Name: evaluating the effectiveness of cancer drug sensitization in vitro and in vivo
Uploaded: 2015-02-06T14:00:00.000+00:00
Duration: 9 min 19 s
Description: Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Diese Arbeit durch Zuschüsse zu JK aus den Ontario Centres of Excellence und dem Ontario Research Fund ermöglicht. Wir möchten Siddika Pardhan und Dr. Peter Ferguson, um technische Unterstützung während der Dreharbeiten zu danken.

HINWEIS: Das folgende Protokoll wurde für den Einsatz mit anhaftenden Zellen ausgelegt. Modifikationen sind erforderlich, um das Verfahren zur nicht-adhärenten Zellen in Suspension gezüchtet anzuwenden. Die in dem Protokoll beschrieben CAM Experimente sind zur Verwendung mit Zellen, die einen fluoreszierenden Marker (zB GFP, RFP etc.) zu exprimieren gestaltet. Neun Tage alten Hühnerembryonen werden am Tag 2 des Versuchsprotokoll für die CAM-Experimente erforderlich. 1. Vorbereitung und Transfektion von Tumorzellen mit Antisense-Oligonukleotide (ASOs) <ol><li> Absaugen Medium aus T75-Flasche (n), die Zellen von Interesse, Wäsche mit 1 × PBS und 2 ml 0,25% Trypsin / EDTA. 10 ml vollständigem Wachstumsmedium zu jedem Kolben und übertragen die Zellen in einer Lösung in ein 50 ml Röhrchen. Zählen Sie die Zellen und die Lautstärke anpassen, so dass die Endkonzentration 1,0x10 5 Zellen pro ml. </li><li> Label zwei Gruppen von T25-Kolben: eine Gruppe acht Flaschen, beschriftet 1-8 enthalten und wird u seinsed für die Echtzeit-Stoffwechselmessung Experiment; und die zweite Gruppe enthält auch 8 Kolben und wird für den Hühnerembryo-CAM-Experiment verwendet werden. 2 ml Zellen in Lösung in jeden Kolben und in den Brutschrank (37 ° C, 5% CO 2 O / N). </li><li> Am nächsten Morgen (Tag 0, Zeit 0), Etiketten drei 5-ml-Röhrchen wie folgt: Kontrolle (nicht-Targeting ASO oder siRNA), &quot;Ziel von Interesse&quot; (dh Ziel ASO oder siRNA) und Lipofectamin 2000 (oder eine ähnliche Transfektionsreagenz). Von der Stammlösungen ASO auf die geeignete Konzentration mit serumfreiem Medium in das entsprechende Rohr. <ol><li> Die erforderliche Menge des Transfektionsreagenz an die entsprechende Röhre und Inkubieren in einem serumfreien Medium für 5 min. Fügen Sie das Transfektionsreagenz Lösung für die ASO Rohre und Inkubation für 20 min. </li></ol></li><li> Fügen Sie 250 ul Steuer ASO Transfektionsreagenz Lösung zu jedem der Kolben 1-4 in jeder Gruppe, und 250ul &#39;Ziel von Interesse&#39; ASO Transfektionsreagenz Lösung zu jedem der Kolben 5-8 in jeder Gruppe. Inkubieren für 4 h (37 ᵒC, 5% CO 2). <ol><li> Während der Inkubation, führen Sie die in Abschnitt 2.1 beschriebenen Schritte. Nach der Inkubation werden 3 ml Vollmedium zu jedem Kolben in der CAM Experimentalgruppe und zurück in den Inkubator O / N (37 ᵒC, 5% CO 2). Verarbeiten Sie den Stoffwechsel Experiment Gruppe gemäß der Beschreibung in Abschnitt 2.2. Verarbeiten Sie die CAM Versuchsaufbau gemäß der Beschreibung in Abschnitt 4. </li></ol></li></ol> 2. Biosensorchip Vorbereitung und Zellaussaat <ol><li> In einer sterilen Umgebung, sorgfältig zu waschen sechs Biosensor-Chips mit 400 ul PBS. Sterilisation der Späne mit 400 ul 70% Ethanol für 20 min. Dreimal mit 400 ul PBS waschen. <ol><li> Legen Sie die Chips in sterile Gewebe culture Gerichte, um eine Kontamination zu verhindern. Platzieren Sie drei Chips in einer Schale &quot;Kontrolle&quot; bezeichnet, und drei in einer Schale &quot;Ziel von Interesse&quot; bezeichnet. </li></ol></li><li> Beschriften Sie zwei 50-ml-Röhrchen als &quot;Kontrolle&quot; und &quot;Ziel von Interesse&quot;. Waschen Sie die Zellen mit PBS und füge eine entsprechende Volumen von 0,25% Trypsin / EDTA. Warten Sie, bis die Monolage ablöst und sammeln Sie die Zellen aus jedem Kolben. Zahlen Sie die Lösung in die entsprechenden Röhrchen. <ol><li> Zählen Sie die Zellen und die Lautstärke anpassen, so dass die Endkonzentration 6.0x10 5 Zellen / ml. Zentrifugieren und Resuspendieren der Zellen, wenn der Anfangskonzentration zu niedrig ist. </li></ol></li><li> Nach Eintragen von 250 ul der Zelllösung zu jeder Biosensorchip in der entsprechenden Gruppe (für insgesamt 1.25x10 5 Zellen pro Chip). Erfüllen diese Aufgabe eine Gruppe zu einer Zeit, um die Gefahr der Verwechslung der Chips zu minimieren. Legen Sie die sterile Gerichte, die die Chips in eine feuchte Kammer, um Verdunstung zu vermeiden, und legen Sie die Luftfeuchtigkeit chamber im Inkubator O / N (37 ᵒC, 5% CO 2). </li><li> Am nächsten Morgen (Tag 1), sorgfältig absaugen Medium von jedem Chip und ersetzen sie durch 250 ul Wachstumsmedium mit 0,2% fötalem Rinderserum (FBS) und 1x Penicillin und Streptomycin (P / S) ergänzt. Inkubieren für 4 h (37 ᵒC, 5% CO 2). </li></ol> 3. Stoffwechselmesssystem Vorbereitung und Herstellung der Lösung <ol><li> Während der Inkubation vorbereiten die erforderlichen Medikamentenlösungen und den Stoffwechsel Messsystem für die kommende Test. HINWEIS: Der Stoffwechsel-Messsystem besteht aus insgesamt sechs Modulen. Jedes Modul bietet Platz für ein Chip pro Experiment. <ol><li> Unterteilen Sie den Test in den folgenden Versuchsgruppen: einem Chip von jedem der &quot;Kontrolle&quot; und &quot;Ziel Sehenswürdigkeit Gruppen Fahrzeug für die Dauer des Tests zu empfangen; zwei Chips aus jeder Gruppe auf eine medikamentöse Therapie für eine definierte Zeitdauer, während der ein Empfangsssay, mit einem Fahrzeug folgen während der Auswaschphase. </li><li> Für Drogen Sensibilisierung Studien, ändern Sie die Länge, Timing und Konzentration der medikamentösen Behandlung, die bestimmtes Medikament in Frage zu entsprechen. HINWEIS: Cisplatin, die folgenden Schritte wurden empirisch mit A549-Zellen bestimmt und können variieren je nach Zelllinie. Führen alle Stufen mit der Standardflussrate von 4 &amp; mgr; l / min. 6 h Wachstumsmedium + 0,2% FBS und 1 x P / S 24-Stunden von 6 uM Cisplatin in Medium + 0,2% FBS 1x P / S 24-Stunden-Wachstumsmedium + 0,2% FBS und 1 x P / S 18 Stunden des Wachstums-Medium + 0,2% FBS und 1 x P / S 4 h 0,1% Triton-X HINWEIS: Bei Abweichungen von diesen Schritten wird die Berechnung erfordern, um das erforderliche Volumen des Mediums und Arzneimittellösungen auf der Grundlage der Soll-Strömungsrate und der Dauer des Experiments zu bestimmen. Die folgenden Abschnitte sind auf den oben beschriebenen Schritten basieren. </li></ol></li><li> Label und füllen vierzehn 50-ml-Röhrchen mit 50 ml Wachstumsmedium + 0,2% FBS eind 1x P / S. Sie sechs in einem Metabolismus Meßsystem Röhrchengestell, sechs in dem anderen, und die verbleibenden zwei in einer dritten Rohrgestell, das auch Rohre mit Cisplatin. Dichten Sie die ersten zwei Racks mit einem luftdurchlässigen Membran um Verdunstung zu verhindern. </li><li> Bereiten Sie eine Lösung von 6 uM Cisplatin (der entsprechende Volume) in Medium + 0,2% FBS mit 1x P / S. Verzichten die gewünschte Lautstärke von Cisplatin-Lösung in vier markierten 50-ml-Röhrchen. <ol><li> Die Röhrchen in den verbleibenden vier Nuten der dritten Stoffwechsel Meßrohr Rack. Sicherzustellen, dass die Röhren in die entsprechenden Schlitze, die zu den gewünschten biomodules entsprechen platziert. Verschließen Sie die Röhrchen mit einer luftdurchlässigen Membran. </li></ol></li><li> Bereiten Sie und beschriften sechs 50-ml-Röhrchen und füllen sie mit je 20 ml 0,1% Triton-X-Lösung im Medium. Der Triton-X-Lösung wird alle verbleibenden Zellen zu lysieren und eine &quot;Null&quot; Wert für jeden Chip. Die Röhrchen in einem vierten Stoffwechsel Meßeinheit Rohrgestell und abdichten with ein Luft permable Membran übermäßiger Verdunstung zu verhindern. </li><li> Legen Sie die Chips in die biomodules und leitet das Experiment. </li></ol> 4. CAM Experiment Drug Treatment und Einspritzung HINWEIS: Die Schritte und Verfahren zur Herstellung der Hühnerembryonen für ein CAM-Experiment werden an anderer Stelle 19 beschrieben <ol><li> Beginnen Sie die Bearbeitung des CAM Experiment 48 Stunden nach der Transfektion (Tag 2). Unterteilen die &quot;Kontrolle&quot; und &quot;Ziel von Interesse Gruppen in zwei Flaschen für Fahrzeug und zwei für Cisplatin. Absaugen Medium aus den Kolben und füllt mit entweder 3 ml frisches Medium oder 6 uM Cisplatin. Inkubieren für 6 h (37 ᵒC, 5% CO 2). </li><li> Saugen Sie das Medium, dann waschen und trypsinieren der Zellen; sammeln die Zellen mit Trypsin in Lösung in vier entsprechend gekennzeichnete 15-ml-Röhrchen. <ol><li> Zentrifuge und waschen Sie die Zellen dreimal mit PBS. Re-suspendieren des Zellpellets in 5 ml PBS einemd die Zellen zu zählen. </li><li> Stellen Sie die Lautstärke so dass die endgültige Zellkonzentration ist 1,0x10 6 Zellen / ml. Übertragen Sie die Zell-Lösung in beschriftete 5-ml-Röhrchen zur Injektion, und legen Sie auf dem Eis. Der Injektion invertieren die Röhren vorsichtig vor, um sicherzustellen, dass die Zellen gut vermischt. </li></ol></li><li> Beiseite insgesamt 24 Hühnerembryonen (9 Tage alt) für die Injektion (6 pro Gruppe). Führen die Injektion unter Verwendung einer Glasnadel, um einen Schlauch mit einer 1 ml Spritze verbunden angebracht. Die individuelle Durchführung der Injektion sollte der Behandlungsgruppe blenden lassen. <ol><li> Mit einem Stereomikroskop zu injizieren 1,0x10 5 Zellen in einem Volumen von 100 ul in die venöse Zirkulation des CAM. Verwenden Sie eine lange, pulsierende Technik, um das volle Volumen von Zellen injizieren. Vorsichtig abtupfen die Injektionsstelle mit einem weichen abzuwischen, um den Blutfluss einzudämmen und zu absorbieren eventuelle Spritzer. Beschriften Sie jedes Embryo Behälter entsprechend nach jeder Injektion. </li></ol></li><li> Bestätigen Sie die Präsenz und Verteiteilung von fluoreszierenden Zellen in das Gefäßsystem des CAM nach der Injektion durch die Visualisierung sie mit einem Fluoreszenzmikroskop. Beachten Sie bitte die Embryonen, bei denen die Zahl der Tumorzellen scheint gering, oder die Verteilung ist schlecht. </li><li> Legen Sie die Hühnerembryonen in einer feuchten Kammer und speichern sie in einem Inkubator (37 ° C, Luftfeuchtigkeit 60%). Warten Sie 7-9 Tage vor der Aufzählung Metastasenherde. </li></ol> 5. metastasiertem Fokus Enumeration <ol><li> Während der 7-9 Tage Inkubationszeit überwachen die Embryonen und entsorgen Sie alle Toten. Sicherzustellen, dass der Feuchtigkeitskammer feucht bleibt zu allen Zeiten während der Inkubationszeit. </li><li> Verwendung eines Fluoreszenz-Stereomikroskop bei 20-facher Vergrößerung, scannen die gesamte Oberseite des Embryos CAM in einem regelmäßigen, gitterartiges Muster. </li><li> Die Anzahl der Metastasenherde in jedem Blickfeld, dann überein die Anzahl für eine abschließende Gesamt pro Embryo. Dies für die sechs Embryonen in jeder Gruppe eine durchschnittliche Zahl o liefernf metastatischen Foci pro Behandlung. </li></ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

Die Autoren haben nichts zu offenbaren.

Aufgrund der inhärenten Kosten und Risiken im Zusammenhang mit klinischen Studien, es notwendig ist, bessere und strengere präklinischen Testverfahren, um neue Anti-Krebs-Behandlung nicht ausreichend adäquat bewerten zu entwickeln. Strom häufigsten verwendeten Techniken alle Schwächen aufweisen, die ihre Fähigkeit, zwischen potentiell vielversprechende therapeutische Ziele / Agenten diskriminieren begrenzen kann, und jene, die weniger wirksam sein kann. Wir entwickelten ein Protokoll, um neue anti-Krebs Ansätze, ...

Erworbener Resistenz gegen gezielte und / oder zytotoxischen Krebsbehandlung ist ein wichtiges klinisches Problem, die zum Therapieversagen, Rückfall führen kann, und eine erhöhte Patientensterblichkeit 1. Angesichts der hohen Heterogenität in den meisten Tumoren, es ist eine mathematische Gewissheit, dass ein Tumor ausreichend hohe Zellzahl wird eine Untergruppe von Zellen resistent gegen einzelne oder kombinierte Therapien, die molekularen Wege, auf denen diese Zellen hängen zum Überleben 2,3 enthalten. Solche Tumorzellen können für den während der Behandlung ausgewählt werden, was zu einem Rezidiv. Entwicklung neuer Therapien, die gleichzeitig unterschiedliche Zielkrebszellüberlebensmechanismen, entweder vor oder nach der Behandlung vermittelte Selektion ist deshalb klinisch wichtig. Ein hohes Maß an Genominstabilität und Mutation in Tumor Genome ist eine grundlegende Eigenschaft, die Krebszellen aus Nicht-Tumorwirtszellen 4 unterscheidet. Folglich wird ein useful-Strategie, um die Wirksamkeit von DNA-schädigenden Chemotherapie zu erhöhen und die Entwicklung einer Resistenz zu verhindern ist, DNA-Reparatur hemmen aktiv in Tumorzellen 5. Dies ist ein aktives Forschungsgebiet und eine Vielzahl von neuen DNA-Reparatur-Ziele werden in einem präklinischen Einstellung erforscht. Eine Anzahl von kleinen Molekülen oder Antisense-basierte Inhibitoren dieser Ziele entwickelt und werden in der Erprobung 6-8. Das Ziel ist es, die vielversprechendsten präklinischen Kandidaten in klinischen Studien zu erkennen und bewerten ihre Sicherheit und Wirksamkeit. Die hohen Kosten der klinischen Versuche und die Gefahr einer Störung (für eine Vielzahl von Gründen, einschließlich suboptimaler präklinische Bewertung) sind gewaltige Hindernisse in die Entwicklung von neuen Therapien 9 voran. Die Verwendung geeigneter und strengen präklinischen Modellen angemessen neue therapeutische Targets und Wirkstoffkandidaten beurteilen kann die hohe Ausfallrate von 10 klinischen Studien zu verringern </sup&gt;. A) Messung der Fähigkeit, die Tumorzellproliferation in vitro (Zellproliferationsassays), b) Therapie-induzierte Verringerung der Kapazität von Tumorzellen zu verringern: Einige häufig verwendete vorklinischen Verfahren, die Wirksamkeit von neuen Antikrebs-Therapien sind, beurteilen Form Gewebekulturkolonien (kolonieBildungsTests), c) Therapie-induzierte Verringerung des Tumorzellstoffwechselaktivität in vitro (Redoxfarbstoff Umwandlung), d) Therapie-induzierte Induktion in vitro Tumorzelltodes (Apoptose, Nekrose, phage, zugeordnet mit der Mitose und weitere) 11, und e) in vivo-Therapie-induzierte Reduktion des Wachstums oder der Ablation von menschlichen und Maus-Xenotransplantaten 12-14. Eine Hauptschwäche der angeführten in vitro Verfahren ist, dass keine von ihnen eine kontinuierliche Echtzeit-Auswertung der Wirkung der Kandidatentherapie. Vielmehr nur an ausgewählten, weit auseinanderZeitPunkten liefern sie Informationenwährend des Verlaufs der Behandlung. Solche Messungen haben Kapazitäten, um die Größe und den Zeitpunkt des Tumorzellantworten genau widerspiegeln vermindert. In vivo-Maus-Xenograft-Modelle werden auch durch hohe Kosten, Zeitdauer in Anspruch, und das Risiko von suboptimalen Dosierungen und Verabreichungszeitpunkt (Scheduling) begrenzt. Darüber hinaus gibt es Hinweise, dass Nager Xenotransplantatmodellen begrenzt Prädiktoren für die klinische Wirksamkeit in Menschen im Vergleich zu in-vitro-Bewertung der Reaktionen von primären humanen Tumorzellen und etablierten menschlichen Tumorzellinien Kandidaten therapeutische Interventionen 15,16. Wir entwickelten eine neuartige Kombinationsprotokoll neue Arzneimittelkombinationen vorklinisch auszuwerten, in einer Weise, die die Schwächen der oben genannten üblichere Verfahren adressiert. An die Stelle der Proliferation, Koloniebildung oder Redoxfarbstoff Umwandlung Tests verwendeten wir einen Stoffwechsel Maßeinheit Zelladhäsion, Atmung und die Versauerung in Echtzeit zu analysierenwährend des gesamten Behandlungszeitraums 17. Gleichzeitig untersuchten wir die Auswirkungen der Behandlung Kombination in vivo durch die Verwendung eines Hühnerembryo Chorioallantoismembran (CAM) Modell der Invasion und Metastasierung von 18,19. Wir verwendeten diese Methoden, um die Fähigkeit eines Antisense-Oligonukleotid (ASO) Targeting BRCA2, um die Wirksamkeit der üblicherweise verwendeten chemotherapeutischen Arzneimittel Cisplatin potenzieren bewerten.

<table><tbody><tr><td>A549 cells</td><td>ATCC</td><td>CCL-185</td><td>http://www.atcc.org/products/all/CCL-185.aspx</td></tr><tr><td>AeraSeal film</td><td>Carl Roth GmbH</td><td></td><td></td></tr><tr><td>AMEM</td><td>Wisent Bioproducts</td><td>210-011-QK</td><td></td></tr><tr><td>Antisense oligodeoxynucleotides</td><td>Avecia</td><td></td><td>BRCA2 target sequence: 5&#039; - UAAGGAACGUCAAGAGAUAC - 3&#039; (bases 7241-7259 )</td></tr><tr><td>Axio Zoom V16 Microscope</td><td>Carl Zeiss</td><td></td><td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td></tr><tr><td>Bionas Biosensor Chips</td><td>Bionas GmbH and Micronas GmbH</td><td>BIS8001D</td><td></td></tr><tr><td>Bionas Discovery 2500 System&amp;nbsp;</td><td>Bionas GmbH</td><td></td><td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td></tr><tr><td>Cisplatin</td><td>Sigma Aldrich</td><td>479306</td><td></td></tr><tr><td>Fertilized chicken eggs</td><td>Sourced locally</td><td></td><td></td></tr><tr><td>Fetal bovine serum&amp;nbsp;</td><td>Gibco - Life Technologies</td><td></td><td></td></tr><tr><td>Lipofectamine 2000&amp;nbsp;</td><td>Invitrogen - Life Technologies&amp;nbsp;</td><td>12566014</td><td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td></tr><tr><td>PBS</td><td>Wisent Bioproducts</td><td>311-010-CL</td><td></td></tr><tr><td>Trypsin (0.25%)/EDTA</td><td>Wisent Bioproducts</td><td>325-043-CL</td><td></td></tr></tbody></table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

Aufgrund der hohen Heterogenität und Mutationen in der menschlichen Krebsarten, einzelnes Mittel Therapien oder Kombinationstherapien, die den gleichen Weg zielen, sind wahrscheinlich versagen. Der Nachdruck auf die Hemmung der Pfade bei der intrinsischen und / oder adaptive Therapieresistenz verantwortlich sind, platziert werden. Ein aktives Forschungsgebiet ist die Entwicklung und Erprobung von DNA-Reparatur-Inhibitoren, die die Wirkung von zu fördern und zu verhindern, Widerstand gegen, häufig verwendete Chemotherapie und Strahlentherapie. Wir verwendeten eine neue Methode, um die Wirksamkeit der BRCA2 Hemmung als Mittel zur Tumorzellen mit der DNA-schädigenden Medikament Cisplatin sensibilisieren bewerten. Tumorzellstoffwechsel (Versauerung und Atmung) wurde in Echtzeit über einen Zeitraum von 72 Stunden, um die Wirksamkeit der Behandlung auf einem von Minute zu Minute Grundlage abzugrenzen überwacht. In Kombination, eine Bewertung der metastatischen Frequenz führten wir mit einem Hühnerembryo Chorioallantoismembran (CAM) Modell der Extravasation und Invasion. DieseProtokoll behandelt einige Schwächen üblicherweise in vitro und in vivo-Verfahren verwendet werden, um neue Krebstherapieschemata zu bewerten. Es kann neben üblichen Methoden wie Zellproliferationsassays, Zelltod Assays verwendet werden, und in vivo murine Xenograft Studien genauer unter in Frage kommenden Zielen und Mitteln unterscheiden und wählt nur die aussichtsreichsten Kandidaten für eine weitere Entwicklung.

Ergebnisse und Zahlen mit Genehmigung aus veröffentlichten Arbeiten 22 angepasst. BRCA2 Hemmung induziert eine Abnahme der Atmung in Cisplatin behandelten Tumorzellen Menschen A549 Lungenkrebszellen mit BRCA2-Targeting ASO und Cisplatin zeigte eine frühe und irreversible Abnahme der Atmung, im Vergleich zu Zellen, die Steuer ASO und Cisplatin allein erhielt behandelt; nach 24 h Behandlung mit Cisplatin die Differenz in der Atmung zwischen BR...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

Bewertung der Wirksamkeit der Krebsmedikament Sensibilisierung<em&gt; In-vitro-</em&gt; Und<em&gt; In-vivo-</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

8.3K Aufrufe.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

Serie: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Establishing Dual Resistance to EGFR-TKI and MET-TKI in Lung Adenocarcinoma Cells In Vitro with a 2-step Dose-escalation Procedure

Drug resistance is a major challenge in cancer therapy. The generation of resistant sublines in vitro is necessary for discovering novel mechanisms to overcome this challenge. Here, a 2-step dose-escalation method for establishing dual-resistance to an epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitor (TKI), gefitinib, and a MET-TKI, PHA665752, is described. This method is based on simple stepwise dose-escalation of inhibitors for inducing acquired resistance in cell lines. The alternate method for generating resistant sublines involves exposing the cells to high concentrations of the inhibitor in one step. The stepwise dose-escalation method has a higher possibility of successfully inducing acquired resistance than this method. Activating EGFR mutations are biomarkers of a response to treatment with EGFR-TKI, which is an applied first-line treatment for non-small cell lung cancers (NSCLC) that harbor these mutations. However, despite reports of effective responses, the use of EGFR-TKI is limited because tumors inevitably acquire resistance. The major mechanisms behind EGFR-TKI resistance include a secondary mutation at the gatekeeper site, T790M in exon 20 of EGFR, and a bypass signal of MET. Thus, a potential solution for this issue would be a combination of EGFR-TKI and MET-TKI. This combined treatment has been shown to be effective in an in vitro study model. Acquired gefitinib-resistance was established through MET-amplification by stepwise dose-escalation of gefitinib for 12 months, and a cell line named PC-9MET1000 was generated in a previous study. To further investigate the mechanisms of acquired MET-TKI and EGFR-TKI resistance, a MET-TKI, PHA665752, was administered to these cells with stepwise dose-escalation in the presence of gefitinib for 12 months. This protocol has also been successfully applied for a number of combination therapies to establish acquired resistance to other inhibitor molecules.

Establishing Dual Resistance to EGFR-TKI and MET-TKI in Lung Adenocarcinoma Cells In Vitro with a 2-step Dose-escalation Procedure

An in vitro method for establishing dual resistance to an EGFR-TKI and a MET-TKI in cancer cells is described. This method is useful for developing treatments for patients with EGFR-mutations, who exhibit disease progression despite EGFR-TKI treatment with MET-amplification. It can also be modified for inhibitors targeting other molecules.

Doppelte Resistenz gegen EGFR-TKI und traf TKI etablieren in Lunge Adenokarzinom Zellen In Vitro mit einem 2-stufigen Dosiseskalation Verfahren

Drug resistance is a major challenge in cancer therapy. The generation of resistant sublines in vitro is necessary for discovering novel mechanisms to ...

Forschung

Krebsforschung

Preclinical Assessment of the Bioactivity of the Anticancer Coumarin OT48 by Spheroids, Colony Formation Assays, and Zebrafish Xenografts

In vitro and in vivo pre-clinical screening of novel therapeutic agents are an essential tool in cancer drug discovery. Although human cancer cell lines respond to therapeutic compounds in 2D (dimensional) monolayer cell cultures, 3D culture systems were developed to understand the efficacy of drugs in more physiologically relevant models. In recent years, a paradigm shift was observed in pre-clinical research to validate the potency of new molecules in 3D culture systems, more precisely mimicking the tumor microenvironment. These systems characterize the disease state in a more physiologically relevant manner and help to gain better mechanistic insight and understanding of the pharmacological potency of a given molecule. Moreover, with the current trend in improving in vivo cancer models, zebrafish has emerged as an important vertebrate model to assess in vivo tumor formation and study the effect of therapeutic agents. Here, we investigated the therapeutic efficacy of hydroxycoumarin OT48 alone or in combination with BH3 mimetics in lung cancer cell line A549 by using three different 3D culture systems including colony formation assays (CFA), spheroid formation assay (SFA) and in vivo zebrafish xenografts.

Here, we present the preclinical screening of anticancer coumarins using 3D culture and zebrafish.

Präklinische Bewertung der Bioaktivität der Anti-Krebs Cumarin OT48 Sphäroide, Kolonie Bildung Assays und Zebrafisch Xenotransplantate

In vitro and in vivo pre-clinical screening of novel therapeutic agents are an essential tool in cancer drug discovery. Although human cancer cell lines ...

Potentiation of Anticancer Antibody Efficacy by Antineoplastic Drugs: Detection of Antibody-drug Synergism Using the Combination Index Equation

Potentiation of hostile monoclonal antibodies (mAb) by chemotherapeutic agents constitutes a valuable strategy for designing effective and safer therapy against cancer. Here we provide a protocol to identify a rational combination at the preclinical step. First, we describe a cell-based assay to assess the synergism between anticancer mAb and cytotoxic drugs, that uses the combination index equation of Chou and Talalay1. This includes the measurement of tumor cell drug- and antibody-sensitivity using an MTT assay, followed by an automated computer analysis to calculate the combination index (CI) values. CI values of &lt;1 indicate synergism between tested mAbs and cytotoxic agents1. To corroborate the in vitro findings in vivo, we further describe a method to assess the combination regimen efficacy in a xenograft tumor model. In this model, the combined regimen significantly delays tumor growth, which results in a significant extended survival in comparison to single-agent controls. Importantly, the in vivo experimentation reveals that the combination regimen is well tolerated. This protocol allows the effective evaluation of anticancer drug combinations in preclinical models and the identification of rational combination to evaluate in clinical trials.

This protocol describes how to assess synergism between an anticancer antibody and antineoplastic drugs in preclinical models by using the combination index equation of Chou and Talalay.

Potenzierung der Anti-Krebs-Antikörper-Wirksamkeit von Zytostatika: Nachweis von Antikörper-Wirkstoff-Synergismus mit der Kombination-Index-Gleichung

Potentiation of hostile monoclonal antibodies (mAb) by chemotherapeutic agents constitutes a valuable strategy for designing effective and safer therapy ...

In Vitro Tumor Cell Rechallenge For Predictive Evaluation of Chimeric Antigen Receptor T Cell Antitumor Function

The field of chimeric antigen receptor (CAR) T cell therapy is rapidly advancing with improvements in CAR design, gene-engineering approaches and manufacturing optimizations. One challenge for these development efforts, however, has been the establishment of in vitro assays that can robustly inform selection of the optimal CAR T cell products for in vivo therapeutic success. Standard in vitro tumor-lysis assays often fail to reflect the true antitumor potential of the CAR T cells due to the relatively short co-culture time and high T cell to tumor ratio. Here, we describe an in vitro co-culture method to evaluate CAR T cell recursive killing potential at high tumor cell loads. In this assay, long-term cytotoxic function and proliferative capacity of CAR T cells is examined in vitro over 7 days with additional tumor targets administered to the co-culture every other day. This assay can be coupled with profiling T cell activation, exhaustion and memory phenotypes. Using this assay, we have successfully distinguished the functional and phenotypic differences between CD4+ and CD8+ CAR T cells against glioblastoma (GBM) cells, reflecting their differential in vivo antitumor activity in orthotopic xenograft models. This method provides a facile approach to assess CAR T cell potency and to elucidate the functional variations across different CAR T cell products.

Here, we describe an in vitro co-culture method to recursively challenge tumor-targeted T cells, which allows for phenotypic and functional analysis of antitumor T cell activity.

In Vitro Tumor Zelle Rechallenge für vorausschauende Bewertung der Chimeric Antigen-Rezeptor-T-Zell-Antitumor-Funktion

The field of chimeric antigen receptor (CAR) T cell therapy is rapidly advancing with improvements in CAR design, gene-engineering approaches and ...

Monitoring Cancer Cell Invasion and T-Cell Cytotoxicity in 3D Culture

Significant progress has been made in treating cancer with immunotherapy, although a large number of cancers remain resistant to treatment. A limited number of assays allow for direct monitoring and mechanistic insights into the interactions between tumor and immune cells, amongst which, T-cells play a significant role in executing the cytotoxic response of the adaptive immune system to cancer cells. Most assays are based on two-dimensional (2D) co-culture of cells due to the relative ease of use but with limited representation of the invasive growth phenotype, one of the hallmarks of cancer cells. Current three-dimensional (3D) co-culture systems either require special equipment or separate monitoring for invasion of co-cultured cancer cells and interacting T-cells.
Here we describe an approach to simultaneously monitor the invasive behavior in 3D of cancer cell spheroids and T-cell cytotoxicity in co-culture. Spheroid formation is driven by enhanced cell-cell interactions in scaffold-free agarose microwell casts with U-shaped bottoms. Both T-cell co-culture and cancer cell invasion into type I collagen matrix are performed within the microwells of the agarose casts without the need to transfer the cells, thus maintaining an intact 3D co-culture system throughout the assay. The collagen matrix can be separated from the agarose cast, allowing for immunofluorescence (IF) staining and for confocal imaging of cells. Also, cells can be isolated for further growth or subjected to analyses such as for gene expression or fluorescence activated cell sorting (FACS). Finally, the 3D co-culture can be analyzed by immunohistochemistry (IHC) after embedding and sectioning. Possible modifications of the assay include altered compositions of the extracellular matrix (ECM) as well as the inclusion of different stromal or immune cells with the cancer cells.

The presented approach simultaneously evaluates cancer cell invasion in 3D spheroid assays and T-cell cytotoxicity. Spheroids are generated in a scaffold-free agarose multi-microwell cast. Co-culture and embedding in type I collagen matrix are performed within the same device which allows to monitor cancer cell invasion and T-cell mediated cytotoxicity.

Überwachung der Krebszellinvasion und T-Zell-Zytotoxizität in der 3D-Kultur

Significant progress has been made in treating cancer with immunotherapy, although a large number of cancers remain resistant to treatment. A limited ...

Profiling Sensitivity to Targeted Therapies in EGFR-Mutant NSCLC Patient-Derived Organoids

Novel 3D cancer organoid cultures derived from clinical patient specimens represent an important model system to evaluate intratumor heterogeneity and treatment response to targeted inhibitors in cancer. Pioneering work in gastrointestinal and pancreatic cancers has highlighted the promise of patient-derived organoids (PDOs) as a patient-proximate culture system, with an increasing number of models emerging. Similarly, work in other cancer types has focused on establishing organoid models and optimizing culture protocols. Notably, 3D cancer organoid models maintain the genetic complexity of original tumor specimens and thus translate tumor-derived sequencing data into treatment with genetically informed targeted therapies in an experimental setting. Further, PDOs might foster the evaluation of rational combination treatments to overcome resistance-associated adaptation of tumors in the future. The latter focuses on intense research efforts in non-small-cell lung cancer (NSCLC), as resistance development ultimately limits the treatment success of targeted inhibitors. An early assessment of therapeutically targetable mechanisms using NSCLC PDOs could help inform rational combination treatments. This manuscript describes a standardized protocol for the cell culture plate-based assessment of drug sensitivities to targeted inhibitors in NSCLC-derived 3D PDOs, with potential adaptability to combinational treatments and other treatment modalities.

This protocol describes a standardized evaluation of drug sensitivities to targeted signaling inhibitors in NSCLC patient-derived organoid models.

Profiling der Sensitivität gegenüber zielgerichteten Therapien in EGFR-mutierten NSCLC-patientenabgeleiteten Organoiden

Novel 3D cancer organoid cultures derived from clinical patient specimens represent an important model system to evaluate intratumor heterogeneity and ...

A Combined 3D Tissue Engineered In Vitro/In Silico Lung Tumor Model for Predicting Drug Effectiveness in Specific Mutational Backgrounds

In the present study, we combined an in vitro 3D lung tumor model with an in silico model to optimize predictions of drug response based on a specific mutational background. The model is generated on a decellularized porcine scaffold that reproduces tissue-specific characteristics regarding extracellular matrix composition and architecture including the basement membrane. We standardized a protocol that allows artificial tumor tissue generation within 14 days including three days of drug treatment. Our article provides several detailed descriptions of 3D read-out screening techniques like the determination of the proliferation index Ki67 staining&#39;s, apoptosis from supernatants by M30-ELISA and assessment of epithelial to mesenchymal transition (EMT), which are helpful tools for evaluating the effectiveness of therapeutic compounds. We could show compared to 2D culture a reduction of proliferation in our 3D tumor model that is related to the clinical situation. Despite of this lower proliferation, the model predicted EGFR-targeted drug responses correctly according to the biomarker status as shown by comparison of the lung carcinoma cell lines HCC827 (EGFR -mutated, KRAS wild-type) and A549 (EGFR wild-type, KRAS-mutated) treated with the tyrosine-kinase inhibitor (TKI) gefitinib. To investigate drug responses of more advanced tumor cells, we induced EMT by long-term treatment with TGF-beta-1 as assessed by vimentin/pan-cytokeratin immunofluorescence staining. A flow-bioreactor was employed to adjust culture to physiological conditions, which improved tissue generation. Furthermore, we show the integration of drug responses upon gefitinib treatment or TGF-beta-1 stimulation - apoptosis, proliferation index and EMT - into a Boolean in silico model. Additionally, we explain how drug responses of tumor cells with a specific mutational background and counterstrategies against resistance can be predicted. We are confident that our 3D in vitro approach especially with its in silico expansion provides an additional value for preclinical drug testing in more realistic conditions than in 2D cell culture.

A Combined 3D Tissue Engineered In Vitro/In Silico Lung Tumor Model for Predicting Drug Effectiveness in Specific Mutational Backgrounds

We present a three-dimensional (3D) lung cancer model based on a biological collagen scaffold to study sensitivity towards non-small-cell-lung-cancer-(NSCLC)-targeted therapies. We demonstrate different read-out techniques to determine the proliferation index, apoptosis and epithelial-mesenchymal transition (EMT) status. Collected data are integrated into an in silico model for prediction of drug sensitivity.

Ein kombiniertes 3D-Gewebezüchtungen<em&gt; In Vitro</em&gt; /<em&gt; In Silico</em&gt; Lungentumormodell für Hintergründe in bestimmten Mutations Drug Wirksamkeit vorhersagen

In the present study, we combined an in vitro 3D lung tumor model with an in silico model to optimize predictions of drug response based on a specific ...

Biotechnik

In Vitro and In Vivo Evaluation of Photocontrolled Biologically Active Compounds - Potential Drug Candidates for Cancer Photopharmacology

Photocontrolled, biologically active compounds are an emerging class of &#34;smart&#34; drug candidates. They provide additional safety in systemic chemotherapy due to their precise spatiotemporal activation by directing a benign, non-ionizable light to a specific location within the patient&#39;s body. This paper presents a set of methods to evaluate the in vitro potency and ex vivo efficiency of the photoactivation of photocontrolled, biologically active compounds as well as the in vivo efficacy at early stages of drug development. The methodology is applied to anticancer cytotoxic peptides, namely, the diarylethene-containing analogs of a known antibiotic, gramicidin S. The experiments are performed using 2D (adherent cells) and 3D (spheroids) cell cultures of a cancer cell line (Lewis lung carcinoma, LLC), live tissue surrogates (pork meat mince), and an allograft cancer model (subcutaneous LLC) in immunocompetent mice. The selection of the most effective compounds and estimation of realistic phototherapeutic windows are performed via automated fluorescence microscopy. The photoactivation efficiency at varying illumination regimens is determined at different depths in a model tissue, and the optimal light dosage is applied in the final therapeutic in vivo experiment.

In Vitro and In Vivo Evaluation of Photocontrolled Biologically Active Compounds - Potential Drug Candidates for Cancer Photopharmacology

This protocol presents a set of experiments adopted for the evaluation of photoswitchable anticancer peptides, that can be used in the preclinical screening of such compounds. This includes cytotoxicity assessment in 2D and 3D cell cultures, the evaluation of ex vivo (model tissue) photoisomerization efficiency, and in vivo efficacy.

In-vitro - und In-vivo-Evaluierung photokontrollierter biologisch aktiver Substanzen - potenzielle Wirkstoffkandidaten für die Krebspharmakologie

Photocontrolled, biologically active compounds are an emerging class of &#34;smart&#34; drug candidates. They provide additional safety in systemic ...

Chemie

An Organotypic High Throughput System for Characterization of Drug Sensitivity of Primary Multiple Myeloma Cells

In this work we describe a novel approach that combines ex vivo drug sensitivity assays and digital image analysis to estimate chemosensitivity and heterogeneity of patient-derived multiple myeloma (MM) cells. This approach consists in seeding primary MM cells freshly extracted from bone marrow aspirates into microfluidic chambers implemented in multi-well plates, each consisting of a reconstruction of the bone marrow microenvironment, including extracellular matrix (collagen or basement membrane matrix) and stroma (patient-derived mesenchymal stem cells) or human-derived endothelial cells (HUVECs). The chambers are drugged with different agents and concentrations, and are imaged sequentially for 96 hr through bright field microscopy, in a motorized microscope equipped with a digital camera. Digital image analysis software detects live and dead cells from presence or absence of membrane motion, and generates curves of change in viability as a function of drug concentration and exposure time. We use a computational model to determine the parameters of chemosensitivity of the tumor population to each drug, as well as the number of sub-populations present as a measure of tumor heterogeneity. These patient-tailored models can then be used to simulate therapeutic regimens and estimate clinical response.

We describe a high-throughput drug sensitivity assay for primary multiple myeloma cells. It consists of a reconstruction of the bone marrow microenvironment (including extracellular matrix and stroma) in multi-well plates, and a non-invasive method for longitudinal quantification of cell viability.

Ein organ High Throughput-System zur Charakterisierung von Arzneimittelempfindlichkeit von Primary Multiple Myelomzellen

In this work we describe a novel approach that combines ex vivo drug sensitivity assays and digital image analysis to estimate chemosensitivity and ...

Medizin

Assessing Specificity of Anticancer Drugs In Vitro

A procedure for assessing specificity of anticancer drugs in vitro using cultures containing both tumor and non-tumor cells is demonstrated. The key element is the quantitative determination of a tumor-specific genetic alteration in relation to a universal sequence using a dual-probe digital PCR assay and the subsequent calculation of the proportion of tumor cells. The assay is carried out on a culture containing tumor cells of an established line and spiked-in non-tumor cells. The mixed culture is treated with a test drug at various concentrations. After the treatment, DNA is prepared directly from the survived adhesive cells in wells of 96-well plates using a simple and inexpensive method, and subjected to a dual-probe digital PCR assay for measuring a tumor-specific genetic alteration and a reference universal sequence. In the present demonstration, a heterozygous deletion of the NF1 gene is used as the tumor-specific genetic alteration and a RPP30 gene as the reference gene. Using the ratio NF1/RPP30, the proportion of tumor cells was calculated. Since the dose-dependent change of the proportion of tumor cells provides an in vitro indication for specificity of the drug, this genetic and cell-based in vitro assay will likely have application potential in drug discovery. Furthermore, for personalized cancer-care, this genetic- and cell-based tool may contribute to optimizing adjuvant chemotherapy by means of testing efficacy and specificity of candidate drugs using primary cultures of individual tumors.

Assessing Specificity of Anticancer Drugs In Vitro

The goal of this protocol is to assess specificity of anticancer drugs in vitro using mixed cultures containing both tumor and non-tumor cells.

Die Beurteilung Spezifität von Anti-Krebs-Medikamente<em&gt; In Vitro</em

A procedure for assessing specificity of anticancer drugs in vitro using cultures containing both tumor and non-tumor cells is demonstrated. The key ...

Bewertung der Wirksamkeit der Krebsmedikament Sensibilisierung

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video