Wir möchten Monte Westerfield, Makoto Kobayashi und Jacek Topczewski für die Gaben der Plasmide danken für in-situ-Hybridisierung und mRNA Mikroinjektion. Wir bedanken uns bei Steph Erhard für seinen Einsatz in dem Video. Wir möchten auch die Hilfe von William Goossens mit der konfokalen Mikroskopie in dem Video gezeigt anerkennen. Tyler Schwend bereitgestellten Bilder in dem Video verwendet wird, und Rodney Dale mit Vorbereitung auf das Video unterstützt. Wir erkennen auch die CMRC Tierpfleger für die Zucht Arbeit mit dem Zebrafisch. Diese Arbeit wurde vom NIH R21 AA13596 zu SCA finanziert.

1. Ethanol Behandlung der Embryonen <ol><li> Zebrafisch-Embryonen aus Wildtyp-Paarungen abgeleitet wurden bei 28 ° C erhöht, in 5 ml Wasser Embryo. (Milli-Q Wasser mit 60 mg / L Instant Ocean). Verschiedene Stämme von Wildtyp-Embryonen haben leicht unterschiedliche Toleranzen, um die Exposition 9 Ethanol. </li><li> Die Exposition gegenüber Ethanol wurde bei Kuppel Stufe (~ 4,3 Stunden nach der Befruchtung, HPF) für die gewünschte Zeitdauer eingeleitet, bis zu 24 h Puls. Diese Startphase ist etwa vergleichbar mit der Implantation der Bühne von Säugetier-Embryonen, kurz vor der Gastrulation. Ethanol verwendeten Konzentrationen reichen von 0,2% -2,5%, Volumen / Volumen. Tests haben gezeigt, dass 25-50% der Lösung in dem Wasser am Ende in den sich entwickelnden Embryo 10, 11. Die Embryonen werden bei 28 ° C für die gewünschte Zeitdauer gehalten. Nach der gewünschten Länge von Ethanolexposition wird das Ethanol-Wasser-Lösung entfernt und mit drei Wäschen mit regelmäßigen Zebrafisch Wasser ersetzt und gehalten for die gewünschte Länge der Zeit. Die Spezifität des Mangels hängt von der Zeit des Beginns, der Dosis und der Länge des Pulses von Ethanol. </li></ol> 2. Sammlung von Embryonen für die RNA in situ Hybridisierung, Antikörper und Knorpel Färbung <ol><li> Um mRNA für die qPCR sammeln, sind gleichaltrigen Embryonen in Eppendorf-Röhrchen gesammelt. Nach dem Entfernen des Zebrafisch Wasser, Lysepuffer mit TCEP zugegeben. Eine motorisierte pulverisiert wird verwendet, um physisch distanzieren die Embryonen in der Lyse-Lösung. Dieses wird dann durch eine Preclear Spalte, die keine große Stücke entfernt undissoziierten geleitet. Die resultierende Lösung enthält alle Makromoleküle durch die Lyse freigesetzt. RNA wird dann, indem Sie diese Lösung auf einer Säule, gefolgt von Waschungen und DNAse-Behandlung extrahiert. Die Elution wird dann unter Verwendung von entweder Wasser oder einer Elutionslösung vom Hersteller (5&#39;-Prime) vorgesehen ist. Die RNA kann, um cDNA umgewandelt werden unter Verwendung von Standardtechniken für die qPCR oder Mikroorganismen eingesetztArray-Analyse. </li><li> Für die in situ Hybridisierung und Antikörper-Färbung, Embryonen 6-24 hpf wurden in 4% Paraformaldehyd über Nacht bei 4 ° C fixiert Dies wird mit 3 Waschschritten in PBS + 0,1% Tween (PBT), Embryonen aus aneinander haften gefolgt. Die Embryonen werden dann durch eine Reihe von 3 Methanol übertragen: PBT wäscht in 100% Methanol, an welcher Stelle sie bei -20 ° C gelagert werden können Diese Embryonen können in situ-Hybridisierung oder Antikörper-Färbung verwendet werden. Einige Antikörper funktionieren nicht nach Methanol-Behandlung, so dass diese Einschränkung zu berücksichtigen und Ihre spezifischen Antikörper getestet, um festzustellen, ob es nach der Behandlung mit Methanol wird funktionieren muss. </li><li> Für Knorpel-Färbung, müssen Embryonen Anspruch 5 oder 6 Tagen nach der Befruchtung (dpf) angehoben werden. Sie werden dann in 4% Paraformaldehyd über Nacht bei 4 ° C, gefolgt von 3 Waschschritten in PBT. </li></ol> 3. Die Beurteilung Ethanol-induzierte Veränderungen der Genexpression und Entwicklungsfolgen <ol><li&gt; Um festzustellen, welche die Genexpression haben sich geändert, Zielgenen werden sowohl qPCR und in situ Hybridisierung untersucht. qPCR wird erreicht unter Verwendung von Primern mit Integrated DNA Technologies (IDT)-Software, dann validiert mit 3 separaten biologischen Proben entwickelt. Sobald Primer validiert wurden, wird auf qPCR cDNA aus RNA-Proben gesammelt erstellt durchgeführt. Jede Probe wird in dreifacher Ausfertigung durchgeführt. PCR-Reaktionen werden Platinum SYBR Green qPCR Super Mix (Invitrogen) auf einer Chroma-4 PCR-Maschine (BioRad) oder ähnliche PCR-Maschine mit einer Multicolor Detection System laufen. Zusätzlich zu den Genen verhört, ist es entscheidend, dass eine Steuerung der Primer festgelegt wird verwendet, um kleine Unterschiede in der cDNA oder RNA-Präparation auszugleichen. Für unsere Zebrafischembryonen verwenden wir GAPDH: 5&#39;GAAGGTGGGAAACTGGTCAT3 &#39;und 5&#39;TTGCACCACCCTTAATGTGA3&#39;. Gene, die analysiert werden dann an ein GAPDH normalisiert die relative Quantifizierung der Genexpression berechnet sich nach Pfaffl Methode Variante 2 <sup&gt; - Ct, die Anzeige von Daten wie fache Differenz in der experimentellen Vergleich zum Wildtyp-12. Die normalen Berechnung nimmt an, dass alle Gene Duplizieren der DNA zweimal für jeden Zyklus, und drückt somit die Daten als Verhältnis der Änderung im experimentellen Gens über die Änderung der Bezugs-Gen, ausgedrückt als Leistungsberechnungen über die ganze Zahl &quot;2&quot;, welches die Effizienz der Verdoppelung der DNA pro Zyklus in einer perfekten PCR-Reaktion zu sehen. Der Pfaffl Methode ersetzt den generischen &quot;2&quot; mit dem Experimentator erzeugt echte Effizienz für die PCR-Primer gewählt. Er berücksichtigt genaueres Bild der Differenz in den PCR-Reaktionen. Die vollständige Formel lautet: <table border="0"><tbody><tr><td> (Wirksamkeit der experimentellen Gen) (CT Kontrolle Probe-Ct von behandelten Probe) </td></tr><tr><td> -------------------------------------------------- ----------------------------------- </td></tr><tr><td> (Effizienz des Referenz-Gen) (CT vonKontrollprobe - Ct von behandelten Probe) </td></tr></tbody></table></li><li> Für die in situ Hybridisierung, Digoxigenin (DIG)-markierte Ribosonden aus Plasmiden, die Abschnitte des Gens von Interesse ausgebildet ist. Alter zusammenpassende Embryonen auf Ribosonden unter Verwendung von Standardbedingungen 13 ausgesetzt und unter Verwendung von Anti-DIG-Antikörper gekoppelt ist, um alkalische Phosphatase, die den Standort der markierte Ribosonden Verwendung einer Farbreaktion (NBT / BCIP) ermöglicht. Die Embryonen werden dann visualisiert mit einem Leica Binokular (Abbildung 1B-G). </li><li> Um morphogenetische Entwicklung zu beurteilen, werden Embryonen zur gewünschten Zeit gesammelt und unter dem Binokular. Für Somiten Form, sind Live-Embryonen 14 abgebildet. Für Inter Augenabstand und Körperlänge, sind Embryonen in PFA fixiert. In allen Fällen werden die Bilder des gewünschten Bereichs auf einem Präpariermikroskop mit einer festen Vergrößerung und Messungen mit Adobe Photoshop softwar erfasste 10,14. </li><li> Um die Auswirkungen der Behandlung auf die Entwicklung von Knorpel-Strukturen im Larvenstadium Zebrafisch zu untersuchen, benutzen wir Alcianblaufärbung. 20% Eisessig (Säure-Alkohol) für mehrere Stunden oder über Nacht: Fixed Zebrafischlarven sind mit Alcianblau-Lösung in 80% Ethanol gelöst behandelt. Die Larven werden in mehreren Waschungen mit Säure-Alkohol bevor sie in eine 1% KOH übertragen entfärbt: 3% Wasserstoffperoxid-Lösung für weitere Abwicklung von Pigmentzellen. Zebrafisch müssen mindestens 4 Tage alt, um Knorpel-Strukturen zeigen sein, und diese werden besser in den Fischen, die 5 oder 6 Tage alt sind definiert. </li><li> Der Zelltod in lebenden Embryonen wird anhand Acridinorange (AO). AO ist zellpermeablen, lebende Zellen, und bindet an DNA in Zellen mit eingeschränkter Membranen, einschließlich der Apoptose und Nekrose. Leben Embryonen werden mit 5 mg / ml AO in PBS für 1 Stunde inkubiert, gefolgt von 3 Waschschritten in PBS. Die Embryonen werden dann bebildert mit dem konfokalen Mikroskop. Digitale Z-Sern Bilder werden kombiniert, um Verbundwerkstoffe zu schaffen. </li></ol> 4. Manipulation des Zebrafisch-Embryos <ol><li> Nach der Identifizierung von Genen, die durch Ethanolexposition verringert werden, ist es möglich, zu versuchen, sie zu ersetzen durch Injektion von mRNA konstruiert, um die fehlende Gen zu ersetzen. Capped mRNA von linearisierten DNA-Plasmide unter Verwendung von RNA-Polymerase in vitro-Transkription-Kits transkribiert, nach den Anweisungen des Herstellers (mMessage Maschine, Applied Biosystems). Zwischen 25 bis 200 pg / nl von RNA in 1-2 Zell-Stadium Zebrabärblingeier injiziert, in einer Lösung von 0,1 M KCl. Die Embryonen werden dann absetzen gelassen, mit Ethanol behandelt, wie oben (5) beschrieben erholen. </li><li> Für alle, die durch Gen-Transkripte Ethanolexposition erhöht werden, können sie reduziert werden, oder &quot;Knocked Down&quot; mit einem Antisense-Morpholino-Technologie. Antisense Morpholinos (AMO) werden von der Firma Gene-Tools entwickelt, und blockieren die Translation von RNA in Protein oder block die Reifung und Spleißen von RNA, je nach Notwendigkeit experimentellen. Diese Aktion von Morpholinos beschränken die Menge an aktivem Protein für das Gen gezielt, ein Defizit, gemessen mit anitibodies werden können, wenn sie verfügbar sind. Die Effizienz der RNA-Spleißen Morpholinos gemessen mittels RT-PCR, die relativen Mengen der gespleißten und ungespleißten Transkripten zu detektieren. Titrieren der Morpholino kann in dosisabhängige Aktivität 15 zur Folge haben. Amos sind auf die Zusammenarbeit Konzentrationen (pg bis ng titriert Konzentration) in Danieau Lösung (58 mM NaCl, 0,7 mM KCl, 0,4 mM MgSO 4, 0,6 mM Ca (NO 3) 2, 5 mM HEPES, pH 7,6) verdünnt. Die Einspritzung erfolgt an der 1-2-Zellen-Stadium, dann werden die Embryonen erlaubt, bevor sie einer Wärmebehandlung wie oben Ethanol zu entwickeln. </li></ol> 5. Repräsentative Ergebnisse Zebrafisch-Embryo Exposition gegenüber Ethanol führt zu einer Reihe von Entwicklungs-und genetischen Defekten, die verwandt sinddie Phänotypen in anderen Wirbeltieren gefunden. Wir haben eine abnorme Entwicklung der axialen Gewebe dokumentiert, einschließlich der Chorda (Daten nicht gezeigt 14). Die Entwicklungsverzögerung durch Ethanol führt anscheinend zu einer Störung der ordnungsgemäßen Chorda Dehnung, was zu einer verkürzten und gelegentlich gestört Chorda (Daten nicht gezeigt 14). Diese frühe Verzögerung und Chorda Defekt führt wahrscheinlich zum Teil auf den späteren Auffälligkeiten in den Somiten (Abb. 2), die ihre starke Form Chevron verloren haben, als in den unbehandelten Kontrollen gesehen und sind näher an den U-förmigen Somiten Merkmal der Phänotypen gesehen, wenn Sonic-Signalisierung wird 14 reduziert. Der Winkel der Somiten kann unter Verwendung von Standard-Software, und die Winkel erhöht sich von 92,1 ± 4,6 ° in den unbehandelten Kontrollen auf 122,6 ± 6,6 ° in den Ethanol-behandelten Embryonen (p &lt;0,001) werden. Eine weitere Folge von Ethanolexposition die downstrea sein könntenm frühen Entwicklungsverzögerung und später Chorda Mängel ist eine verkürzte Länge des Embryos (Abbildung 3). Wobei auch der Embryonen zu berücksichtigen die Krümmung durch Ethanolexposition hergestellt führt Ethanolexposition zu einer verkürzten Stamm, der abhängig von der Dosis der Embryo Ethanol ausgesetzt war ist (3E 14). Dieses Ergebnis ist vergleichbar mit der Persistenz der Vorpubertät Kleinwuchs bei Kindern, die Ethanol ausgesetzt während der Entwicklung 16, 17 gefunden, was darauf hindeutet, dass das Zebrafisch-Modell relevant für das Verständnis des menschlichen Geburtsfehler ist. Eines der klassischen Merkmale des FAS ist ein klassisches Fazies, einschließlich einer reduzierten Kiefer, kleine Augen öffnen, und eine glatte Philtrum. Ein Großteil dieser Funktionen werden zu einer Reduktion in der Mittellinie Gewebe. Es wurde in Tiermodellen gezeigt worden, dass schwere Ethanolexposition noch stärker Phänotypen, einschließlich synopthalmia und Zyklopie führt. Wenn exposingen Zebrafischembryonen höhere Dosen von Ethanol sinkt der intraokularen Abstand (IOD) in einer dosisabhängigen Art und Weise (Abbildung 4) im Einklang mit der Natur des menschlichen Geburtsfehler. Cyclopia nur bei sehr hohen Dosen vor, aber niedriger Dosis muss eine signifikante Reduktion in der IOD (4) zu erzeugen, was darauf hindeutet, dass dieses Tiermodell einen ähnlichen Defekt in der Mitte, Gesichtsentwicklung 10 aufweist. Um den zugrunde liegenden Mechanismus der Mängel sowohl in der Körper und das Gesicht von Ethanol produziert Exposition zu verstehen, haben wir versucht, Veränderungen der Genexpression, die früh in der Entwicklung auftreten und dass aller Voraussicht nach zu später Entwicklungsstörungen beitragen werden, zu etablieren. Wir tun dies in zweierlei Hinsicht, ermöglicht die Extraktion von mRNA, die aus Embryonen für eine quantitative Auswertung der Ebenen der Genexpression in Ethanol behandelt Embryonen im Vergleich zur Kontrollgruppe (Abbildung 1A). Darüber hinaus können wir in situ durchführenHybridisierung an das Muster von Genen zu suchen, unabhängig davon, ob das Signal verringert wird (1B-G 18). In diesem Beispiel sind zwei Gene, deren Expression nach Exposition gegenüber Ethanol verringert gezeigt, Gli1 und six3b. Wenn wir die in-situ-Muster für six3b untersucht Versuch es eine Verringerung der räumlichen Ausdehnung der Expression dieses Gens (1 Zum Beispiel) in Embryonen, die Ethanol ausgesetzt. Eine ähnliche Reduktion wurde in der GSC-Gen (Abb. BD) gefunden. Sowohl six3b und GSC sind in Geweben bestimmt, zu kraniofazialen Mittellinie Geweben beitragen ausgedrückt. So Reduktion dieser Gene bei 8 hpf steht im Einklang mit der Verringerung der IOD weiter hinten, wie in 4 gezeigt. Wenn Gene, die durch Ethanol beeinflusst identifiziert sind, gibt es Mechanismen, durch den die Expression von ihnen erhöht oder verringert werden kann. In diesem speziellen example, haben wir zwei Gene, die sind zurückgegangen (Gli1 und six3b) durch qPCR gezeigt. Wir entschieden uns, mRNA zu injizieren, um festzustellen, ob die Umkehr dieser Genveränderungen Ergebnisse verbessern können. Für dieses Experiment statt Injektion Gli1, entschieden wir uns zu sch, ein Ligand, der Gli1 Ebenen erhöht injizieren. Für six3b, konnten wir six3b selbst zu injizieren. Wir fanden keine Veränderungen, wenn wir six3b (Daten nicht gezeigt) injiziert, sondern konnten sich retten, die grundsätzlich grobe Mängel in Zebrafisch-Embryos mit zusätzlichen Injektionen shh (Abbildung 5). <img alt="1" src="/files/ftp_upload/3704/3704fig1.jpg" /> Abbildung 1. Ethanolexposition ändert die frühen Muster und Genexpression von ausgewählten Entwicklungs-Genen. A) qPCR-Ergebnisse für Embryonen im 8hpf. Die Ergebnisse für zwei Gene werden angezeigt: six3b und Gli1. Ergebnisse als Mittelwert von drei getrennten Experimenten gezeigt,und die Dosis von Ethanol dargestellt beträgt 2,5%. Beide Gene sind in einer Weise, die signifikante Steuerung (t-Test, p &lt;0,05) reduziert ist. BG) In situ Hybridisierung von 8 hpf Zebrabärblinge. Sowohl GSC und six3b Muster werden zu diesem Zeitpunkt im Vergleich zur Kontrollgruppe verändert. (Modifiziert mit Erlaubnis von Loucks et al. 2007). <img alt="2" src="/files/ftp_upload/3704/3704fig2.jpg" /> Abbildung 2. Somitenentwicklung wird in den behandelten Embryonen verändert. Somiten Struktur und Winkel bei 48 HPF untersucht. In der Kontrollgruppe Embryonen (A) haben Somiten eine Chevron-Form und einen spitzen Winkel. Ethanol ausgesetzt Zebrafisch haben mehr I-oder U-förmigen Somiten, und weniger scharfen Winkeln. (Modifiziert mit Erlaubnis von Loucks und Ahlgren 2009). <img alt="Abbildung 3" src="/files/ftp_upload/3704/3704fig3.jpg" /> Abbildung 3. Ethanol Behandlung signifikant abnimmt Körperlänge im Zebrafisch.Die Länge der unbehandelten und Ethanol-exponierten Embryonen wurden nach 5 Tagen der Befruchtung gemessen. Eine signifikante Reduktion in der Länge wurde bei allen behandelten Embryonen gesehen (ANOVA, p &lt;0,001). BD. Es gab eine geringe, aber signifikante Verringerung der Gesamtlänge von Embryonen mit 1,0% und 1,5% Ethanol behandelt, während eine größere Verringerung der Embryonen mit 2,0% und 2,5% Ethanol dosiert zu sehen war. E. Zur Größenunterschiede in jeder Kupplung zu steuern, wurden die Embryonen Steuerelement für jedes Experiment auf 100 normiert, und Geschwister-behandelten Embryonen als Prozentsatz von 100 ausgedrückt. (Modifiziert mit Erlaubnis von Loucks und Ahlgren 2009). <img alt="Abbildung 4" src="/files/ftp_upload/3704/3704fig4.jpg" /> Abbildung 4. Ethanolexposition führt zu einer Verringerung des intraokularen Abstand (IOD) in Zebrafisch-Embryos. A) Frontalansichten von Embryonen zeigen normalen und fusionierten Auge Phänotypen. B) Unterschiedliche Dosierungen von Ethanol für 3 Stunden während der Gastrulation res verabreichtultate in IOD verringert, wenn der Fisch 24 Stunden später untersucht werden. Fused Augen und Zyklopie sind nur bei der höchsten getesteten Dosis (2,4%) gesehen. * Kennzeichnet eine signifikante Reduktion der IOD im Vergleich zur Kontrollgruppe. (Modifiziert mit Erlaubnis von Ahlgren, 2004). <img alt="Abbildung 5" src="/files/ftp_upload/3704/3704fig5.jpg" /> Abbildung 5. Shh-N-mRNA-Injektion rettet die grobe Mängel, die durch Ethanol Exposition von Zebrabärbling produziert. Eins-zwei Embryonen wurden mit 100 pg / nl Shh-N-mRNA und die Hälfte der injizierten Embryonen wurden zu den Standard-Ethanol-Dosen von 4,3 bis 24 HPF ausgesetzt injiziert. Die Embryonen wurden bei 5 dpf analysiert. Embryonen mit 2,0% Ethanol behandelt aufweisen dorsal kürzere Schwänze, I-förmigen Somiten, und Augen-Defekte einschließlich Zyklopie gekrümmt. Rettung dieser Phänotypen ist in 71/76 der injizierten Embryonen (93%) gesehen. In diesen Embryonen, wird der Körper gerade, sind die Chevron-förmige Somiten, und die Augen sind vollständig getrennt.

<ol>
	<li>Streissguth, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fetal+alcohol+syndrome+in+adolescents+and+adults.">Fetal alcohol syndrome in adolescents and adults.</a> Jama. 265 (15), 1961-1967 (1991).</li><li>Floyd, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Observations+from+the+CDC.+Preventing+alcohol-exposed+pregnancies+among+women+of+childbearing+age:+the+necessity+of+a+preconceptional+approach.">Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach.</a> J. Womens Health Gend. Based Med. 8 (6), 733-736 (1999).</li><li>Ali, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+analysis+of+acute+ethanol+exposure+in+zebrafish+development:+a+critical+time+window+and+resilience.">Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience.</a> PLoS One. 6 (5), e20037-e20037 (2011).</li><li>Dlugos, C. A., Rabin, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+functional+effects+of+developmental+exposure+to+ethanol+on+the+zebrafish+heart.">Structural and functional effects of developmental exposure to ethanol on the zebrafish heart.</a> Alcohol Clin. Exp. Res. 34 (6), 1013-1021 (2010).</li><li>Fernandes, Y., Gerlai, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+behavioral+changes+in+response+to+early+developmental+exposure+to+ethanol+in+zebrafish.">Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish.</a> Alcohol Clin. Exp. Res. 33 (4), 601-609 (2009).</li><li>Bilotta, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+embryonic+exposure+to+ethanol+on+zebrafish+visual+function.">Effects of embryonic exposure to ethanol on zebrafish visual function.</a> Neurotoxicol. Teratol. 24 (6), 759-766 (2002).</li><li>Tanguay, R. L., Reimers, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+ethanol+developmental+toxicity+in+zebrafish.">Analysis of ethanol developmental toxicity in zebrafish.</a> Methods Mol. Biol. 447, 63-74 (2008).</li><li>Blader, P., Strahle, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ethanol+impairs+migration+of+the+prechordal+plate+in+the+zebrafish+embryo.">Ethanol impairs migration of the prechordal plate in the zebrafish embryo.</a> Dev. Biol. 201 (2), 185-201 (1998).</li><li>Loucks, E., Carvan, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3rd,+Strain-dependent+effects+of+developmental+ethanol+exposure+in+zebrafish.">3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish.</a> Neurotoxicol. Teratol. 26 (6), 745-755 (2004).</li><li>Ahlgren, S. C., Preedy, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+Mechanisms+of+Fetal+Alcohol+Syndrome:+Shh-signaling.">Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling.</a> Comprehensive Handbook of Alcohol Related Pathology. , (2004).</li><li>Reimers, M. J., Flockton, A. R., Tanguay, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ethanol-+and+acetaldehyde-mediated+developmental+toxicity+in+zebrafish.">Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish.</a> Neurotoxicol. Teratol. 26 (6), 769-781 (2004).</li><li>Pfaffl, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+mathematical+model+for+relative+quantification+in+real-time+RT-PCR.">A new mathematical model for relative quantification in real-time RT-PCR.</a> Nucleic Acids Res. 29 (9), 45-45 (2001).</li><li>Jowett, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Tissue in situ hybridization: methods in animal development. , 128-128 (1997).</li><li>Loucks, E. J., Ahlgren, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deciphering+the+role+of+Shh+signaling+in+axial+defects+produced+by+ethanol+exposure.">Deciphering the role of Shh signaling in axial defects produced by ethanol exposure.</a> Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).</li><li>Schwend, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Requirement+of+Npc1+and+availability+of+cholesterol+for+early+embryonic+cell+movements+in+zebrafish.">Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish.</a> J. Lipid Res. 52 (7), 1328-1344 (2011).</li><li>Spohr, H. L., Willms, J., Steinhausen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fetal+alcohol+spectrum+disorders+in+young+adulthood.">Fetal alcohol spectrum disorders in young adulthood.</a> J. Pediatr. 150 (2), 175-179 (2007).</li><li>Strauss, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+the+intrauterine+environment+on+childhood+growth.">Effects of the intrauterine environment on childhood growth.</a> Br. Med. Bull. 53 (1), 81-95 (1997).</li><li>Loucks, E. J., Schwend, T., Ahlgren, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+changes+associated+with+teratogen-induced+cyclopia.">Molecular changes associated with teratogen-induced cyclopia.</a> Birth Defects Res. A. Clin. Mol. Teratol. 79 (9), 642-651 (2007).</li><li>Schwend, T., Loucks, E. J., Ahlgren, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+Gli+activity+in+craniofacial+tissues+of+hedgehog-pathway+reporter+transgenic+zebrafish.">Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish.</a> PLoS One. 5 (9), 14396-14396 (2011).</li><li>Chrisman, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gestational+ethanol+exposure+disrupts+the+expression+of+FGF8+and+Sonic+hedgehog+during+limb+patterning.">Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning.</a> Birth Defects Res. A. Clin. Mol. Teratol. 70 (4), 163-171 (2004).</li></ol>

Wir haben nichts zu offenbaren.

Die hier beschriebenen Methoden und die Ergebnisse gezeigt, zeigen nur die Spitze des Zebrafisch-how lassen sich Entwicklungsstörungen verhören werden. Aufgrund der Zugänglichkeit des Embryos, der hohen Anzahl von Eiern für jede Kupplung, und eine hohe Reproduzierbarkeit der Ergebnisse gelegt, sind diese ideal für Wirbeltiere Teratogenität durchgeführt. Fische können auch manipuliert werden, um fluoreszierende Moleküle enthalten, die als visuelle Reportergen für ein bestimmtes Gen oder ein Weg von Interesse 19 verwenden werden. In den Ethanol-Studien erscheinen die verwendeten Dosen recht hoch im Vergleich zu Säugetieren Blutalkoholspiegel. Jedoch, während die einzelnen Stufen das in dem Wasser, und nicht alle der Ethanol auf den Embryo geliefert. Insgesamt deuten die beschriebenen Methoden und oben erläuterten, dass Zebrafischembryonen sehr nützlich bei der Modellierung menschlichen Missbildungen im Zusammenhang mit Ethanolexposition sind. Darüber hinaus haben die Veränderungen der Genexpression im Zebrafisch vor von anderen bestätigtin den Säugetier-Modellsystemen 20, was darauf hindeutet, dass die entwicklungspolitischen Effekte von Ethanol auf Wirbeltiere werden beibehalten. Viele der Techniken demonstriert oben kann mit anderen Umwelt-oder pharmazeutischen Beleidigungen verwendet werden, um schnell und einfach erkennen potenzielle Teratogene und bestimmen die zugrunde liegenden Mechanismen, die zur Teratogenität eines bestimmten Stoffes beitragen.

<table border="1"><tbody><tr><td> Name des Reagenzes </td><td> Firma </td><td> Katalog-Nummer </td></tr><tr><td> Tissue RNA Kit: 5-Prime PerfectPure </td><td> Fisher Scientific </td><td> FP2302410 </td></tr><tr><td> Platinum SYBR Green qPCR SuperMix-UDG </td><td> Invitrogen </td><td> 11733038 </td></tr><tr><td> mMessage mMachine hohe Ausbeute begrenzt RNA-Transkription-Kit </td><td> Applied Biosystems </td><td> Abhängig von der RNA-Polymerase in Ihrer Plasmid </td></tr></tbody></table>

assessing teratogenic changes in a zebrafish model of fetal alcohol exposure

Fetale Alkoholsyndrom (FAS) ist eine schwere Manifestation der embryonalen Exposition gegenüber Ethanol. Es stellt sich mit charakteristischen Defekten im Gesicht und Organe, einschließlich mentaler Retardierung aufgrund ungeordneter und beschädigten die Entwicklung des Gehirns. Fetale Alkohol-Spektrum-Störung (FASD) ist ein Begriff verwendet, um ein Kontinuum von Geburtsschäden, die aufgrund mütterlichen Alkoholkonsum auftreten zu decken, und tritt bei etwa 4% der Kinder in den Vereinigten Staaten geboren. Mit 50% der gebärfähigen Alter Frauen berichten Konsum von Alkohol, und die Hälfte aller Schwangerschaften ungeplant sein, ist ein anhaltender unbeabsichtigten Exposition Ausgabe 2. Um am besten verstehen, den Schaden durch Ethanol produziert, plus ein Modell zu produzieren, mit denen potenzielle Interventionen zu testen, entwickelten wir ein Modell der Entwicklungspsychologie Ethanolexposition Verwendung der Zebrafisch-Embryos. Zebrafische sind ideal für diese Art von Studie Teratogen 3-8. Jedes Paar legt Hunderte von Eiern, die dann ohne Schädigung der Erwachsenen gesammelt werden könnenFisch. Die Zebrafisch ist transparent und kann leicht mit einer beliebigen Anzahl von Flecken abgebildet werden. Die Analyse dieser Embryonen nach Exposition mit Ethanol in verschiedenen Dosierungen und Zeiten der Dauer und der Anwendung zeigt, dass die grobe Entwicklungsstörungen durch Ethanol produziert im Einklang mit der menschlichen Geburtsfehler sind. Hier beschrieben werden die grundlegenden Techniken verwendet, um zu studieren und manipulieren das Zebrafisch-FAS-Modell.

Watch this Scientific Journal Video about Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure at JoVE.com

Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure

Um die molekularen Mechanismen des Ethanol-induzierte Entwicklungsstörungen verstehen, haben wir einen Zebrafisch-Modell von Ethanol Exposition entwickelt und erforschen die physikalischen, zellulären und genetischen Veränderungen, die nach der Exposition auftreten Ethanol<sup&gt; 1</sup&gt;. Wir haben dann versuchen, mögliche Interventionen zu finden und schnell testen sie in diesem Tiermodell.

Die Beurteilung Teratogene Änderungen in einem Zebrafisch-Modell der Fetal Alcohol Exposure

Fetal alcohol syndrome (FAS) is a severe manifestation of embryonic exposure to ethanol. It presents with characteristic defects to the face and organs, ...

assessing-teratogenic-changes-zebrafish-model-fetal-alcohol

Research

JoVE Journal

Medicine

26.1K Aufrufe.  Children's Memorial Research Center. Um die molekularen Mechanismen des Ethanol-induzierte Entwicklungsstörungen verstehen, haben wir einen Zebrafisch-Modell von Ethanol Exposition entwickelt und erforschen die physikalischen, zellulären und genetischen Veränderungen, die nach der Exposition auftreten Ethanol 1. Wir haben dann versuchen, mögliche Interventionen zu finden und schnell testen sie in diesem Tiermodell.

Serie: Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure

The Polyvinyl Alcohol Sponge Model Implantation

Wound healing is a complicated, multistep process involving many cell types, growth factors and compounds1-3. Because of this complexity, wound healing studies are most comprehensive when carried out in vivo. There are many in vivo models available to study acute wound healing, including incisional, excisional, dead space, and burns. Dead space models are artificial, porous implants which are used to study tissue formation and the effects of substances on the wound. Some of the commonly used dead space models include polyvinyl alcohol (PVA) sponges, steel wire mesh cylinders, expanded polytetrafluoroethylene (ePTFE) material, and the Cellstick1,2.
Each dead space model has its own limitations based on its material's composition and implantation methods. The steel wire mesh cylinder model has a lag phase of infiltration after implantation and requires a long amount of time before granulation tissue formation begins1. Later stages of wound healing are best analyzed using the ePTFE model1,4. The Cellstick is a cellulose sponge inside a silicon tube model which is typically used for studying human surgery wounds and wound fluid2. The PVA sponge is limited to acute studies because with time it begins to provoke a foreign body response which causes a giant cell reaction in the animal5. Unlike other materials, PVA sponges are easy to insert and remove, made of inert and non-biodegradable materials and yet are soft enough to be sectioned for histological analysis2,5.
In wound healing the PVA sponge is very useful for analyzing granulation tissue formation, collagen deposition, wound fluid composition, and the effects of substances on the healing process1,2,5. In addition to its use in studying a wide array of attributes of wound healing, the PVA sponge has also been used in many other types of studies. It has been utilized to investigate tumor angiogenesis, drug delivery and stem cell survival and engraftment1,2,6,7. With its great alterability, prior extensive use, and reproducible results, the PVA sponge is an ideal model for many studies1,2.
Here, we will describe the preparation, implantation and retrieval of PVA sponge disks (Figure 1) in a mouse model of wound healing.

A useful tool to analyze the effects of drugs, growth factors, and/or manipulated cells in an animal model of wound repair is described. This technique utilizes the properties of a polyvinyl alcohol (PVA) sponge to deliver and contain the desired treatment and also provide a platform to be excised and analyzed.

Die Polyvinylalkoholschwamm Modell Implantation

Wound healing is a complicated, multistep process involving many cell types, growth factors and compounds1-3. Because of this complexity, wound healing ...

Forschung

Medizin

A Novel Surgical Approach for Intratracheal Administration of Bioactive Agents in a Fetal Mouse Model

Prenatal pulmonary delivery of cells, genes or pharmacologic agents could provide the basis for new therapeutic strategies for a variety of genetic and acquired diseases. Apart from congenital or inherited abnormalities with the requirement for long-term expression of the delivered gene, several non-inherited perinatal conditions, where short-term gene expression or pharmacological intervention is sufficient to achieve therapeutic effects, are considered as potential future indications for this kind of approach. Candidate diseases for the application of short-term prenatal therapy could be the transient neonatal deficiency of surfactant protein B causing neonatal respiratory distress syndrome1,2 or hyperoxic injuries of the neonatal lung3. Candidate diseases for permanent therapeutic correction are Cystic Fibrosis (CF)4, genetic variants of surfactant deficiencies5 and &alpha;1-antitrypsin deficiency6.
Generally, an important advantage of prenatal gene therapy is the ability to start therapeutic intervention early in development, at or even prior to clinical manifestations in the patient, thus preventing irreparable damage to the individual. In addition, fetal organs have an increased cell proliferation rate as compared to adult organs, which could allow a more efficient gene or stem cell transfer into the fetus. Furthermore, in utero gene delivery is performed when the individual's immune system is not completely mature. Therefore, transplantation of heterologous cells or supplementation of a non-functional or absent protein with a correct version should not cause immune sensitization to the cell, vector or transgene product, which has recently been proven to be the case with both cellular and genetic therapies7.
In the present study, we investigated the potential to directly target the fetal trachea in a mouse model. This procedure is in use in larger animal models such as rabbits and sheep8, and even in a clinical setting9, but has to date not been performed before in a mouse model. When studying the potential of fetal gene therapy for genetic diseases such as CF, the mouse model is very useful as a first proof-of-concept because of the wide availability of different transgenic mouse strains, the well documented embryogenesis and fetal development, less stringent ethical regulations, short gestation and the large litter size.
Different access routes have been described to target the fetal rodent lung, including intra-amniotic injection10-12, (ultrasound-guided) intrapulmonary injection13,14 and intravenous administration into the yolk sac vessels15,16 or umbilical vein17. Our novel surgical procedure enables researchers to inject the agent of choice directly into the fetal mouse trachea which allows for a more efficient delivery to the airways than existing techniques18.

We developed a novel surgical approach for intratracheal administration of bioactive agents into the mouse fetus. The delivery route is more efficient in targeting the fetal mouse lungs than the commonly used intra-amniotic injection. This procedure has to date not been described in a mouse model.

A Novel Surgical Ansatz intratracheale Verabreichung von Wirkstoffen in einem Fetal Mouse Model

Prenatal pulmonary delivery of cells, genes or pharmacologic agents could provide the basis for new therapeutic strategies for a variety of genetic and ...

Screening for Melanoma Modifiers using a Zebrafish Autochthonous Tumor Model

Genomic studies of human cancers have yielded a wealth of information about genes that are altered in tumors1,2,3. A challenge arising from these studies is that many genes are altered, and it can be difficult to distinguish genetic alterations that drove tumorigenesis from that those arose incidentally during transformation. To draw this distinction it is beneficial to have an assay that can quantitatively measure the effect of an altered gene on tumor initiation and other processes that enable tumors to persist and disseminate. Here we present a rapid means to screen large numbers of candidate melanoma modifiers in zebrafish using an autochthonous tumor model4 that encompasses steps required for melanoma initiation and maintenance. A key reagent in this assay is the miniCoopR vector, which couples a wild-type copy of the mitfa melanocyte specification factor to a Gateway recombination cassette into which candidate melanoma genes can be recombined5. The miniCoopR vector has a mitfa rescuing minigene which contains the promoter, open reading frame and 3'-untranslated region of the wild-type mitfa gene. It allows us to make constructs using full-length open reading frames of candidate melanoma modifiers. These individual clones can then be injected into single cell Tg(mitfa:BRAFV600E);p53(lf);mitfa(lf)zebrafish embryos. The miniCoopR vector gets integrated by Tol2-mediated transgenesis6 and rescues melanocytes. Because they are physically coupled to the mitfa rescuing minigene, candidate genes are expressed in rescued melanocytes, some of which will transform and develop into tumors. The effect of a candidate gene on melanoma initiation and melanoma cell properties can be measured using melanoma-free survival curves, invasion assays, antibody staining and transplantation assays.

A rapid way to screen for melanoma modifiers using a zebrafish autochthonous tumor model is presented. It takes advantage of the miniCoopR vector which allows for expression of candidate melanoma genes in melanocytes. A method to obtain melanoma-free survival curves, an invasion assay, a protocol for antibody staining of scale melanocytes and a melanoma transplantation assay are described.

Screening für Melanom Modifiers mit einem Zebrafisch Autochthone Tumormodell

Genomic studies of  human cancers have yielded a wealth of information about genes that are altered  in tumors1,2,3. A challenge arising from these ...

Fetal Echocardiography and Pulsed-wave Doppler Ultrasound in a Rabbit Model of Intrauterine Growth Restriction

Fetal intrauterine growth restriction (IUGR) results in abnormal cardiac function that is apparent antenatally due to advances in fetoplacental Doppler ultrasound and fetal echocardiography. Increasingly, these imaging modalities are being employed clinically to examine cardiac function and assess wellbeing in utero, thereby guiding timing of birth decisions. Here, we used a rabbit model of IUGR that allows analysis of cardiac function in a clinically relevant way. Using isoflurane induced anesthesia, IUGR is surgically created at gestational age day 25 by performing a laparotomy, exposing the bicornuate uterus and then ligating 40-50% of uteroplacental vessels supplying each gestational sac in a single uterine horn. The other horn in the rabbit bicornuate uterus serves as internal control fetuses. Then, after recovery at gestational age day 30 (full term), the same rabbit undergoes examination of fetal cardiac function. Anesthesia is induced with ketamine and xylazine intramuscularly, then maintained by a continuous intravenous infusion of ketamine and xylazine to minimize iatrogenic effects on fetal cardiac function. A repeat laparotomy is performed to expose each gestational sac and a microultrasound examination (VisualSonics VEVO 2100) of fetal cardiac function is performed. Placental insufficiency is evident by a raised pulsatility index or an absent or reversed end diastolic flow of the umbilical artery Doppler waveform. The ductus venosus and middle cerebral artery Doppler is then examined. Fetal echocardiography is performed by recording B mode, M mode and flow velocity waveforms in lateral and apical views. Offline calculations determine standard M-mode cardiac variables, tricuspid and mitral annular plane systolic excursion, speckle tracking and strain analysis, modified myocardial performance index and vascular flow velocity waveforms of interest. This small animal model of IUGR therefore affords examination of in utero cardiac function that is consistent with current clinical practice and is therefore useful in a translational research setting.

We describe examination of fetal cardiac function with contemporary functional fetal echocardiography and fetoplacental Doppler ultrasound using the VisualSonics VEVO 2100 microultrasound in a surgically induced model of intrauterine fetal growth restriction in a rabbit.

Fetale Echokardiographie und Pulsed-Wave-Doppler-Ultraschall in einem Kaninchen-Modell von Intrauterine Growth Restriction

Fetal intrauterine growth restriction (IUGR) results in abnormal cardiac function that is apparent antenatally due to advances in fetoplacental Doppler ...

Assessing Changes in Volatile General Anesthetic Sensitivity of Mice after Local or Systemic Pharmacological Intervention

One desirable endpoint of general anesthesia is the state of unconsciousness, also known as hypnosis. Defining the hypnotic state in animals is less straightforward than it is in human patients. A widely used behavioral surrogate for hypnosis in rodents is the loss of righting reflex (LORR), or the point at which the animal no longer responds to their innate instinct to avoid the vulnerability of dorsal recumbency. We have developed a system to assess LORR in 24 mice simultaneously while carefully controlling for potential confounds, including temperature fluctuations and varying gas flows. These chambers permit reliable assessment of anesthetic sensitivity as measured by latency to return of the righting reflex (RORR) following a fixed anesthetic exposure. Alternatively, using stepwise increases (or decreases) in anesthetic concentration, the chambers also enable determination of a population's sensitivity to induction (or emergence) as measured by EC50 and Hill slope. Finally, the controlled environmental chambers described here can be adapted for a variety of alternative uses, including inhaled delivery of other drugs, toxicology studies, and simultaneous real-time monitoring of vital signs.

Loss of the righting reflex has long served as a standard behavioral surrogate for unconsciousness, also called hypnosis, in laboratory animals. Alterations in volatile anesthetic sensitivity caused by pharmacological interventions can be detected with a carefully controlled high-throughput assessment system, which may be adapted for delivery of any inhaled therapeutic.

Beurteilung von Veränderungen in volatilen Vollnarkose Empfindlichkeit von Mäusen nach lokalen oder systemischen pharmakologischen Intervention

One desirable endpoint of general anesthesia is  the state of unconsciousness, also known as hypnosis. Defining the hypnotic state in animals is  less ...

A Possible Zebrafish Model of Polycystic Kidney Disease: Knockdown of wnt5a Causes Cysts in Zebrafish Kidneys

Polycystic kidney disease (PKD) is one of the most common causes of end-stage kidney disease, a devastating disease for which there is no cure. The molecular mechanisms leading to cyst formation in PKD remain somewhat unclear, but many genes are thought to be involved. Wnt5a is a non-canonical glycoprotein that regulates a wide range of developmental processes. Wnt5a works through the planar cell polarity (PCP) pathway that regulates oriented cell division during renal tubular cell elongation. Defects of the PCP pathway have been found to cause kidney cyst formation. Our paper describes a method for developing a zebrafish cystic kidney disease model by knockdown of the wnt5a gene with wnt5a antisense morpholino (MO) oligonucleotides. Tg(wt1b:GFP) transgenic zebrafish were used to visualize kidney structure and kidney cysts following wnt5a knockdown. Two distinct antisense MOs (AUG - and splice-site) were used and both resulted in curly tail down phenotype and cyst formation after wnt5a knockdown. Injection of mouse Wnt5a mRNA, resistant to the MOs due to a difference in primary base pair structure, rescued the abnormal phenotype, demonstrating that the phenotype was not due to &#8220;off-target&#8221; effects of the morpholino. This work supports the validity of using a zebrafish model to study wnt5a function in the kidney.

A Possible Zebrafish Model of Polycystic Kidney Disease: Knockdown of wnt5a Causes Cysts in Zebrafish Kidneys

We describe a method of generating a possible zebrafish model of polycystic kidney disease. We used Tg(wt1b:GFP) fish to visualize kidney structure. Knockdown of wnt5a was by morpholino injection. Pronephric cyst formation after wnt5a knockdown was observed in this GFP transgenic zebrafish.

Eine mögliche Zebrafisch-Modell der Kidney Disease: Knockdown von<em&gt; Wnt5a</em&gt; Ursachen Zysten in Zebrafisch-Nieren

Polycystic kidney disease (PKD) is one of the most common causes of end-stage kidney disease, a devastating disease for which there is no cure. The ...

A Mouse Fetal Skin Model of Scarless Wound Repair

Early in utero, but not in postnatal life, cutaneous wounds undergo regeneration and heal without formation of a scar. Scarless fetal wound healing occurs across species but is age dependent. The transition from a scarless to scarring phenotype occurs in the third trimester of pregnancy in humans and around embryonic day 18 (E18) in mice. However, this varies with the size of the wound with larger defects generating a scar at an earlier gestational age. The emergence of lineage tracing and other genetic tools in the mouse has opened promising new avenues for investigation of fetal scarless wound healing. However, given the inherently high rates of morbidity and premature uterine contraction associated with fetal surgery, investigations of fetal scarless wound healing in vivo require a precise and reproducible surgical model. Here we detail a reliable model of fetal scarless wound healing in the dorsum of E16.5 (scarless) and E18.5 (scarring) mouse embryos.

During mammalian development, early gestational skin wounds heal without a scar. Here we detail a reliable and reproducible model of fetal scarless wound healing in the cutaneous dorsum of E16.5 (scarless) and E18.5 (scarring) mouse embryos.

Eine Maus fetalen Hautmodell von Scarless Wound Repair

Early in utero, but not in postnatal life, cutaneous wounds undergo regeneration and heal without formation of a scar. Scarless fetal wound healing occurs ...

Generation of a Chronic Obstructive Pulmonary Disease Model in Mice by Repeated Ozone Exposure

Chronic obstructive pulmonary disease (COPD) is characterized by persistent airflow limitation and lung parenchymal destruction. It has a very high incidence in aging populations. The current conventional therapies for COPD focus mainly on symptom-modifying drugs; thus, the development of new therapies is urgently needed. Qualified animal models of COPD could help to characterize the underlying mechanisms and can be used for new drug screening. Current COPD models, such as lipopolysaccharide (LPS) or the porcine pancreatic elastase (PPE)-induced emphysema model, generate COPD-like lesions in the lungs and airways but do not otherwise resemble the pathogenesis of human COPD. A cigarette smoke (CS)-induced model remains one of the most popular because it not only simulates COPD-like lesions in the respiratory system, but it is also based on one of the main hazardous materials that causes COPD in humans. However, the time-consuming and labor-intensive aspects of the CS-induced model dramatically limit its application in new drug screening. In this study, we successfully generated a new COPD model by exposing mice to high levels of ozone. This model demonstrated the following: 1) decreased forced expiratory volume 25, 50, and 75/forced vital capacity (FEV25/FVC, FEV50/FVC, and FEV75/FVC), indicating the deterioration of lung function; 2) enlarged lung alveoli, with lung parenchymal destruction; 3) reduced fatigue time and distance; and 4) increased inflammation. Taken together, these data demonstrate that the ozone exposure (OE) model is a reliable animal model that is similar to humans because ozone overexposure is one of the etiological factors of COPD. Additionally, it only took 6 - 8 weeks, based on our previous work, to create an OE model, whereas it requires 3 - 12 months to induce the cigarette smoke model, indicating that the OE model might be a good choice for COPD research.

This study describes the successful generation of a new chronic obstructive pulmonary disease (COPD) animal model by repeatedly exposing mice to high concentrations of ozone.

Generation von eine chronisch obstruktive Lungenerkrankung-Modell bei Mäusen durch wiederholte Ozonbelastung

Chronic obstructive pulmonary disease (COPD) is characterized by persistent airflow limitation and lung parenchymal destruction. It has a very high ...

Model Surgical Training: Skills Acquisition in Fetoscopic Laser Photocoagulation of Monochorionic Diamniotic Twin Placenta Using Realistic Simulators

Fetoscopic laser coagulation of arterio-venous anastomoses (AVA) in a monochorionic placenta is the standard of care for twin-twin transfusion syndrome (TTTS), but is technically challenging and can lead to significant complications. Acquiring and maintaining the necessary surgical skills require consistent practice, a critical caseload, and time. Training on realistic surgical simulators can potentially shorten this steep learning curve and enables several proceduralists to acquire procedure-specific skills simultaneously. Here we describe realistic simulators designed to allow the user familiarity with the equipment and specific steps required in the surgical treatment of TTTS, including fetoscopic handling, approaches to anterior and posterior placenta, recognition of anastomoses, and efficient coagulation of vessels. We describe the skills that are especially important in conducting placental laser coagulation that the surgeon can practice on the model and apply in a clinical case. These models can be adapted easily depending on the availability of materials and require standard fetoscopy equipment. Such training systems are complementary to traditional surgical apprenticeships and can be useful aids for fetal medicine units that provide this clinical service.

Practicing the specific skills required for fetoscopic laser coagulation of monochorionic placental anastomoses on realistic models can aid less experienced surgeons in overcoming the steep learning curve associated with this procedure that is now regarded as the standard of care for twin-twin transfusion syndrome.

Modell chirurgische Ausbildung: Kompetenzentwicklung in Fetoscopic Laser Photokoagulation monochorialen dichorial Twin Plazenta mit realistischen Simulatoren

Fetoscopic laser coagulation of arterio-venous anastomoses (AVA) in a monochorionic placenta is the standard of care for twin-twin transfusion syndrome ...

A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish

The genetically accessible adult zebrafish (Danio rerio) has been increasingly used as a vertebrate model for understanding human diseases such as cardiomyopathy. Because of its convenience and amenability to high throughput genetic manipulations, the generation of acquired cardiomyopathy models, such as the doxorubicin-induced cardiomyopathy (DIC) model in adult zebrafish, is opening the doors to new research avenues, including discovering cardiomyopathy modifiers via forward genetic screening. Different from the embryonic zebrafish DIC model, both initial acute and later chronic phases of cardiomyopathy can be determined in the adult zebrafish DIC model, enabling the study of stage-dependent signaling mechanisms and therapeutic strategies. However, variable results can be obtained with the current model, even in the hands of experienced investigators. To facilitate future implementation of the DIC model, we present a detailed protocol on how to generate this DIC model in adult zebrafish and describe two alternative ways of intraperitoneal (IP) injection. We further discuss options on how to reduce variations to obtain reliable results and provide suggestions on how to appropriately interpret the results.

A method to generate a doxorubicin-induced cardiomyopathy model in adult zebrafish (Danio rerio) is described here. Two alternative ways of intraperitoneal injection are presented and conditions to reduce variations among different experimental groups are discussed.