Wir danken Gordon Freeman für die Bereitstellung des anti-PD-L1 blockierenden Antikörpers. Wir danken der klinischen und Laborpersonal am Massachusetts General Hospital und allen Studienteilnehmern für ihre unschätzbare Rolle in diesem Projekt. , National Heart Lung and Blood Institute der National Institutes of Health (RO1 HL-092565; DEK) Diese Studie wurde durch das Nationale Institut für Allergie und Infektionskrankheiten der National Institutes of Health (DEK PA1 AI-080192) gefördert. DEK ist von einem Research Scholar Career Award der Quebec Health Research Fund (FRQS) unterstützt. FP wird durch ein Stipendium Erteilung des Massachusetts General Hospital Vorstand für Forschung und der Harvard Global Health Institute (HGHI) unterstützt.

1. Entleerung und Isolierung von PBMCs durch Ficoll-Trennung <ol><li> Abbau CD8 + T-Zellen durch Zugabe von Menschen CD8 +-Depletion Cocktail bei 50 ul / ml Vollblut. </li><li> Gut mischen und Inkubation für 20 min bei Raumtemperatur (18-25 ° C). </li><li> Nach der Inkubation mischen Vollblut mit HBSS (Hanks Balanced Salt Solution ohne Ca 2 + oder Mg 2 +) und Schicht über Histopaque. Spin bei 340 rcf für 30 min (keine Bremse, langsame Beschleunigung). </li><li> Sammeln PBMCs und Transfer zu einem neuen 50 ml konisch. Wasch 2x mit 45 ml RPMI 1640 mit 50 IE Penicillin, 50 ug / ml Streptomycin, 2 mM L-Glutamin und 1% HEPES durch Schleudern für 10 min bei 340 rcf ergänzt. </li></ol> 2. Antikörper-Blockade und Antigen-spezifische Stimulation der Zellen <ol><li> Die Zellen in 2x10 6 pro Bedingung in RPMI 1640 mit 10% Humanserum und 50 IU Penicillin, 50 ug / ml Streptomycin, 2 mM L-Glutamin und 1% HEPES,Anteil von 500 ul pro Zustand. </li><li> Aliquot 500 ul Zellsuspension pro FACS-Röhrchen. </li><li> Abhängig von der Bahn untersucht, fügen PD-L1, IL-10Rα-blockierende Antikörper und / oder Isotyp-Kontrollen bei 10 ug / ml und Inkubation für 15 min bei 37 ° C, 5% CO 2. </li><li> Stimulierung von Zellen mit einem HIV-1-Gag-Peptid-Pool bei 1 &amp;mgr; g / ml / Peptid-Endkonzentration. Auch eine &quot;keine Stimulation&quot;-Steuerung für jede Sperrung Zustand. Bei 37 ° C, 5% CO 2 für 48 Stunden. </li></ol> 3. Sammlung und Analyse der Überstand <ol><li> Nach 48 Stunden, Spin-down FACS-Röhrchen für 7 min bei 340 rcf. </li><li> 2 x 225 ul Überstand in Eppendorf-Röhrchen für Luminex Bead Arrays sorgfältig sammeln, ohne das Pellet zu stören. </li><li> Inaktivierung von Viren im Überstand gesammelt mit 25 ul 0,5% PBS-Tween, um eine Endkonzentration von 0,05% Tween-PBS zu ergeben. </li><li> Shop gesammelten Überstände, die nicht immed sindiately in einem -80 ° C Gefrierschrank eingesetzt. </li><li> Messen gewünschten Cytokin-Konzentrationen unter Verwendung von Millipore Luminex-Kit nach Herstellerprotokoll. </li></ol> 4. Sammlung und phänotypische Analyse von Zellen via Durchflusszytometrie <ol><li> Nach dem Sammeln der Überstand, waschen Sie die Zellen in 3 ml PBS. Spin-Zellen für 7 min bei 340 rcf und dekantieren überschüssigen Wasch. </li><li> Stain für die Lebensfähigkeit mit einem LIVE / DEAD Fixable Dead Cell Stain Kit nach Herstellerprotokoll. </li><li> Waschen der Zellen in PBS für 7 Minuten bei 340 RCF und bei 4 ° C. Resuspendieren in 100 &amp;mgr; l PBS, 1% FBS. </li><li> Wenn Färbung auf Monozyten oder anderen Antigen-präsentierenden Zellen, Block-Fc-Rezeptoren durch Zugabe von 1,4 ul FcR Blockingreagenz und Wirbel zu mischen. </li><li> Inkubation für 10 min bei 4 ° C. </li><li> In Oberfläche Antikörper, Vortex, und Inkubation für 20 min bei 4 ° C im Dunkeln. </li><li> Waschen der Zellen mit PBS 1% FBS, dekantieren überschüssigen Wasch, und mit 200 ul 4% Paraformaldehyd. Bebrütenbei Raumtemperatur für 20 Minuten im Dunkeln. </li><li> Waschen der Zellen mit PBS 1% FBS, Resuspendieren in 250 ul PBS 1% FBS und erwerben auf einer Vielfach Durchflusszytometer (zB BD LSRII oder Fortessa). </li></ol> 5. Die Analyse der Zellen über qRT-PCR <ol><li> Für Zellen, die nicht über Durchflusszytometrie analysiert: Nach der Überstand Sammlung, lysieren Zellen in 300 ul Qiagen Buffer RLT mit 1% beta-Mercaptoethanol. Wenn nicht mit dem Protokoll weiter, können die Zellen bei -80 ° C nach diesem Zeitpunkt eingefroren werden. </li><li> Isolieren RNA unter Verwendung einer RNA Isolation Kit nach dem Protokoll des Herstellers. </li><li> Synthetisieren von cDNA aus RNA unter Verwendung eines cDNA-Synthese-Kit nach Herstellerprotokoll. </li><li> Führen quantitative PCR mit SYBR Green Technologie. </li><li> Erstellen einer Primer-Gemisch für jeden Primer durch Zugabe von Primern, um Nuklease-freies Wasser bis zu einer Endkonzentration von 10 geben, verwendet werden, einschließlich Haushaltsgene (z. B. IL-13, IL-10, IFN-γ, GAPDH)uM. Halten Sie auf dem Eis. </li><li> Erstellen Sie ein Master-Mix für jeden Primer durch Zugabe von 10,5 ul Nuklease-freies Wasser, 12,5 ul SYBR Grün und 1 ul Primer-Mix pro Platte auch. Halten Sie auf dem Eis. </li><li> Pipette 24 ul Master-Mix in jede Vertiefung der Platte, die verwendet werden. </li><li> 1 ul cDNA in jede Vertiefung nach Vorlage. </li><li> Cap Brunnen und Zentrifugenplatte für 3 min bei 800 rcf. </li><li> Führen Platte auf einem qRT-PCR-Maschine, zB eine Stratagene Mx3005P Instrument. </li></ol> 6. Die Anpassung für die intrazelluläre Zytokin-Färbung bei 48 h In Brefeldin und Monensin 6 Stunden vor der intrazellulären Zytokin-Färbung. Brefeldin in einer Konzentration von 10 ug / ml zugegeben, während Monensin wird gemäß den Anweisungen des Herstellers zugegeben. Der Einfachheit halber können Brefeldin 12 Stunden vor in einer Konzentration von 5 ug / ml Fleck hinzugefügt werden. <ol><li> Nach der Oberflächen Fleck, waschen Sie die Zellen mit PBS 1% FBS und Fleck inzellulären Zytokinen wie IL-12, IFN-γ und TNF-α unter Verwendung einer Fixierung / Permeabilisierung Lösung Satz und Protokoll. </li><li> Waschen der Zellen, Resuspendieren in 250 ul PBS 1% FBS, und auf einer Vielfach Durchflusszytometer (zB BD LSR II oder Fortessa). </li></ol> 7. Anpassung zum Sortieren Cells <ol><li> 16 Stunden nach der Stimulation, Flecken für die Lebensfähigkeit mit LIVE / DEAD Fixable Dead Cell Stain Kit nach Herstellerprotokoll. Halten Zellen auf Eis während der gesamten Prozedur. </li><li> Waschen der Zellen mit PBS für 7 Minuten bei 340 RCF und bei 4 ° C. Resuspendieren in 100 &amp;mgr; l PBS, 1% FBS. </li><li> In Oberfläche Antikörper, Vortex zu mischen, und Inkubation Zellen auf Eis im Dunkeln für 20 min. </li><li> Waschen der Zellen mit PBS, 1% FBS bei 340 RCF und bei 4 ° C und Resuspension in 500 &amp;mgr; l kaltem RPMI 1640 mit 10% fötalem Rinderserum mit 50 IU Penicillin, 50 ug / ml Streptomycin, 2 mM L-Glutamin und 1% HEPES. </li><li> Filterzellen unter Verwendung von 5 ml Polystyrolrene-Rundrohr mit den Cell-Sieb Kappe. </li><li> Vorbereitung Röhrchen für Sortier durch Zugabe von 200 &amp;mgr; l RPMI 1640, enthaltend 10% fötales Rinderserum, ergänzt mit 50 IU Penicillin, 50 ug / ml Streptomycin, 2 mM L-Glutamin und 1% HEPES in jedes Röhrchen. Halten Sie alle Röhrchen auf Eis beim Sortieren. </li><li> Sortieren Sie die Live-Zell-Untergruppen von Interesse an einem Instrument (zB BD FACS Aria II) in einer Einrichtung für biologische Gefahrenstoffe ausgestattet entfernt. </li><li> Nachdem die Zellen wurden sortiert, Ortszellen zurück in den Inkubator für die gewünschte Menge an Zeit und folgen mit Überstand Sammlung / Luminex Analyse und Zellpellet Sammlung / PCR-Analyse. </li></ol>

<ol>
	<li>Zajac, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+immune+evasion+due+to+persistence+of+activated+T+cells+without+effector+function.">Viral immune evasion due to persistence of activated T cells without effector function.</a> J. Exp. Med. 188, 2205-2213 (1998).</li><li>Wherry, E. J., Blattman, J. N., Murali-Krishna, K., vander Most, R., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+persistence+alters+CD8+T-cell+immunodominance+and+tissue+distribution+and+results+in+distinct+stages+of+functional+impairment.">Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment.</a> J. Virol. 77, 4911-4927 (2003).</li><li>Kwon, D. S., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+and+detrimental+roles+of+IL-10+in+HIV+pathogenesis.">Protective and detrimental roles of IL-10 in HIV pathogenesis.</a> Eur. Cytokine Netw. 21, 208-214 (2010).</li><li>Porichis, F., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+PD-1+in+HIV+pathogenesis+and+as+target+for+therapy.">Role of PD-1 in HIV pathogenesis and as target for therapy.</a> Curr. HIV/AIDS Rep. 9, 81-90 (2012).</li><li>Wherry, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+exhaustion.">T cell exhaustion.</a> Nat. 12, 492-499 (2011).</li><li>Trautmann, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+PD-1+expression+on+HIV-specific+CD8++T+cells+leads+to+reversible+immune+dysfunction.">Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.</a> Nat. Med. 12, 1198-1202 (2006).</li><li>Day, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+expression+on+HIV-specific+T+cells+is+associated+with+T-cell+exhaustion+and+disease+progression.">PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression.</a> Nature. 443, 350-354 (2006).</li><li>Brockman, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-10+is+up-regulated+in+multiple+cell+types+during+viremic+HIV+infection+and+reversibly+inhibits+virus-specific+T+cells.">IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.</a> Blood. 114, 346-356 (2009).</li><li>Barber, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoring+function+in+exhausted+CD8+T+cells+during+chronic+viral+infection.">Restoring function in exhausted CD8 T cells during chronic viral infection.</a> Nature. 439, 682-687 (2006).</li><li>Zhang, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+up-regulation+is+correlated+with+HIV-specific+memory+CD8++T-cell+exhaustion+in+typical+progressors+but+not+in+long-term+nonprogressors.">PD-1 up-regulation is correlated with HIV-specific memory CD8+ T-cell exhaustion in typical progressors but not in long-term nonprogressors.</a> Blood. 109, 4671-4678 (2007).</li><li>Ndhlovu, Z. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-dimensional+immunomonitoring+models+of+HIV-1-specific+CD8+T-cell+responses+accurately+identify+subjects+achieving+spontaneous+viral+control.">High-dimensional immunomonitoring models of HIV-1-specific CD8 T-cell responses accurately identify subjects achieving spontaneous viral control.</a> Blood. 121, 801-811 (2013).</li><li>Porichis, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Responsiveness+of+HIV-specific+CD4+T+cells+to+PD-1+blockade.">Responsiveness of HIV-specific CD4 T cells to PD-1 blockade.</a> Blood. 118, 965-974 (2011).</li><li>Kwon, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD4++CD25++regulatory+T+cells+impair+HIV-1-specific+CD4+T+cell+responses+by+upregulating+interleukin-10+production+in+monocytes.">CD4+ CD25+ regulatory T cells impair HIV-1-specific CD4 T cell responses by upregulating interleukin-10 production in monocytes.</a> 86, 6586-6594 (2012).</li></ol>

Die Autoren erklären, dass sie keine finanziellen Interessen konkurrieren.

Der Überstand Sammlung ist ein Imperativ Teil dieser experimentellen Design. Bei der Ernte der Überstände zur Luminex-Assay wurden Aliquote hergestellt und bei -80 ° C gehalten, um den Proteinabbau durch Zyklen Einfrieren-Auftauen zu verhindern. Einfrieren und Auftauen kann hart Verfahren für Proteine ​​und durch Gefrier taut minimiert sein, werden in Tests Signal maximiert werden. Daher ist es einfacher, wiederholbare und genaue Daten beim Arbeiten von Aliquots, die gefriertaut die gleiche Anzahl von Zeiten zu...

Während der anhaltenden viralen Infektionen, Virus-spezifischen T-Zellen-erwerben Funktionsstörungen in einem Prozess als T-Zell-Erschöpfung bekannt. Früh in-vivo-Studien im murinen Modell der LCMV chronische Virusinfektion angegeben, dass erschöpft Virus-spezifische T-Zellen gegen zytolytische Funktion viral infizierte Zellen reduziert, verlieren ihre Fähigkeit zu vermehren und haben Fähigkeit, Zytokine wie IL-2, TNF-produzieren reduziert α und IFN-γ 1,2. Ein komplexes Netzwerk von immunWege, wie PD-1 und IL-10, während chronische Infektionen hochreguliert und zur T-Zell-Funktionsstörung (in 3,4 bewertet). In vivo-Verabreichung von blockierenden Antikörpern gegen diese hemmenden Bahnen in der LCMV-Maus Modell restauriert Funktion erschöpft virusspezifischen T-Zellen und eine verbesserte Virenfreiheit, die anzeigt, dass T-Zell-Erschöpfung ist ein Phänomen teilweise reversibel (in 5 Bewertung). Erkenntnisse über thE LCMV-Modell wurden schnell die menschliche chronische Virusinfektionen wie HBV, HCV und HIV 5 verlängert. Bei der chronischen HIV-1-Infektion, sind PD-1 und IL-10 Wege in infizierten Patienten hochreguliert und korrelieren mit den Parametern der Krankheitsprogression, direkt mit der Viruslast und umgekehrt mit der CD4-Zellzahl 6-8. Antikörper Blockade der PD-1 oder IL-10 in vitro Wege wiederhergestellt Proliferation von HIV-spezifischen CD4-und CD8-T-Zellen, was anzeigt, dass, ähnlich der LCMV-Maus-Modell, ist T-Zell-Erschöpfung bei Menschen eine teilweise reversible Phänomen. Aufgrund der empfindlichen Natur von Experimenten an menschlichen Proben sowie Einschränkungen in der Empfindlichkeit der in-vitro-Assays, gründliche Untersuchung der funktionellen Wiederherstellung von Profilen dieser Interventionen erreicht wird, ist jedoch auffallend abwesend. Proliferationsassays wurden, so weit, die einzige zuverlässige in-vitro-Test in den meisten Studien getestet, aber es ist ein bemerkenswerter Mangel an Beweisen über die Auswirkungen dieser interInterventionen auf: 1) die Tötung Kapazität von zytotoxischen T-Zellen, 2) die antivirale Wirkung von T-Zellen auf die virale Replikation, 3) die Zytokinsekretion Profil und 4) die Wirkung auf CD4-T-Zell-Hilfe für andere Zell-Untergruppen. Intrazelluläre Cytokin-Färbung (ICS) ist eine sehr nützliche und weit verbreitet Durchflusszytometrie basierenden Assay, der verwendet wird, um die Produktion von Zytokinen in verschiedenen Zelltypen sowohl in Mäusen und Menschen zu erkennen. Es wurde auch verwendet, um die Wirkung der Antikörperblockade hemmenden Bahnen zu untersuchen. In ICS Assays wird Zytokinsekretion durch Zugabe von Brefeldin und / oder Monensin blockiert. Zytokine in den Zellen eingeschlossen werden dann mit fluoreszierenden Antikörpern mit polychromatischen Durchflusszytometrie detektiert. Die Dauer des Tests wird in der Regel 6 oder 12 Stunden nach der Antigen-Stimulation beschränkt, da sowohl Brefeldin und Monensin, die typischerweise innerhalb von 2 h von Antigen Zugabe zugegeben werden, sind für die Zellen toxisch. Das ICS-Assay ist eine leistungsfähige Technik, die sich als nützlich erwiesen hat in die Untersuchung der Wirkung der in vivo-Verabreichung von blockierenden Antikörper Eingriff mit Mäusen, wurden die Zellen nach einer gewissen Zeit nach der Antikörper-Belichtungs 9 extrahiert. Es gibt jedoch mehrere Einschränkungen bei der Anwendung dieser experimentellen Ansatz, die Auswirkungen der Blockade der inhibitorischen Rezeptoren im menschlichen Proben auszuwerten. Bei der Durchführung von Antikörper Eingriffe hemmenden Bahnen in einer 6 oder 12 h in-vitro-Stimulation (typischerweise der Fall bei humanen Proben), wird die Blockade der hemmenden Rezeptoren in den meisten Fällen die Frequenz reagiert Antigen-spezifischen T-Zellen nicht zu ändern, wie durch Standardassays gemessen ICS 6, 7. Messungen pro Zelle Zytokinproduktion durch Mittelwert oder Median der Fluoreszenzintensität gemessen, haben widersprüchliche Ergebnisse 6, 7, 10 angegeben. Andererseits, wenn ICS zu einem späten Zeitpunkt nach der Stimulierung durchgeführt (dh 6 Tage), Veränderungen in der Anzahl der Cytokin-sezer cEllen beobachtet werden. Die Unterschiede sind ein kombinierter Effekt der veränderten Proliferation, das Überleben und Veränderungen in Effektor-Funktion, die über den angegebenen Zeitraum 6 ansammeln. Eine Möglichkeit, diese Beschränkungen teilweise zu überwinden, ist für längere Zeiträume (z. B. 36 h, 60 h, etc.) Mit dem Antigen vor der Zugabe der Zytokinsekretion Blocker, ohne auf die Proliferation auftritt inkubieren. Wir haben erfolgreich diese Methode verwendet, um die Kinetik der Zytokinsekretion von HIV-spezifischen CD4-und CD8-T-Zellen zu bestimmen, 11,12, jedoch ist dieser Ansatz nicht in der Lage, kleine Antworten detektieren und ein integriertes Ergebnis die Gesamt Zytokinsekretion vorkommenden nicht geben seit Stimulation. Daher ist ICS nicht ausreichend empfindliches Verfahren, um die Auswirkungen der Blockade der hemmenden Bahnen auf der Anzahl von Zytokinen durch aktivierte T-Zellen produziert, verglichen mit Zytokin-mRNA-Quantifizierung oder Messungen der Cytokin-Sekretion im supernatan erkennent in den gleichen Zeitpunkten. Zusätzlich wirken die meisten der von aktivierten T-Zellen produzierten Zytokine in autokriner Weise durch einen Beitrag zur positiven oder negativen Rückkopplungsschleifen durch die Interaktion mit Antigen-präsentierenden Zellen. Daher Zugabe von Monensin oder Brefeldin im ICS Assay verhindert Zytokinsekretion und somit Stimulation von T-Zellen nicht optimal ist. Schließlich wird die Detektion von mehreren Cytokinen mit ICS durch die Verfügbarkeit und die Empfindlichkeit der Antikörper zum Nachweis von Zytokinen mit Durchflusszytometrie als auch durch Beschränkungen in der Anzahl von Fluorochromen, die gleichzeitig in einem gegebenen Panel verwendet werden können, begrenzt. Wir entwickelten ein hochempfindliches in vitro-Versuchsansatz, um die Auswirkungen von immun Wege der Regulierung der Zytokinsekretion von HIV-spezifischen CD4 + T-Zellen und CD4 Hilfe anschließend auf Antigen-präsentierenden Zellen (APCs) und natürliche Killerzellen (NK-Zellen) zu bewerten. Dieses Verfahren kann auch verwendet werden, um die impa evaluierenct Blockade von inhibitorischen Moleküle auf CD8-T-Zellfunktion durch abbau die CD4-T-Zellen aus PBMCs oder durch Stimulation mit optimalen Peptide, die nur von CD8-T-Zellen erkannt werden. Im Gegensatz zu intrazellulären Zytokinfärbung Assays haben wir beschlossen, nicht mit der Cytokin-Sekretion von HIV-spezifischen CD4 + T-Zellen, um in der Lage zu sein, beeinträchtigt: 1) führen eine genauere Quantifizierung der produzierten Zytokinspiegel, 2) Untersuchung eine breitere Platte von Cytokinen oder Effektormoleküle, und 3) die Auswirkungen von von HIV-spezifischen CD4 + T-Zellen auf andere Zellen-Untergruppen produzierten Zytokine. Wir stimulieren CD8 abgereicherten PBMC mit einem HIV-1-Gag-Peptid-Pool in Gegenwart von blockierenden Antikörpern für die immun Weg von Interesse. Nach der gewünschten Inkubationszeit, in der Regel 48 Stunden, sammeln wir die Überstände Zytokinsekretion mit Perlenanordnungen messen und sammeln die Zellpellets entweder für phänotypische Analyse der verschiedenen Zelluntergruppen oder für die Transkriptionsanalyse. Von beachten Sie, dass bei tseine 48 h Zeitpunkt haben wir nicht eine bedeutende Population von proliferierenden T-Zellen 12 zu erfassen. Dies ist ein flexibler Ansatz und mehrere Anpassungen dieser Konstruktion kann angewendet werden, um verschiedene Hypothesen zu adressieren. Zum Beispiel können die einzelnen Zelluntergruppen (z. B. HIV-spezifischen CD4 + T-Zellen oder PD-1 Hoch CD4-T-Zellen, etc..) Nach 12 h Inkubation vor der weiteren Inkubation für 36 Stunden, gefolgt vom Sammeln der Überstände und Zellpellets sortiert um genauer zu untersuchen die Auswirkungen der Blockade auf Interventionen Zytokinsekretion durch definierte Subpopulationen von PBMCs.

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent/Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		 </tr>
		 <tr>
			<td>Hanks Balanced Salt Solution without Ca2+ or Mg2+</td>
			<td>Sigma</td>
			<td>H9394</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RPMI 1640</td>
			<td>Sigma</td>
			<td>R0883</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Histopaque-1077</td>
			<td>Sigma</td>
			<td>10771</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Human Serum AB</td>
			<td>Gemini BioProducts</td>
			<td>100-512</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Penicillin/Streptomycin</td>
			<td>Mediatech</td>
			<td>30 001 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>L-glutamine</td>
			<td>Mediatech</td>
			<td>25 005 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>HEPES buffer</td>
			<td>Mediatech</td>
			<td>25060CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>FcR blocking reagent, human</td>
			<td>Miltenyi</td>
			<td>130-059-901</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RosetteSep Human CD8+ Depletion Cocktail </td>
			<td>Stem Cell </td>
			<td>15663</td>
			<td></td>
		 </tr>
		 <tr>
			<td>LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation</td>
			<td>Invitrogen</td>
			<td>L23105</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Rneasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Improm-II Reverse Transcription System</td>
			<td>Promega</td>
			<td>A3800</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Brilliant II SYBR qPCR Low Rox Master Mix</td>
			<td>Agilent</td>
			<td>600830</td>
			<td></td>
		 </tr>
		 <tr>
			<td>BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit</td>
			<td>BD</td>
			<td>554714</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Tween-20</td>
			<td>Fisher</td>
			<td>BP337100</td>
			<td></td>
		 </tr>
		 <tr>
			<td>IFN-&gamma; primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA</td>
		 </tr>
		 <tr>
			<td>GAPDH primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG</td>
		 </tr>
		</tbody>
 </table>

in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function

T-Zell-Erschöpfung ist ein wichtiger Faktor in gescheiterten Erreger Freiheit während der chronischen Virusinfektionen. Immunwege, wie PD-1 und IL-10 sind bei dieser laufenden Antigenexposition hochreguliert und tragen zum Verlust von Proliferation, cytolytische Funktion reduziert und durch CD4-und CD8-T-Zellen-Cytokinproduktion beeinträchtigt. Im Mausmodell der LCMV-Infektion, die Verwaltung der blockierenden Antikörper gegen diese beiden Wege erweitert T-Zellantworten. Allerdings gibt es noch keine in vitro Assay, um die Auswirkungen dieser Blockade Zytokinsekretion in Zellen aus menschlichen Proben zu messen. Unser Protokoll und experimentellen Ansatz ermöglichen es uns, genau und effizient zu quantifizieren, die Wiederherstellung der Zytokin-Produktion von HIV-spezifischen CD4-T-Zellen von HIV-infizierten Patienten. Hier wird ein in vitro-Versuchsanordnung, die Messungen der Cytokin-Sekretion kann durch HIV-spezifische CD4 + T-Zellen und deren Auswirkungen auf andere cel zeigen wirl Teilmengen. CD8-T-Zellen wurden aus Vollblut erschöpft und Rest PBMCs wurden über Ficoll-Trennverfahren isoliert. CD8-abgereicherten PBMC wurden dann mit blockierenden Antikörpern gegen PD-L1 und / oder IL-10Rα und nach Stimulation mit einem HIV-1-Gag-Peptid-Pool wurden die Zellen bei 37 ° C, 5% CO 2 inkubiert. Nach 48 Stunden Überstand wurde für die Zytokin-Analyse durch Perlen-Arrays und Zellpellets gesammelt wurden, entweder für phänotypische Analyse mittels Durchflusszytometrie oder Transkriptionsanalyse mittels qRT-PCR gesammelt. Für weitere detaillierte Analyse wurden verschiedene Zellpopulationen durch selektive Depletion Teilmenge aus PBMCs oder durch Sortieren mit Durchflusszytometrie, bevor sie in den gleichen Tests untersucht erhalten. Diese Verfahren stellen eine sehr empfindliche und spezifische Ansatz zur Modulation der Cytokin-Produktion durch Antigen-spezifische T-Helferzellen zu bestimmen und funktionellen Wechselwirkungen zwischen den verschiedenen Populationen von Immunzellen zu bestimmen.

Bei der Durchführung von Messungen unter Verwendung dieses Zytokin in vitro-System, ist es wichtig, in der Lage, das Antigen-spezifische Reaktionen gegenüber der Kontrolle ohne Stimulation zu unterscheiden. Im allgemeinen betrachtet man positive Reaktionen wie alle Werte der antigenen Stimulation, die mindestens dreifache Zunahme in Zytokinspiegel Vergleich zu der Kontrolle ohne Stimulierung und davon waren innerhalb des linearen Bereichs des Assays zu ergeben. Wir sind mit hoher Empfindlichkeit Bead-Assays, ...

Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Wir entwickelten ein in vitro Assay, um die Rolle von immunWege in der Regulation der Zytokin-Sekretion von HIV-spezifischen CD4 + T-Zellen zu untersuchen.

In vitro-Test, um die Auswirkungen von immun Pathways auf die HIV-spezifischen CD4 T-Zell-Effektor-Funktion auswerten

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

in-vitro-assay-to-evaluate-impact-immunoregulatory-pathways-on-hiv

Research

JoVE Journal

Immunology and Infection

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

14.0K Aufrufe.  The Ragon Institute of MGH, MIT and Harvard.  Wir entwickelten ein in vitro Assay, um die Rolle von immunWege in der Regulation der Zytokin-Sekretion von HIV-spezifischen CD4 + T-Zellen zu untersuchen. 

Serie: In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&amp;#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

Isolierung und Differenzierung von Th17 Naive CD4-T-Lymphozyten

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

Forschung

Immunologie und Infektion

Transplantation of Tail Skin to Study Allogeneic CD4 T Cell Responses in Mice

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and host T cells, to easily monitor the graft, and to adapt the system in order to answer different immunological questions. Medawar and colleagues established allogeneic tail-skin transplantation in mice in 1955. Since then, the skin transplantation model has been continuously modified and adapted to answer specific questions. The use of tail-skin renders this model easy to score for graft rejection, requires neither extensive preparation nor deep anesthesia, is applicable to animals of all genetic background, discourages ischemic necrosis, and permits chemical and biological intervention. 
In general, both CD4+ and CD8+ allogeneic T cells are responsible for the rejection of allografts since they recognize mismatched major histocompatibility antigens from different mouse strains. Several models have been described for activating allogeneic T cells in skin-transplanted mice. The identification of major histocompatibility complex (MHC) class I and II molecules in different mouse strains including C57BL/6 mice was an important step toward understanding and studying T cell-mediated alloresponses. In the tail-skin transplantation model described here, a three-point mutation (I-Abm12) in the antigen-presenting groove of the MHC-class II (I-Ab) molecule is sufficient to induce strong allogeneic CD4+ T cell activation in C57BL/6 mice. Skin grafts from I-Abm12 mice on C57BL/6 mice are rejected within 12-15 days, while syngeneic grafts are accepted for up to 100 days. The absence of T cells (CD3-/- and Rag2-/- mice) allows skin graft acceptance up to 100 days, which can be overcome by transferring 2 x 104 wild type or transgenic T cells. Adoptively transferred T cells proliferate and produce IFN-&#947; in I-Abm12-transplanted Rag2-/- mice.

Tail-skin transplantation is a powerful model for studying T cell-dependent rejection and tolerance induction during allogeneic immune responses in mice. The advantages of this protocol are minor invasive surgery, and ease of monitoring with no need to sacrifice the recipient mouse.

Transplantation von Haut-Schwanz zu allogene CD4-T-Zellantworten in Mäusen untersucht

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and ...

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte function, in general these are limited in terms of the information they can provide. For example, most existing assays merely provide a percentage of how many granulocytes are activated following a single, fixed length incubation. Complicating matters, most assays focus on only one aspect of function due to limitations in detection technology. This report demonstrates a technique for simultaneous measurement of granulocyte phagocytosis of bacteria and oxidative burst. By measuring both of these functions at the same time, three unique phenotypes of activated granulocytes were identified: 1) Low Activation (minimal phagocytosis, no oxidative burst), 2) Moderate Activation (moderate phagocytosis, some oxidative burst, but no co-localization of the two functional events), and 3) High Activation (high phagocytosis, high oxidative burst, co-localization of phagocytosis and oxidative burst). A fourth population that consisted of inactivated granulocytes was also identified. Using assay incubations of 10, 20, and 40-min the effect of assay incubation duration on the redistribution of activated granulocyte phenotypes was assessed. A fourth incubation was completed on ice as a control. By using serial time incubations, the assay may be able to able to detect how a treatment spatially affects granulocyte function. All samples were measured using an image-based flow cytometer equipped with a quantitative imaging (QI) option, autosampler, and multiple lasers (488, 642, and 785 nm).

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

This method demonstrates a technique for assessing granulocyte function by simultaneously measuring phagocytosis of bacteria and oxidative burst. Image-based flow cytometry allowed for the identification of three distinct subsets of activated granulocytes that all differed in their relative functional capacity.

Bildbasierte Durchflusszytometrie Technik zur Veränderung der Granulozyten-Funktion auswerten<em&gt; In-vitro-</em

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

Die Induktion von Murine Darmentzündungen durch adoptiven Transfer von Effektor CD4<sup&gt; +</sup&gt; CD45RB<sup&gt; Hoch</sup&gt; T-Zellen in immundefizienten Mäusen

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition of cognate antigen presented on MHC class II. The cytokine signals present in the environment at the time of TCR activation are a major factor in determining the effector fate of a na&#239;ve CD4+ T cell. Although the cytokine environment during na&#239;ve T cell activation may be complex and involve both redundant and opposing signals in vivo, the addition of various cytokine combinations during naive CD4+ T cell activation in vitro can readily promote the establishment of effector T helper lineages with hallmark cytokine and transcription factor expression. Such differentiation experiments are commonly used as a first step for the evaluation of targets believed to promote or inhibit the development of certain CD4+ T helper subsets. The addition of mediators, such as signaling agonists, antagonists, or other cytokines, during the differentiation process can also be used to study the influence of a particular target on T cell differentiation. Here, we describe a basic protocol for the isolation of na&#239;ve T cells from mouse and the subsequent steps necessary for polarizing na&#239;ve cells to various T helper effector lineages in vitro.

Mouse Na&amp;#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Na&#239;ve CD4+ T cells polarize to various subsets depending on the environment at the time of activation. The differentiation of na&#239;ve CD4+ T cells to various effector subsets can be achieved in vitro through the addition of T cell receptor stimuli and specific cytokine signals.

Maus Naive CD4<sup&gt; +</sup&gt; T-Zell-Isolierung und<em&gt; In-vitro-</em&gt; Differenzierung in T-Zell-Populationen

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition ...

Application of Long-term cultured Interferon-&#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is controlled up to 95 % of the T cells generated during the expansion phase are eliminated (i.e., contraction phase) and memory T cells remain, sometimes for a lifetime. In humans, two functionally distinct subsets of memory T cells have been described based on the expression of lymph node homing receptors. Central memory T cells express C-C chemokine receptor 7 and CD45RO and are mainly located in T-cell areas of secondary lymphoid organs. Effector memory T cells express CD45RO, lack CCR7 and display receptors associated with lymphocyte homing to peripheral or inflamed tissues. Effector T cells do not express either CCR7 or CD45RO but upon encounter with antigen produce effector cytokines, such as interferon-&#947;. Interferon-&#947; release assays are used for the diagnosis of bovine and human tuberculosis and detect primarily effector and effector memory T cell responses. Central memory T cell responses by CD4+ T cells to vaccination, on the other hand, may be used to predict vaccine efficacy, as demonstrated with simian immunodeficiency virus infection of non-human primates, tuberculosis in mice, and malaria in humans. Several studies with mice and humans as well as unpublished data on cattle, have demonstrated that interferon-&#947; ELISPOT assays measure central memory T cell responses. With this assay, peripheral blood mononuclear cells are cultured in decreasing concentration of antigen for 10 to 14 days (long-term culture), allowing effector responses to peak and wane; facilitating central memory T cells to differentiate and expand within the culture.

Application of Long-term cultured Interferon-&amp;#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Long-term cultured interferon-&#947; enzyme-linked immunospot assay is used as a measure of central memory responses and correlates with protective anti-mycobacterial vaccine responses. With this assay, peripheral blood mononuclear cells are stimulated with mycobacterial antigens and interleukin-2 for 14 days, enabling differentiation and expansion of central memory T cells.

Anwendung von Langzeit kultiviert Interferon-γ Enzyme-linked Immunospot Assay zur Beurteilung Effektor und Gedächtnis-T-Zell-Antworten in Cattle

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

Imaging CD4 T-Zell-Interstitial Migration in den entzündeten Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

Ein<em&gt; In Vitro</em&gt; Modell der Blut-Hirn-Schranke Mit Impedanzspektroskopie: Ein Fokus auf T-Zell-Endothelzellinteraktion

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, including phagocytosis of damaged synapses or cells, debris, and/or invading pathogens. Impaired phagocytic function has been implicated in the pathogenesis of diseases such as Alzheimer's and age-related macular degeneration, where amyloid-&#946; plaque and drusen accumulate, respectively. Despite its importance, microglial phagocytosis has been challenging to assess in vivo. Here, we describe a simple, yet robust, technique for precisely monitoring and quantifying the in vivo phagocytic potential of retinal microglia. Previous methods have relied on immunohistochemical staining and imaging techniques. Our method uses flow cytometry to measure microglial uptake of fluorescently labeled particles after intravitreal delivery to the eye in live rodents. This method replaces conventional practices that involve laborious tissue sectioning, immunostaining, and imaging, allowing for more precise quantification of microglia phagocytic function in just under six hours. This procedure can also be adapted to test how various compounds alter microglial phagocytosis in physiological settings. While this technique was developed in the eye, its use is not limited to vision research.

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglial phagocytosis is critical for the maintenance of tissue homeostasis and inadequate phagocytic function has been implicated in pathology. However, assessing microglia function in vivo is technically challenging. We have developed a simple but robust technique for precisely monitoring and quantifying the phagocytic potential of microglia in a physiological setting.

Die Beurteilung Retinal Microglial Phagozytische Funktion<em&gt; In Vivo</em&gt; Mit einem Durchfluss-Zytometrie basierten Assay

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, ...

In Vitro Differentiation of Human CD4+FOXP3+ Induced Regulatory T Cells (iTregs) from Na&#239;ve CD4+ T Cells Using a TGF-&#946;-containing Protocol

Regulatory T cells (Tregs) are an integral part of peripheral tolerance, suppressing immune reactions against self-structures and thus preventing autoimmune diseases. Clinical approaches to adoptively transfer Tregs, or to deplete Tregs in cancer, are underway with promising first outcomes. 
Because the number of naturally occurring Tregs (nTregs) is very limited, studying certain Treg features using in vitro induced Tregs (iTregs) can be advantageous. To date, the best although not absolutely specific protein marker to delineate Tregs is the transcription factor FOXP3. Despite the importance of Tregs including non-redundant roles of peripherally induced Tregs, the protocols to generate iTregs are currently controversial, particularly for human cells. This protocol therefore describes the in vitro differentiation of human CD4+FOXP3+ iTregs from human na&#239;ve T cells using a range of Treg-inducing factors (TGF-&#946; plus IL-2 only, or their combination with retinoic acid, rapamycin or butyrate) in parallel. It also describes the phenotyping of these cells by flow cytometry and qRT-PCR. 
These protocols result in reproducible expression of FOXP3 and other Treg signature genes and enable the study of general FOXP3-regulatory mechanisms as well as protocol-specific effects to delineate the impact of certain factors. iTregs can be utilized to study various phenotypic aspects as well as molecular mechanisms of Treg induction. Detailed molecular studies are facilitated by relatively large cell numbers that can be obtained. 
A limitation for the application of iTregs is the relative instability of FOXP3 expression in these cells compared to nTregs. iTregs generated by these protocols can also be used for functional assays such as studying their suppressive function, in which iTregs induced by TGF-&#946; plus retinoic acid and rapamycin display superior suppressive activity. However, the suppressive capacity of iTregs can differ from nTregs and the use of appropriate controls is crucial.

&lt;em&gt;In Vitro&lt;/em&gt; Differentiation of Human CD4&lt;sup&gt;+&lt;/sup&gt;FOXP3&lt;sup&gt;+&lt;/sup&gt; Induced Regulatory T Cells (iTregs) from Na&amp;#239;ve CD4&lt;sup&gt;+&lt;/sup&gt; T Cells Using a TGF-&amp;#946;-containing Protocol

This protocol describes the reproducible generation and phenotyping of human induced regulatory T cells (iTregs) from na&#239;ve CD4+ T cells in vitro. Different protocols for FOXP3 induction allow for the study of specific iTreg phenotypes obtained with respective protocols.

In vitro Differenzierung von humanen CD4 + FOXP3 + Induced regulatorischer T - Zellen (iTregs) von Naïve CD4 + T - Zellen unter Verwendung eines TGF-β-enthaltende Protokoll