우리는 현장 하이브리드화 및 mRNA의 microinjections에 대해 plasmids의 선물 몬테 Westerfield, 마코토 고바야시와 제이섹 Topczewski 감사하고 싶습니다. 우리는 비디오에 등장을위한 스테파니 Erhard에 감사합니다. 우리는 또한 비디오에 나타난 공촛점 현미경과 윌리엄 Goossens의 도움을 인정하고 싶습니다. 타일​​러 Schwend는 동영상에 사용된 이미지를 제공하고, 로드니 데일 동영상에 대한 준비에 도움. 우리는 또한 zebrafish와의 축산 직장 CMRC 동물 관리 직원을 인정합니다. 이 작품은 SCA에 NIH 교부금 R21 AA13596에 의해 재정 지원되었다.

1. 태아의 에탄올 처리 <ol><li> 야생 형 matings에서 파생된 Zebrafish 배아는 28에서 자랐던 배아 물 5 ML에서 ° C에서. (밀리 Q 60 밀리그램 / 패 인스턴트 오션과 물). 야생 형 배아의 다양한 변종이 노출 9 에탄올 위해 약간 다른 공차 있습니다. </li><li> 에탄올에 대한 노출은 최대 24 시간 펄스로, 시간의 원하는 길이에 대한 돔 무대 (~ 4.3 시간 포스트 기름지게, hpf)에서 시작 됐습니다. 이것은 시작 단계 gastrulation에 직전 포유 동물 배아의 주입 단계와 대략적으로 비슷합니다. 에탄올 농도는 0.2 %에서 -2.5 %, 볼륨 / 볼륨 범위를 사용했습니다. 검사 물에 솔루션의 25-50 사이의 %는 개발 배아 10, 11에 끝나는 것을 증명하고있다. 태아도 시간의 원하는 길이에 대해 28 ° C에서 유지 관리됩니다. 에탄올 노출의 원하는 길이 후, 에탄올 - 물 용액이 제거 및 교체 정규 zebrafish 물 세 세차장와 함께 구경이 유지됩니다시간의 R 원하는 길이. 결함의 특이성은 발병, 복용량 및 에탄올의 펄스 길이의 시간에 따라 달라집니다. </li></ol> 2. 원위치 하이브리드화, 항체, 그리고 연골 염색법의 RNA에 대한 태아의 수집, <ol><li> qPCR에 대한 mRNA를 수집하려면, 연령 일치하는 배아는 eppendorf 튜브에 수집됩니다. zebrafish 물의 제거 후 TCEP과 용해 버퍼가 추가됩니다. 동력 pulverizer는 물리적으로 용해 용액의 배아를 떼어 놓다하는 데 사용됩니다. 이것은 그때 어떤 undissociated 큰 조각을 제거 preclear 칼럼을 통해 전달됩니다. 결과 솔루션은 용해 과정에서 릴리스된 모든 macromolecules가 포함되어 있습니다. RNA는 다음 세차장 및 DNAse 치료 뒤에는 칼럼에서이 솔루션을 실행하여 추출됩니다. 용리 그런 다음 물 또는 제조 업체 (5&#39;-프라임)에 의해 제공 용출 용액을 사용하여 수행됩니다. RNA은 마이크로에서 qPCR에 대한 표준 기술을 사용하여 cDNA로 변환하거나 사용할 수 있습니다배열 분석. </li><li> 원위치 하이브리드화 및 항체 염색법, 6-24에서 배아에 들어 hpf은 4 ° C.에 밤새 4 % paraformaldehyde에서 해결되었다 이것은 PBS에서 3 세차장 + 0.1 % 십대 초반 (PBT), 같이 가겠다는에서 배아를 유지하기 위해 다음됩니다. 태아도 다음 세 메탄올 일련의를 통해 전송됩니다 PBT들은 -20 ° C.에 저장될 수있는 시점에서, 100 % 메탄올로 세척 이러한 배아는 원위치 하이브리드화 또는 항체 염색법에 사용할 수 있습니다. 일부 항체는 메탄올 처리 후, 이번 경고가 고려하여 특정 항체 그것 메탄올 처리 후 작동하는지 확인하기 위해 테스트를해야 작동하지 않습니다. </li><li> 연골의 염색법의 경우 배아는 5 ~ 6 일 게시물 기름지게 (dpf)에 제기해야합니다. 그들은 다음 4에서 하룻밤 사이에 4 % paraformaldehyde에서 해결된 ° C는 PBT 3 세차장으로 따라갔다. </li></ol> 3. 평가 에탄올을 유발 유전자 발현 변경 및 발달 결과들 <ol><li&gt; 유전자 발현 수준이 변경된 것을 확인하려면, 대상 유전자는 모두 qPCR 의해 원위치 하이브리드화에서 검사합니다. qPCR 그 다음 세 별도의 생물 학적 샘플을 사용하여 유효성을 검사할 통합의 DNA 기술 (IDT) 소프트웨어 설계 primers를 사용하여 이루어진다. 일단 primers가 확인되었으며, qPCR는 수집 RNA 샘플에서 생성된 cDNA에서 수행됩니다. 각 예제는 세중의에서 실행됩니다. PCR 반응은 여러 가지 빛깔의 감지 시스템과 채도-4 PCR 기계 (BioRad) 또는 이와 유사한 PCR 기계에서 플래티넘 SYBR 녹색 qPCR 슈퍼 믹스 (Invitrogen)를 실행하고 있습니다. 심문하는 유전자 이외에, 그것은 primers 세트 컨트롤이 cDNA 또는 RNA 준비의 작은 차이의 균형을 위해 사용되는 것이 중요합니다. 우리 zebrafish 배아 들어, gapdh를 사용 5&#39;GAAGGTGGGAAACTGGTCAT3 &#39;과 5&#39;TTGCACCACCCTTAATGTGA3&#39;. 분석중인 유전자 그러면 유전자 발현의 상대적인 양을 정함은 2 Pfaffl 메서드 편차를 사용하여 계산됩니다 gapdh 수준으로 정규화 <sup&gt; - CT, 야생 유형 12 ~ 실험 상대의 배 차이 같은 데이터가 표시됩니다. 일반적인 계산은 모든 유전자가 모든주기 위해 두 DNA를 복제하고 있다고 가정하며 따라서 정수 &quot;2&quot;이상의 전력 계산으로 표현, 기준 유전자의 변화를 통해 실험적인 유전자의 변화의 비율로 데이터를 표현 완벽한 PCR 반응에서 볼주기에 따라 DNA의 두 배로의 효율성이되는 것입니다. Pfaffl 메서드는 선택한 PCR primers에 대한 진정한 효율성을 생성한 실험자와 일반 &quot;2&quot;를 대체합니다. 그것은 PCR 반응의 차이보다 정확한 반영을 반영합니다. 전체 수식은 다음과 같습니다 <table border="0"><tbody><tr><td> (실험적인 유전자의 효율성) (처리 샘플 컨트롤 샘플 CT-CT) </td></tr><tr><td> -------------------------------------------------- ----------------------------------- </td></tr><tr><td> (참고 유전자의 효율성) (CT의컨트롤 샘플 - 시료의 처리 CT) </td></tr></tbody></table></li><li> 원위치 하이브리드화의 내용은 digoxigenin은 (발굴) - 라벨 riboprobes는 관심 유전자의 일부를 포함하는 plasmids에서 구축하고 있습니다. 연령 일치하는 배아가 표준 조건 13 사용 riboprobes에 노출 및 컬러 반응 (NBT / BCIP)을 사용하여 레이블 riboprobes의 위치를 수 알칼리 인산 분해 효소에 결합 백신 발굴의 항체를 사용하여 감지됩니다. 태아도 그때 Leica 해부 현미경 (그림 1B-G)를 사용하여 시각 있습니다. </li><li> morphogenic 발전을 평가하기 위해 배아가 원하는 시간에 수집하고 해부 현미경으로 검사합니다. 체절 형태의 경우, 라이브 배아는 14 군데있다. 상호 눈의 거리와 몸 길이의 경우 배아는 PFA에서 수정되었습니다. 모든 경우에있어서, 원하는 지역의 이미지는 어도비 포토샵 softwar를 사용하여 촬영한 고정 배율 및 측정의 해부 현미경에 캡처되어E 10,14. </li><li> 애벌레 zebrafish의 개발 연골 구조에 대한 치료의 효과를 조사하기 위해, 우리는 Alcian 블루 염색법을 사용합니다. 몇 시간이나 야간 20 % 빙초산 (산성 알코올) : 고정 zebrafish 애벌레는 80 % 에탄올에 녹아있는 Alcian 푸른 솔루션으로 취급됩니다. 애벌레는 1 %의 코이에 전송되기 전에 산성 알코올의 몇몇 세차장에서 destained됩니다 안료 세포의 더욱 지워 위해 3 % 과산화수소 용액. Zebrafish는 연골 구조를 보여줄 오래된 최소 4 일이 될 필요가 있으며 이들은보다 5 ~ 6 일이 지나면 물고기는에 정의됩니다. </li><li> 살아있는 배아에서 세포 사망은 Acridine 오랜지 (AO)를 사용하여 평가됩니다. AO는 살아있는 세포에 대한 세포 투과되지이며, apoptosis과 괴사를 겪고 포함 훼손 세포막과 세포의 DNA에 바인딩합니다. 생활 배아는 PBS 3 세차장 다음, 1 시간 동안 PBS에 5 밀리그램 / ML AO와 incubated있다. 태아도 다음 공촛점 현미경을 사용하여 몇 군데 있습니다. 디지털 Z-백산이거야 이미지 합성을 만들 결합됩니다. </li></ol> 4. Zebrafish 배아를 조작 <ol><li> 에탄올 노출에 의해 감소​​되는 유전자의 식별 후, 부족한 부분이 유전자를 대체하기위한 mRNA의 분사를 사용하여 그들을 바꾸려고하는 것이 가능합니다. 뒤덮힌 mRNA는 제조 업체 지침 (mMessage 기계, 응용 Biosystems)에 따르면 시험 관내 전사 키트에서 RNA의 효소를 사용하여 선형의 DNA plasmids에서 베꼈는데됩니다. 25-200 사이 RNA의 PG / NL은 0.1 M KCl의 솔루션, 1-2 세포 단계 zebrafish 달걀에 주입된다. 태아도 후 (그림 5) 위에서 설명한대로 에탄올로 치료되기 전에 복구하는 데 사용할 수 있습니다. </li><li> 에탄올 노출에 의해 증가하고있는 유전자 사본의 경우, 그들은 &quot;노크 다운&quot;안티 센스 morpholino 기술을 사용하여 축소하거나 할 수 있습니다. 안티 센스 morpholinos (아모스)은 회사의 유전자 도구에 의해 디자인, 그리고 단백질로 RNA의 번역을 차단하거나, blo있다실험적인 필요성에 따라 RNA의 CK는 성숙과 접합. morpholinos의이 작업은 타겟 유전자, 그들이 가능한 경우 anitibodies를 사용하여 측정할 수 적자에 대해 활성 단백질의 양을 제한합니다. RNA의 접합에 morpholinos의 효율성 spliced​​ 및 unspliced​​ 성적의 상대적 양을 감지하는 RT-PCR을 사용하여 측정할 수있다. morpholino의 Titrating 것은 선량 종속적인 활동을 15 발생할 수 있습니다. 아모스는 Danieau 솔루션에서 작업 농도 (NG 농도를 PG를 titrated) (58 MM NaCl 0.7 MM KCl, 0.4 MM MgSO 4, 0.6 MM 칼슘 (NO 3) 2, 5 밀리미터 HEPES, 산도 7.6)으로 희석한다. 사출은 배아는 위의 치료를 에탄올에 노출되기 전에 개발을 허용하는 다음 1-2-세포 단계에서 이루어진다. </li></ol> 5. 대표 결과 관련된 발달과 유전적 결함의 수가 에탄올 결과에 Zebrafish 배아 노출phenotypes는 다른 척추 동물에서 발견. 우리는 notochord (데이터가 14 보이지 않음)를 포함하여, 축방향 조직의 비정상적인 발전을 문서화했습니다. 에탄올에 의해 생산된 발달 지연은 분명히 단축하고 때때로 중단 notochord (데이터가 14 보이지 않음)로 이어지는, 올바른 notochord 신장의 장애로 안내합니다. 이것은 초기 지연과 notochord 결함 가능성이 경과 컨트롤에서 본 것처럼 그들의 강한 셰브론 모양을 잃었 somites에서 나중에 이상 (그림 2)에 부분적으로 주도하고, 본 phenotypes의 특징 U 형 somites에 가까이있다 음파 신호가 14 감소합니다. somites의 각도가 표준 소프트웨어 및 92.1에서 ± 4.6 ° 치료 컨트롤에서 122.6로 ± 6.6 ° 에탄올 취급 배아 (P &lt;0.001)의 각도 증가를 사용하여 측정할 수있다. downstrea있을 에탄올 노출의 또 다른 결과초기 발달 지연과 나중 notochord 결함의 상부 배아의 단축 길이 (그림 3)입니다. 심지어 배아는 계좌로 에탄올 노출에 의해 생산되는 곡률을 측정하기 위해, 에탄올 노출 (3E 14 그림) 배아에 노출되었다 에탄올의 복용량에 따라 달라집니다 단축 트렁크로 안내합니다. 이 조사는 zebrafish 모델은 인간의 선천성 이상에 대한 이해를위한 관련성을 제안, 개발 16, 17 중 에탄올에 노출된 어린이에서 발견 prepuberty 짧은 성장의 지속성과 비슷합니다. FAS의 고전적인 특징 중 하나는 낮은 턱, 작은 눈 개방, 그리고 부드러운 philtrum 포함한 고전 facies입니다. 대부분 이러한 기능의 대부분은 중간선 조직의 감소와 관련있다. 이것은 심각한 에탄올 노출 synopthalmia 및 cyclopia 포함한보다 발음 phenotypes,로 연결되는 동물 모델에서 증명되었습니다. 언제 엑스포에탄올의 증가 복용에 zebrafish의 배아를 부르 intraocular 거리 (IOD)는 인간의 출생 결함의 특성과 일치합니다 (그림 4) 복용에 의존 방식으로 줄어 듭니다. Cyclopia은 매우 다량으로 복용과 함께 발견되지만 낮은 복용이 동물 모델은 중간선 얼굴 개발에 10의 유사한 결함을 갖고 제안, IOD (그림 4)에서 상당한 감소를 생산 않습니다. 에탄올 노출에 의해 생산 몸과 얼굴 모두에서 결함의 기본 메커니즘을 이해하려면, 우리는 개발 초기에 발생하며이 합리적으로 나중에 발달 결함에 기여할 것으로 기대 수도 유전자 발현 변화를 설립 모색하고 있습니다. 우리는 두 가지 방법으로이 작업을 수행, 배아에서 mRNA의 추출 컨트롤 (그림 1A)에 비해 에탄올 취급 배아의 유전자 발현의 수준의 양적 평가 수 있습니다. 또한 현장에서 수행할 수하이브 리다이 제이션에 관계없이 신호 (그림 1B-G 18) 감소 여부, 유전자의 패턴을 볼 수 있습니다. 이 예제에서는 누구의 표현 에탄올에 노출 후 감소 둘이 같이 유전자는 gli1 및 six3b가 표시됩니다. 우리가 six3b위한 원위치 패턴으로 검사했을 때, 우리는 에탄올에 노출된 태아에서이 유전자의 표현의 공간적 범위 (그림 1 EG)의 감소를 찾았지. 유사한 감소는 유전자 gsc (그림 BD)에서 발견되었다. six3b 및 gsc 모두 craniofacial 중간선 조직에 공헌하고 운명 티슈로 표현됩니다. 그래서 8 hpf에서 이러한 유전자의 감소는 나중에 그림 4와 같이 발견 IOD의 감소와 일치합니다. 에탄올의 영향을받는 유전자가 발견되면, 그들의 표현이 증가 또는 감소시킬 수있는 의해 메커니즘이 있습니다. 이 특정 EXA에서mple, 우리는 qPCR에 의해 감소되는 두 유전자 (gli1 및 six3b) 보여주었다. 우리는이 유전자 변화를 반대하는 것은 결과를 향상시킬 수 있는지 확인하기 위해 mRNA를 투입하기로 결정했습니다. 본 실험 대신 gli1 주입으로, 우리는 쉬, gli1 수준을 증가 리간드를 투입하기로 결정했습니다. six3b 들어, six3b 자체를 주입 수 있었다. 우리는 six3b합니다 (데이터가 표시되지 않음) 주입하지만, 근본적으로 보완 쉬 주사 (그림 5)와 zebrafish 배아의 총 결함을 구조할 수 있었다 아무런 변화가 없습니다. <img alt="그림 1" src="/files/ftp_upload/3704/3704fig1.jpg" /> 그림 1. 에탄올 노출 초기 패턴과 선택된 발달 유전자의 유전자 발현 수준을 변경합니다. 8hpf에서 배아의) qPCR 결과입니다. 이 유전자에 대한 결과가 표시됩니다 six3b 및 gli1합니다. 결과는 별도의 세 가지 실험을 평균으로 표시그리고 표시된 에탄올의 복용량은 2.5 %이다. 두 유전자가 제어 (T-테스트, P &lt;0.05)에서 중요하다 방식으로 감소됩니다. 8 hpf의 zebrafish의 배아의 원위치 하이브리드화에서 BG). gsc 및 six3b 패턴이 모두 컨트롤에 비해 현재의 시점에서 변경될 수 있습니다. (Loucks 외. 2007 년부터 허가 수정). <img alt="그림 2" src="/files/ftp_upload/3704/3704fig2.jpg" /> 그림 2. 체절 개발은 대우 배아로 변경됩니다. 체절 구조와 앵글은 48 hpf에서 검사합니다. 제어 배아에서 () somites는 셰브론 형상과 날카로운 각도로되어 있습니다. 에탄올 노출 zebrafish는 더 또는 U 형 somites하고, 덜 날카로운 각도로되어 있습니다. (Loucks 및 Ahlgren 2,009의 허가와 함께 수정). <img alt="그림 3" src="/files/ftp_upload/3704/3704fig3.jpg" /> 그림 3. 에탄올 치료는 크게 zebrafish에서 몸 길이를 줄입니다.치료 및 에탄올 노출된 태아의 길이는 5 일 postfertilization에서 측정되었다. 길이가 크게 감소 (ANOVA, P &lt;0.001) 모든 치료 배아에서 본되었다. BD. 큰 감소는 2.0 %와 2.5 %의 에탄올과 함께 복용한 배아 모습을 본 반면, 1.0 % 및 1.5 %의 에탄올로 치료 배아의 전체 길이는 약간이지만 상당한 감소가 발생했습니다. 각 클러치의 크기 차이에 대한 제어하려면 E., 각 실험의 제어 배아는 100으로 정규화하고, 형제 취급 배아는 100의 비율로 표현되었다. (Loucks 및 Ahlgren 2,009의 허가와 함께 수정). <img alt="그림 4" src="/files/ftp_upload/3704/3704fig4.jpg" /> 그림 4. zebrafish 배아에서 intraocular 거리 (iod)의 감소에서 에탄올 노출 결과. ) 배아의 정면 전망 정상과 융합된 눈 phenotypes를 보여줍니다. 나) 에탄올의 다양한 복용은 gastrulation의 고해상도 동안 3 시간 동안 실시물고기는 24 시간 후에 검사하는 경우에 ults이 iod 감소. 융합된 눈과 cyclopia은 (2.4 %) 검사 높은 복용량에서 볼 수 있습니다. *이 컨트롤에 비해 iod에 큰 감소를 나타냅니다. (Ahlgren 2004에서 허가 수정). <img alt="그림 5" src="/files/ftp_upload/3704/3704fig5.jpg" /> 그림 5. 쉬 - N 개의 mRNA 주입은 zebrafish의 에탄올 노출에 의해 생산되는 총 결함을 구출. 하나, 둘, 세포 배아는 100 PG / NL 쉬 - N의 mRNA와 주입된 배아의 절반은 4.3-24 hpf에서 표준 에탄올 접종에 노출되었다 주사되었다. 태아은 5 dpf에서 분석했다. 2.0 %의 에탄올로 치료 태아는 dorsally 짧은 꼬리, 난 모양 somites 및 cyclopia 포함한 시력 결함 구부러져냅니다. 이러한 phenotypes의 구조는 주입된 배아 (93 %)의 76분의 71에서 볼 수있다. 이러한 배아에서 몸은 똑바로, somites는 셰브론 모양입니다 있으며, 눈은 완전히 구분됩니다.

<ol>
	<li>Streissguth, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fetal+alcohol+syndrome+in+adolescents+and+adults.">Fetal alcohol syndrome in adolescents and adults.</a> Jama. 265 (15), 1961-1967 (1991).</li><li>Floyd, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Observations+from+the+CDC.+Preventing+alcohol-exposed+pregnancies+among+women+of+childbearing+age:+the+necessity+of+a+preconceptional+approach.">Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach.</a> J. Womens Health Gend. Based Med. 8 (6), 733-736 (1999).</li><li>Ali, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+analysis+of+acute+ethanol+exposure+in+zebrafish+development:+a+critical+time+window+and+resilience.">Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience.</a> PLoS One. 6 (5), e20037-e20037 (2011).</li><li>Dlugos, C. A., Rabin, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+functional+effects+of+developmental+exposure+to+ethanol+on+the+zebrafish+heart.">Structural and functional effects of developmental exposure to ethanol on the zebrafish heart.</a> Alcohol Clin. Exp. Res. 34 (6), 1013-1021 (2010).</li><li>Fernandes, Y., Gerlai, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+behavioral+changes+in+response+to+early+developmental+exposure+to+ethanol+in+zebrafish.">Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish.</a> Alcohol Clin. Exp. Res. 33 (4), 601-609 (2009).</li><li>Bilotta, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+embryonic+exposure+to+ethanol+on+zebrafish+visual+function.">Effects of embryonic exposure to ethanol on zebrafish visual function.</a> Neurotoxicol. Teratol. 24 (6), 759-766 (2002).</li><li>Tanguay, R. L., Reimers, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+ethanol+developmental+toxicity+in+zebrafish.">Analysis of ethanol developmental toxicity in zebrafish.</a> Methods Mol. Biol. 447, 63-74 (2008).</li><li>Blader, P., Strahle, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ethanol+impairs+migration+of+the+prechordal+plate+in+the+zebrafish+embryo.">Ethanol impairs migration of the prechordal plate in the zebrafish embryo.</a> Dev. Biol. 201 (2), 185-201 (1998).</li><li>Loucks, E., Carvan, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3rd,+Strain-dependent+effects+of+developmental+ethanol+exposure+in+zebrafish.">3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish.</a> Neurotoxicol. Teratol. 26 (6), 745-755 (2004).</li><li>Ahlgren, S. C., Preedy, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+Mechanisms+of+Fetal+Alcohol+Syndrome:+Shh-signaling.">Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling.</a> Comprehensive Handbook of Alcohol Related Pathology. , (2004).</li><li>Reimers, M. J., Flockton, A. R., Tanguay, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ethanol-+and+acetaldehyde-mediated+developmental+toxicity+in+zebrafish.">Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish.</a> Neurotoxicol. Teratol. 26 (6), 769-781 (2004).</li><li>Pfaffl, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+mathematical+model+for+relative+quantification+in+real-time+RT-PCR.">A new mathematical model for relative quantification in real-time RT-PCR.</a> Nucleic Acids Res. 29 (9), 45-45 (2001).</li><li>Jowett, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Tissue in situ hybridization: methods in animal development. , 128-128 (1997).</li><li>Loucks, E. J., Ahlgren, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deciphering+the+role+of+Shh+signaling+in+axial+defects+produced+by+ethanol+exposure.">Deciphering the role of Shh signaling in axial defects produced by ethanol exposure.</a> Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).</li><li>Schwend, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Requirement+of+Npc1+and+availability+of+cholesterol+for+early+embryonic+cell+movements+in+zebrafish.">Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish.</a> J. Lipid Res. 52 (7), 1328-1344 (2011).</li><li>Spohr, H. L., Willms, J., Steinhausen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fetal+alcohol+spectrum+disorders+in+young+adulthood.">Fetal alcohol spectrum disorders in young adulthood.</a> J. Pediatr. 150 (2), 175-179 (2007).</li><li>Strauss, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+the+intrauterine+environment+on+childhood+growth.">Effects of the intrauterine environment on childhood growth.</a> Br. Med. Bull. 53 (1), 81-95 (1997).</li><li>Loucks, E. J., Schwend, T., Ahlgren, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+changes+associated+with+teratogen-induced+cyclopia.">Molecular changes associated with teratogen-induced cyclopia.</a> Birth Defects Res. A. Clin. Mol. Teratol. 79 (9), 642-651 (2007).</li><li>Schwend, T., Loucks, E. J., Ahlgren, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+Gli+activity+in+craniofacial+tissues+of+hedgehog-pathway+reporter+transgenic+zebrafish.">Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish.</a> PLoS One. 5 (9), 14396-14396 (2011).</li><li>Chrisman, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gestational+ethanol+exposure+disrupts+the+expression+of+FGF8+and+Sonic+hedgehog+during+limb+patterning.">Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning.</a> Birth Defects Res. A. Clin. Mol. Teratol. 70 (4), 163-171 (2004).</li></ol>

우리는 공개 할게 없다.

방법은 여기서 설명하고 표시된 결과는 zebrafish가 발달 결함을 심문하는 데 사용할 수있는 방법 중 팁을 보여줍니다. 때문에 태아의 접근으로, 각 클러치, 그리고 결과의 높은 재현성을 위해 알을 낳았의 높으면 이러한 척추 동물은 teratogenic 연구에 이상적입니다. 물고기는 또한 특정 유전자 또는 이익 19 경로에 대한 시각적 기자로 사용하는 형광 분자를 포함하도록 조작할 수 있습니다. 에탄올 연구에 사용되는 접종은 포유류의 혈중 알코올 농도 수치에 비해 상당히 높은 나타납니다. 그러나 이러한 수치는 물 속에 존재하는 것을 반영하고, 모든 에탄올의 대부분은 태아에게 전달됩니다. 함께 촬영, 설명 그리고 위의 설명된 방법은 zebrafish 배아는 에탄올 노출에 관련된 인간의 출생 결함을 모델링에 매우 유용하는 것이 좋습니다. 또한, zebrafish에있는 유전자 발현 변경은 다른 사용자가 확인되었습니다에탄올의 발달 효과는 척추 동물에 걸쳐 유지되는 제안 포유 동물 모델 시스템 20 인치 위에서 보여주는 기술 중 대부분이 쉽고 빠르게 잠재 teratogens를 검색하고 특정 물질의 teratogenesis에 기여하는 기본 메커니즘을 결정하기 위해 다른 환경이나 제약 모욕 함께 사용할 수 있습니다.

<table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td></tr><tr><td> 조직 RNA 키트 : 5 - 프라임 PerfectPure </td><td> 피셔 과학 </td><td> FP2302410 </td></tr><tr><td> 플래티넘 SYBR 녹색 qPCR SuperMix-UDG </td><td> Invitrogen </td><td> 11733038 </td></tr><tr><td> mMessage mMachine 높은 수율은 RNA의 전사 키트를 공을 </td><td> 응용 Biosystems </td><td> 당신의 플라스미드에 RNA의 효소에 따라 다름 </td></tr></tbody></table>

assessing teratogenic changes in a zebrafish model of fetal alcohol exposure

태아 알코올 증후군 (FAS)은 에탄올에 배아 노출 심각한 징후이다. 그것은 얼굴과 섞여 및 손상된 뇌 발달로 인해 정신 지체를 포함한 장기에 특색있는 결함과 함께 소개합니다. 태아 알코올 스펙트럼 장애 (FASD)는 모성 알코올 소비로 인해 발생하는 선천적 결함의 연속체를 충당하기 위해 사용되는 용어이며, 미국에서 태어난 어린이의 약 4 %에 발생합니다. 어린이 베어링 연령 여성의 50 %가 알코올의 소비를보고, 모든 임신의 절반은 계획되지 않은 있기 때문에 무심코 노출은 지속적인 문제 2입니다. 최고의 에탄올에 의해 생산되는 피해를 이해 플러스 잠재적인 개입을 테스트하기위한 모델을 생성하기 위해, 우리는 zebrafish 배아를 사용하여 발달 에탄올 노출 모델을 개발했습니다. Zebrafish는 teratogen 연구 3-8 이런 종류의 이상적입니다. 각 쌍은 다음 성인을 해치지 않고 수집될 수 계란 수백을 낳는생선. zebrafish 배아가 투명하고 쉽게 얼룩의 번호를 몇 군데하실 수 있습니다. 이러한 배아 분석 에탄올 제작한 총 발달 결함이 인간의 선천성과 일치하는 기간 및 응용 프로그램의 다른 복용 및 시간에서 에탄올에 노출 후. zebrafish FAS 모델을 연구하고 조작하는 데 사용되는 기본적인 방법은 다음과 같습니다 여기서 설명했다.

Watch this Scientific Journal Video about Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure at JoVE.com

Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure

에탄올로 유도된 발달 손상의 분자 메커니즘을 이해하려면, 우리는 에탄올 노출 zebrafish 모델을 개발하고 에탄올에 노출된 후 발생하는 신체적, 세포 및 유전자 개조를 연구하고<sup&gt; 1</sup&gt;. 그러면 잠재적인 개입을 찾아 신속하게이 동물 모델에서 그들을 시험을 추구합니다.

태아 알코올 노출의 Zebrafish 모델에서 Teratogenic 변경 사항 평가

Fetal alcohol syndrome (FAS) is a severe manifestation of embryonic exposure to ethanol. It presents with characteristic defects to the face and organs, ...

assessing-teratogenic-changes-zebrafish-model-fetal-alcohol

Research

JoVE Journal

Medicine

26.2K 조회수.  Children's Memorial Research Center. 에탄올로 유도된 발달 손상의 분자 메커니즘을 이해하려면, 우리는 에탄올 노출 zebrafish 모델을 개발하고 에탄올에 노출된 후 발생하는 신체적, 세포 및 유전자 개조를 연구하고 1. 그러면 잠재적인 개입을 찾아 신속하게이 동물 모델에서 그들을 시험을 추구합니다.

비디오: Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure

The Polyvinyl Alcohol Sponge Model Implantation

Wound healing is a complicated, multistep process involving many cell types, growth factors and compounds1-3. Because of this complexity, wound healing studies are most comprehensive when carried out in vivo. There are many in vivo models available to study acute wound healing, including incisional, excisional, dead space, and burns. Dead space models are artificial, porous implants which are used to study tissue formation and the effects of substances on the wound. Some of the commonly used dead space models include polyvinyl alcohol (PVA) sponges, steel wire mesh cylinders, expanded polytetrafluoroethylene (ePTFE) material, and the Cellstick1,2.
Each dead space model has its own limitations based on its material's composition and implantation methods. The steel wire mesh cylinder model has a lag phase of infiltration after implantation and requires a long amount of time before granulation tissue formation begins1. Later stages of wound healing are best analyzed using the ePTFE model1,4. The Cellstick is a cellulose sponge inside a silicon tube model which is typically used for studying human surgery wounds and wound fluid2. The PVA sponge is limited to acute studies because with time it begins to provoke a foreign body response which causes a giant cell reaction in the animal5. Unlike other materials, PVA sponges are easy to insert and remove, made of inert and non-biodegradable materials and yet are soft enough to be sectioned for histological analysis2,5.
In wound healing the PVA sponge is very useful for analyzing granulation tissue formation, collagen deposition, wound fluid composition, and the effects of substances on the healing process1,2,5. In addition to its use in studying a wide array of attributes of wound healing, the PVA sponge has also been used in many other types of studies. It has been utilized to investigate tumor angiogenesis, drug delivery and stem cell survival and engraftment1,2,6,7. With its great alterability, prior extensive use, and reproducible results, the PVA sponge is an ideal model for many studies1,2.
Here, we will describe the preparation, implantation and retrieval of PVA sponge disks (Figure 1) in a mouse model of wound healing.

A useful tool to analyze the effects of drugs, growth factors, and/or manipulated cells in an animal model of wound repair is described. This technique utilizes the properties of a polyvinyl alcohol (PVA) sponge to deliver and contain the desired treatment and also provide a platform to be excised and analyzed.

폴리비닐 알코올 스폰지 모델 주입

Wound healing is a complicated, multistep process involving many cell types, growth factors and compounds1-3. Because of this complexity, wound healing ...

연구

의학

A Novel Surgical Approach for Intratracheal Administration of Bioactive Agents in a Fetal Mouse Model

Prenatal pulmonary delivery of cells, genes or pharmacologic agents could provide the basis for new therapeutic strategies for a variety of genetic and acquired diseases. Apart from congenital or inherited abnormalities with the requirement for long-term expression of the delivered gene, several non-inherited perinatal conditions, where short-term gene expression or pharmacological intervention is sufficient to achieve therapeutic effects, are considered as potential future indications for this kind of approach. Candidate diseases for the application of short-term prenatal therapy could be the transient neonatal deficiency of surfactant protein B causing neonatal respiratory distress syndrome1,2 or hyperoxic injuries of the neonatal lung3. Candidate diseases for permanent therapeutic correction are Cystic Fibrosis (CF)4, genetic variants of surfactant deficiencies5 and &alpha;1-antitrypsin deficiency6.
Generally, an important advantage of prenatal gene therapy is the ability to start therapeutic intervention early in development, at or even prior to clinical manifestations in the patient, thus preventing irreparable damage to the individual. In addition, fetal organs have an increased cell proliferation rate as compared to adult organs, which could allow a more efficient gene or stem cell transfer into the fetus. Furthermore, in utero gene delivery is performed when the individual's immune system is not completely mature. Therefore, transplantation of heterologous cells or supplementation of a non-functional or absent protein with a correct version should not cause immune sensitization to the cell, vector or transgene product, which has recently been proven to be the case with both cellular and genetic therapies7.
In the present study, we investigated the potential to directly target the fetal trachea in a mouse model. This procedure is in use in larger animal models such as rabbits and sheep8, and even in a clinical setting9, but has to date not been performed before in a mouse model. When studying the potential of fetal gene therapy for genetic diseases such as CF, the mouse model is very useful as a first proof-of-concept because of the wide availability of different transgenic mouse strains, the well documented embryogenesis and fetal development, less stringent ethical regulations, short gestation and the large litter size.
Different access routes have been described to target the fetal rodent lung, including intra-amniotic injection10-12, (ultrasound-guided) intrapulmonary injection13,14 and intravenous administration into the yolk sac vessels15,16 or umbilical vein17. Our novel surgical procedure enables researchers to inject the agent of choice directly into the fetal mouse trachea which allows for a more efficient delivery to the airways than existing techniques18.

We developed a novel surgical approach for intratracheal administration of bioactive agents into the mouse fetus. The delivery route is more efficient in targeting the fetal mouse lungs than the commonly used intra-amniotic injection. This procedure has to date not been described in a mouse model.

태아 마우스 모델에서 Bioactive 에이전트의 Intratracheal 관리를위한 소설 외과 접근

Prenatal pulmonary delivery of cells, genes or pharmacologic agents could provide the basis for new therapeutic strategies for a variety of genetic and ...

Screening for Melanoma Modifiers using a Zebrafish Autochthonous Tumor Model

Genomic studies of human cancers have yielded a wealth of information about genes that are altered in tumors1,2,3. A challenge arising from these studies is that many genes are altered, and it can be difficult to distinguish genetic alterations that drove tumorigenesis from that those arose incidentally during transformation. To draw this distinction it is beneficial to have an assay that can quantitatively measure the effect of an altered gene on tumor initiation and other processes that enable tumors to persist and disseminate. Here we present a rapid means to screen large numbers of candidate melanoma modifiers in zebrafish using an autochthonous tumor model4 that encompasses steps required for melanoma initiation and maintenance. A key reagent in this assay is the miniCoopR vector, which couples a wild-type copy of the mitfa melanocyte specification factor to a Gateway recombination cassette into which candidate melanoma genes can be recombined5. The miniCoopR vector has a mitfa rescuing minigene which contains the promoter, open reading frame and 3'-untranslated region of the wild-type mitfa gene. It allows us to make constructs using full-length open reading frames of candidate melanoma modifiers. These individual clones can then be injected into single cell Tg(mitfa:BRAFV600E);p53(lf);mitfa(lf)zebrafish embryos. The miniCoopR vector gets integrated by Tol2-mediated transgenesis6 and rescues melanocytes. Because they are physically coupled to the mitfa rescuing minigene, candidate genes are expressed in rescued melanocytes, some of which will transform and develop into tumors. The effect of a candidate gene on melanoma initiation and melanoma cell properties can be measured using melanoma-free survival curves, invasion assays, antibody staining and transplantation assays.

A rapid way to screen for melanoma modifiers using a zebrafish autochthonous tumor model is presented. It takes advantage of the miniCoopR vector which allows for expression of candidate melanoma genes in melanocytes. A method to obtain melanoma-free survival curves, an invasion assay, a protocol for antibody staining of scale melanocytes and a melanoma transplantation assay are described.

Zebrafish Autochthonous 종양 모델을 사용하여 흑종 조절을위한 검사

Genomic studies of  human cancers have yielded a wealth of information about genes that are altered  in tumors1,2,3. A challenge arising from these ...

Fetal Echocardiography and Pulsed-wave Doppler Ultrasound in a Rabbit Model of Intrauterine Growth Restriction

Fetal intrauterine growth restriction (IUGR) results in abnormal cardiac function that is apparent antenatally due to advances in fetoplacental Doppler ultrasound and fetal echocardiography. Increasingly, these imaging modalities are being employed clinically to examine cardiac function and assess wellbeing in utero, thereby guiding timing of birth decisions. Here, we used a rabbit model of IUGR that allows analysis of cardiac function in a clinically relevant way. Using isoflurane induced anesthesia, IUGR is surgically created at gestational age day 25 by performing a laparotomy, exposing the bicornuate uterus and then ligating 40-50% of uteroplacental vessels supplying each gestational sac in a single uterine horn. The other horn in the rabbit bicornuate uterus serves as internal control fetuses. Then, after recovery at gestational age day 30 (full term), the same rabbit undergoes examination of fetal cardiac function. Anesthesia is induced with ketamine and xylazine intramuscularly, then maintained by a continuous intravenous infusion of ketamine and xylazine to minimize iatrogenic effects on fetal cardiac function. A repeat laparotomy is performed to expose each gestational sac and a microultrasound examination (VisualSonics VEVO 2100) of fetal cardiac function is performed. Placental insufficiency is evident by a raised pulsatility index or an absent or reversed end diastolic flow of the umbilical artery Doppler waveform. The ductus venosus and middle cerebral artery Doppler is then examined. Fetal echocardiography is performed by recording B mode, M mode and flow velocity waveforms in lateral and apical views. Offline calculations determine standard M-mode cardiac variables, tricuspid and mitral annular plane systolic excursion, speckle tracking and strain analysis, modified myocardial performance index and vascular flow velocity waveforms of interest. This small animal model of IUGR therefore affords examination of in utero cardiac function that is consistent with current clinical practice and is therefore useful in a translational research setting.

We describe examination of fetal cardiac function with contemporary functional fetal echocardiography and fetoplacental Doppler ultrasound using the VisualSonics VEVO 2100 microultrasound in a surgically induced model of intrauterine fetal growth restriction in a rabbit.

자궁 내 성장 제한의 토끼 모델에서 태아 심 초음파 및 펄스 파 도플러 초음파

Fetal intrauterine growth restriction (IUGR) results in abnormal cardiac function that is apparent antenatally due to advances in fetoplacental Doppler ...

Assessing Changes in Volatile General Anesthetic Sensitivity of Mice after Local or Systemic Pharmacological Intervention

One desirable endpoint of general anesthesia is the state of unconsciousness, also known as hypnosis. Defining the hypnotic state in animals is less straightforward than it is in human patients. A widely used behavioral surrogate for hypnosis in rodents is the loss of righting reflex (LORR), or the point at which the animal no longer responds to their innate instinct to avoid the vulnerability of dorsal recumbency. We have developed a system to assess LORR in 24 mice simultaneously while carefully controlling for potential confounds, including temperature fluctuations and varying gas flows. These chambers permit reliable assessment of anesthetic sensitivity as measured by latency to return of the righting reflex (RORR) following a fixed anesthetic exposure. Alternatively, using stepwise increases (or decreases) in anesthetic concentration, the chambers also enable determination of a population's sensitivity to induction (or emergence) as measured by EC50 and Hill slope. Finally, the controlled environmental chambers described here can be adapted for a variety of alternative uses, including inhaled delivery of other drugs, toxicology studies, and simultaneous real-time monitoring of vital signs.

Loss of the righting reflex has long served as a standard behavioral surrogate for unconsciousness, also called hypnosis, in laboratory animals. Alterations in volatile anesthetic sensitivity caused by pharmacological interventions can be detected with a carefully controlled high-throughput assessment system, which may be adapted for delivery of any inhaled therapeutic.

One desirable endpoint of general anesthesia is  the state of unconsciousness, also known as hypnosis. Defining the hypnotic state in animals is  less ...

A Possible Zebrafish Model of Polycystic Kidney Disease: Knockdown of wnt5a Causes Cysts in Zebrafish Kidneys

Polycystic kidney disease (PKD) is one of the most common causes of end-stage kidney disease, a devastating disease for which there is no cure. The molecular mechanisms leading to cyst formation in PKD remain somewhat unclear, but many genes are thought to be involved. Wnt5a is a non-canonical glycoprotein that regulates a wide range of developmental processes. Wnt5a works through the planar cell polarity (PCP) pathway that regulates oriented cell division during renal tubular cell elongation. Defects of the PCP pathway have been found to cause kidney cyst formation. Our paper describes a method for developing a zebrafish cystic kidney disease model by knockdown of the wnt5a gene with wnt5a antisense morpholino (MO) oligonucleotides. Tg(wt1b:GFP) transgenic zebrafish were used to visualize kidney structure and kidney cysts following wnt5a knockdown. Two distinct antisense MOs (AUG - and splice-site) were used and both resulted in curly tail down phenotype and cyst formation after wnt5a knockdown. Injection of mouse Wnt5a mRNA, resistant to the MOs due to a difference in primary base pair structure, rescued the abnormal phenotype, demonstrating that the phenotype was not due to &#8220;off-target&#8221; effects of the morpholino. This work supports the validity of using a zebrafish model to study wnt5a function in the kidney.

A Possible Zebrafish Model of Polycystic Kidney Disease: Knockdown of wnt5a Causes Cysts in Zebrafish Kidneys

We describe a method of generating a possible zebrafish model of polycystic kidney disease. We used Tg(wt1b:GFP) fish to visualize kidney structure. Knockdown of wnt5a was by morpholino injection. Pronephric cyst formation after wnt5a knockdown was observed in this GFP transgenic zebrafish.

다낭성 신장 질환의 가능한 제브라 피쉬 모델 :의 넉다운<em&gt; wnt5a</em&gt; Zebrafish의 신장의 낭종 원인

Polycystic kidney disease (PKD) is one of the most common causes of end-stage kidney disease, a devastating disease for which there is no cure. The ...

A Mouse Fetal Skin Model of Scarless Wound Repair

Early in utero, but not in postnatal life, cutaneous wounds undergo regeneration and heal without formation of a scar. Scarless fetal wound healing occurs across species but is age dependent. The transition from a scarless to scarring phenotype occurs in the third trimester of pregnancy in humans and around embryonic day 18 (E18) in mice. However, this varies with the size of the wound with larger defects generating a scar at an earlier gestational age. The emergence of lineage tracing and other genetic tools in the mouse has opened promising new avenues for investigation of fetal scarless wound healing. However, given the inherently high rates of morbidity and premature uterine contraction associated with fetal surgery, investigations of fetal scarless wound healing in vivo require a precise and reproducible surgical model. Here we detail a reliable model of fetal scarless wound healing in the dorsum of E16.5 (scarless) and E18.5 (scarring) mouse embryos.

During mammalian development, early gestational skin wounds heal without a scar. Here we detail a reliable and reproducible model of fetal scarless wound healing in the cutaneous dorsum of E16.5 (scarless) and E18.5 (scarring) mouse embryos.

흉터 상처 수리의 마우스 태아의 피부 모델

Early in utero, but not in postnatal life, cutaneous wounds undergo regeneration and heal without formation of a scar. Scarless fetal wound healing occurs ...

Generation of a Chronic Obstructive Pulmonary Disease Model in Mice by Repeated Ozone Exposure

Chronic obstructive pulmonary disease (COPD) is characterized by persistent airflow limitation and lung parenchymal destruction. It has a very high incidence in aging populations. The current conventional therapies for COPD focus mainly on symptom-modifying drugs; thus, the development of new therapies is urgently needed. Qualified animal models of COPD could help to characterize the underlying mechanisms and can be used for new drug screening. Current COPD models, such as lipopolysaccharide (LPS) or the porcine pancreatic elastase (PPE)-induced emphysema model, generate COPD-like lesions in the lungs and airways but do not otherwise resemble the pathogenesis of human COPD. A cigarette smoke (CS)-induced model remains one of the most popular because it not only simulates COPD-like lesions in the respiratory system, but it is also based on one of the main hazardous materials that causes COPD in humans. However, the time-consuming and labor-intensive aspects of the CS-induced model dramatically limit its application in new drug screening. In this study, we successfully generated a new COPD model by exposing mice to high levels of ozone. This model demonstrated the following: 1) decreased forced expiratory volume 25, 50, and 75/forced vital capacity (FEV25/FVC, FEV50/FVC, and FEV75/FVC), indicating the deterioration of lung function; 2) enlarged lung alveoli, with lung parenchymal destruction; 3) reduced fatigue time and distance; and 4) increased inflammation. Taken together, these data demonstrate that the ozone exposure (OE) model is a reliable animal model that is similar to humans because ozone overexposure is one of the etiological factors of COPD. Additionally, it only took 6 - 8 weeks, based on our previous work, to create an OE model, whereas it requires 3 - 12 months to induce the cigarette smoke model, indicating that the OE model might be a good choice for COPD research.

This study describes the successful generation of a new chronic obstructive pulmonary disease (COPD) animal model by repeatedly exposing mice to high concentrations of ozone.

반복된 오존 노출에 의해 쥐에 만성 폐쇄성 폐 질환 모델의 생성

Chronic obstructive pulmonary disease (COPD) is characterized by persistent airflow limitation and lung parenchymal destruction. It has a very high ...

Model Surgical Training: Skills Acquisition in Fetoscopic Laser Photocoagulation of Monochorionic Diamniotic Twin Placenta Using Realistic Simulators

Fetoscopic laser coagulation of arterio-venous anastomoses (AVA) in a monochorionic placenta is the standard of care for twin-twin transfusion syndrome (TTTS), but is technically challenging and can lead to significant complications. Acquiring and maintaining the necessary surgical skills require consistent practice, a critical caseload, and time. Training on realistic surgical simulators can potentially shorten this steep learning curve and enables several proceduralists to acquire procedure-specific skills simultaneously. Here we describe realistic simulators designed to allow the user familiarity with the equipment and specific steps required in the surgical treatment of TTTS, including fetoscopic handling, approaches to anterior and posterior placenta, recognition of anastomoses, and efficient coagulation of vessels. We describe the skills that are especially important in conducting placental laser coagulation that the surgeon can practice on the model and apply in a clinical case. These models can be adapted easily depending on the availability of materials and require standard fetoscopy equipment. Such training systems are complementary to traditional surgical apprenticeships and can be useful aids for fetal medicine units that provide this clinical service.

Practicing the specific skills required for fetoscopic laser coagulation of monochorionic placental anastomoses on realistic models can aid less experienced surgeons in overcoming the steep learning curve associated with this procedure that is now regarded as the standard of care for twin-twin transfusion syndrome.

Monochorionic Diamniotic 트윈 태 현실 시뮬레이터를 사용 하 여의 Fetoscopic 레이저 Photocoagulation에서 모델 외과 교육: 기술 습득

Fetoscopic laser coagulation of arterio-venous anastomoses (AVA) in a monochorionic placenta is the standard of care for twin-twin transfusion syndrome ...

A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish

The genetically accessible adult zebrafish (Danio rerio) has been increasingly used as a vertebrate model for understanding human diseases such as cardiomyopathy. Because of its convenience and amenability to high throughput genetic manipulations, the generation of acquired cardiomyopathy models, such as the doxorubicin-induced cardiomyopathy (DIC) model in adult zebrafish, is opening the doors to new research avenues, including discovering cardiomyopathy modifiers via forward genetic screening. Different from the embryonic zebrafish DIC model, both initial acute and later chronic phases of cardiomyopathy can be determined in the adult zebrafish DIC model, enabling the study of stage-dependent signaling mechanisms and therapeutic strategies. However, variable results can be obtained with the current model, even in the hands of experienced investigators. To facilitate future implementation of the DIC model, we present a detailed protocol on how to generate this DIC model in adult zebrafish and describe two alternative ways of intraperitoneal (IP) injection. We further discuss options on how to reduce variations to obtain reliable results and provide suggestions on how to appropriately interpret the results.

A method to generate a doxorubicin-induced cardiomyopathy model in adult zebrafish (Danio rerio) is described here. Two alternative ways of intraperitoneal injection are presented and conditions to reduce variations among different experimental groups are discussed.