategies provide a powerful platform to investigate the roles of signaling in development, health, and physiology.

Author Spotlight: Manipulating Signaling in Zebrafish Embryos to Decode Cell Fate Decisions 

Optogenetic manipulation of signaling pathways can be a powerful strategy to investigate how signaling is decoded in development, regeneration, homeostasis, and disease. This protocol provides practical guidelines for using light-oxygen-voltage sensing domain-based Nodal and bone morphogenic protein (BMP) signaling activators in the early zebrafish embryo.

Signaling pathways orchestrate fundamental biological processes, including development, regeneration, homeostasis, and disease. Methods to experimentally ...