Diese Arbeit durch Zuschüsse zu JK aus den Ontario Centres of Excellence und dem Ontario Research Fund ermöglicht. Wir möchten Siddika Pardhan und Dr. Peter Ferguson, um technische Unterstützung während der Dreharbeiten zu danken.

HINWEIS: Das folgende Protokoll wurde für den Einsatz mit anhaftenden Zellen ausgelegt. Modifikationen sind erforderlich, um das Verfahren zur nicht-adhärenten Zellen in Suspension gezüchtet anzuwenden. Die in dem Protokoll beschrieben CAM Experimente sind zur Verwendung mit Zellen, die einen fluoreszierenden Marker (zB GFP, RFP etc.) zu exprimieren gestaltet. Neun Tage alten Hühnerembryonen werden am Tag 2 des Versuchsprotokoll für die CAM-Experimente erforderlich. 1. Vorbereitung und Transfektion von Tumorzellen mit Antisense-Oligonukleotide (ASOs) <ol><li> Absaugen Medium aus T75-Flasche (n), die Zellen von Interesse, Wäsche mit 1 × PBS und 2 ml 0,25% Trypsin / EDTA. 10 ml vollständigem Wachstumsmedium zu jedem Kolben und übertragen die Zellen in einer Lösung in ein 50 ml Röhrchen. Zählen Sie die Zellen und die Lautstärke anpassen, so dass die Endkonzentration 1,0x10 5 Zellen pro ml. </li><li> Label zwei Gruppen von T25-Kolben: eine Gruppe acht Flaschen, beschriftet 1-8 enthalten und wird u seinsed für die Echtzeit-Stoffwechselmessung Experiment; und die zweite Gruppe enthält auch 8 Kolben und wird für den Hühnerembryo-CAM-Experiment verwendet werden. 2 ml Zellen in Lösung in jeden Kolben und in den Brutschrank (37 ° C, 5% CO 2 O / N). </li><li> Am nächsten Morgen (Tag 0, Zeit 0), Etiketten drei 5-ml-Röhrchen wie folgt: Kontrolle (nicht-Targeting ASO oder siRNA), &quot;Ziel von Interesse&quot; (dh Ziel ASO oder siRNA) und Lipofectamin 2000 (oder eine ähnliche Transfektionsreagenz). Von der Stammlösungen ASO auf die geeignete Konzentration mit serumfreiem Medium in das entsprechende Rohr. <ol><li> Die erforderliche Menge des Transfektionsreagenz an die entsprechende Röhre und Inkubieren in einem serumfreien Medium für 5 min. Fügen Sie das Transfektionsreagenz Lösung für die ASO Rohre und Inkubation für 20 min. </li></ol></li><li> Fügen Sie 250 ul Steuer ASO Transfektionsreagenz Lösung zu jedem der Kolben 1-4 in jeder Gruppe, und 250ul &#39;Ziel von Interesse&#39; ASO Transfektionsreagenz Lösung zu jedem der Kolben 5-8 in jeder Gruppe. Inkubieren für 4 h (37 ᵒC, 5% CO 2). <ol><li> Während der Inkubation, führen Sie die in Abschnitt 2.1 beschriebenen Schritte. Nach der Inkubation werden 3 ml Vollmedium zu jedem Kolben in der CAM Experimentalgruppe und zurück in den Inkubator O / N (37 ᵒC, 5% CO 2). Verarbeiten Sie den Stoffwechsel Experiment Gruppe gemäß der Beschreibung in Abschnitt 2.2. Verarbeiten Sie die CAM Versuchsaufbau gemäß der Beschreibung in Abschnitt 4. </li></ol></li></ol> 2. Biosensorchip Vorbereitung und Zellaussaat <ol><li> In einer sterilen Umgebung, sorgfältig zu waschen sechs Biosensor-Chips mit 400 ul PBS. Sterilisation der Späne mit 400 ul 70% Ethanol für 20 min. Dreimal mit 400 ul PBS waschen. <ol><li> Legen Sie die Chips in sterile Gewebe culture Gerichte, um eine Kontamination zu verhindern. Platzieren Sie drei Chips in einer Schale &quot;Kontrolle&quot; bezeichnet, und drei in einer Schale &quot;Ziel von Interesse&quot; bezeichnet. </li></ol></li><li> Beschriften Sie zwei 50-ml-Röhrchen als &quot;Kontrolle&quot; und &quot;Ziel von Interesse&quot;. Waschen Sie die Zellen mit PBS und füge eine entsprechende Volumen von 0,25% Trypsin / EDTA. Warten Sie, bis die Monolage ablöst und sammeln Sie die Zellen aus jedem Kolben. Zahlen Sie die Lösung in die entsprechenden Röhrchen. <ol><li> Zählen Sie die Zellen und die Lautstärke anpassen, so dass die Endkonzentration 6.0x10 5 Zellen / ml. Zentrifugieren und Resuspendieren der Zellen, wenn der Anfangskonzentration zu niedrig ist. </li></ol></li><li> Nach Eintragen von 250 ul der Zelllösung zu jeder Biosensorchip in der entsprechenden Gruppe (für insgesamt 1.25x10 5 Zellen pro Chip). Erfüllen diese Aufgabe eine Gruppe zu einer Zeit, um die Gefahr der Verwechslung der Chips zu minimieren. Legen Sie die sterile Gerichte, die die Chips in eine feuchte Kammer, um Verdunstung zu vermeiden, und legen Sie die Luftfeuchtigkeit chamber im Inkubator O / N (37 ᵒC, 5% CO 2). </li><li> Am nächsten Morgen (Tag 1), sorgfältig absaugen Medium von jedem Chip und ersetzen sie durch 250 ul Wachstumsmedium mit 0,2% fötalem Rinderserum (FBS) und 1x Penicillin und Streptomycin (P / S) ergänzt. Inkubieren für 4 h (37 ᵒC, 5% CO 2). </li></ol> 3. Stoffwechselmesssystem Vorbereitung und Herstellung der Lösung <ol><li> Während der Inkubation vorbereiten die erforderlichen Medikamentenlösungen und den Stoffwechsel Messsystem für die kommende Test. HINWEIS: Der Stoffwechsel-Messsystem besteht aus insgesamt sechs Modulen. Jedes Modul bietet Platz für ein Chip pro Experiment. <ol><li> Unterteilen Sie den Test in den folgenden Versuchsgruppen: einem Chip von jedem der &quot;Kontrolle&quot; und &quot;Ziel Sehenswürdigkeit Gruppen Fahrzeug für die Dauer des Tests zu empfangen; zwei Chips aus jeder Gruppe auf eine medikamentöse Therapie für eine definierte Zeitdauer, während der ein Empfangsssay, mit einem Fahrzeug folgen während der Auswaschphase. </li><li> Für Drogen Sensibilisierung Studien, ändern Sie die Länge, Timing und Konzentration der medikamentösen Behandlung, die bestimmtes Medikament in Frage zu entsprechen. HINWEIS: Cisplatin, die folgenden Schritte wurden empirisch mit A549-Zellen bestimmt und können variieren je nach Zelllinie. Führen alle Stufen mit der Standardflussrate von 4 &amp; mgr; l / min. 6 h Wachstumsmedium + 0,2% FBS und 1 x P / S 24-Stunden von 6 uM Cisplatin in Medium + 0,2% FBS 1x P / S 24-Stunden-Wachstumsmedium + 0,2% FBS und 1 x P / S 18 Stunden des Wachstums-Medium + 0,2% FBS und 1 x P / S 4 h 0,1% Triton-X HINWEIS: Bei Abweichungen von diesen Schritten wird die Berechnung erfordern, um das erforderliche Volumen des Mediums und Arzneimittellösungen auf der Grundlage der Soll-Strömungsrate und der Dauer des Experiments zu bestimmen. Die folgenden Abschnitte sind auf den oben beschriebenen Schritten basieren. </li></ol></li><li> Label und füllen vierzehn 50-ml-Röhrchen mit 50 ml Wachstumsmedium + 0,2% FBS eind 1x P / S. Sie sechs in einem Metabolismus Meßsystem Röhrchengestell, sechs in dem anderen, und die verbleibenden zwei in einer dritten Rohrgestell, das auch Rohre mit Cisplatin. Dichten Sie die ersten zwei Racks mit einem luftdurchlässigen Membran um Verdunstung zu verhindern. </li><li> Bereiten Sie eine Lösung von 6 uM Cisplatin (der entsprechende Volume) in Medium + 0,2% FBS mit 1x P / S. Verzichten die gewünschte Lautstärke von Cisplatin-Lösung in vier markierten 50-ml-Röhrchen. <ol><li> Die Röhrchen in den verbleibenden vier Nuten der dritten Stoffwechsel Meßrohr Rack. Sicherzustellen, dass die Röhren in die entsprechenden Schlitze, die zu den gewünschten biomodules entsprechen platziert. Verschließen Sie die Röhrchen mit einer luftdurchlässigen Membran. </li></ol></li><li> Bereiten Sie und beschriften sechs 50-ml-Röhrchen und füllen sie mit je 20 ml 0,1% Triton-X-Lösung im Medium. Der Triton-X-Lösung wird alle verbleibenden Zellen zu lysieren und eine &quot;Null&quot; Wert für jeden Chip. Die Röhrchen in einem vierten Stoffwechsel Meßeinheit Rohrgestell und abdichten with ein Luft permable Membran übermäßiger Verdunstung zu verhindern. </li><li> Legen Sie die Chips in die biomodules und leitet das Experiment. </li></ol> 4. CAM Experiment Drug Treatment und Einspritzung HINWEIS: Die Schritte und Verfahren zur Herstellung der Hühnerembryonen für ein CAM-Experiment werden an anderer Stelle 19 beschrieben <ol><li> Beginnen Sie die Bearbeitung des CAM Experiment 48 Stunden nach der Transfektion (Tag 2). Unterteilen die &quot;Kontrolle&quot; und &quot;Ziel von Interesse Gruppen in zwei Flaschen für Fahrzeug und zwei für Cisplatin. Absaugen Medium aus den Kolben und füllt mit entweder 3 ml frisches Medium oder 6 uM Cisplatin. Inkubieren für 6 h (37 ᵒC, 5% CO 2). </li><li> Saugen Sie das Medium, dann waschen und trypsinieren der Zellen; sammeln die Zellen mit Trypsin in Lösung in vier entsprechend gekennzeichnete 15-ml-Röhrchen. <ol><li> Zentrifuge und waschen Sie die Zellen dreimal mit PBS. Re-suspendieren des Zellpellets in 5 ml PBS einemd die Zellen zu zählen. </li><li> Stellen Sie die Lautstärke so dass die endgültige Zellkonzentration ist 1,0x10 6 Zellen / ml. Übertragen Sie die Zell-Lösung in beschriftete 5-ml-Röhrchen zur Injektion, und legen Sie auf dem Eis. Der Injektion invertieren die Röhren vorsichtig vor, um sicherzustellen, dass die Zellen gut vermischt. </li></ol></li><li> Beiseite insgesamt 24 Hühnerembryonen (9 Tage alt) für die Injektion (6 pro Gruppe). Führen die Injektion unter Verwendung einer Glasnadel, um einen Schlauch mit einer 1 ml Spritze verbunden angebracht. Die individuelle Durchführung der Injektion sollte der Behandlungsgruppe blenden lassen. <ol><li> Mit einem Stereomikroskop zu injizieren 1,0x10 5 Zellen in einem Volumen von 100 ul in die venöse Zirkulation des CAM. Verwenden Sie eine lange, pulsierende Technik, um das volle Volumen von Zellen injizieren. Vorsichtig abtupfen die Injektionsstelle mit einem weichen abzuwischen, um den Blutfluss einzudämmen und zu absorbieren eventuelle Spritzer. Beschriften Sie jedes Embryo Behälter entsprechend nach jeder Injektion. </li></ol></li><li> Bestätigen Sie die Präsenz und Verteiteilung von fluoreszierenden Zellen in das Gefäßsystem des CAM nach der Injektion durch die Visualisierung sie mit einem Fluoreszenzmikroskop. Beachten Sie bitte die Embryonen, bei denen die Zahl der Tumorzellen scheint gering, oder die Verteilung ist schlecht. </li><li> Legen Sie die Hühnerembryonen in einer feuchten Kammer und speichern sie in einem Inkubator (37 ° C, Luftfeuchtigkeit 60%). Warten Sie 7-9 Tage vor der Aufzählung Metastasenherde. </li></ol> 5. metastasiertem Fokus Enumeration <ol><li> Während der 7-9 Tage Inkubationszeit überwachen die Embryonen und entsorgen Sie alle Toten. Sicherzustellen, dass der Feuchtigkeitskammer feucht bleibt zu allen Zeiten während der Inkubationszeit. </li><li> Verwendung eines Fluoreszenz-Stereomikroskop bei 20-facher Vergrößerung, scannen die gesamte Oberseite des Embryos CAM in einem regelmäßigen, gitterartiges Muster. </li><li> Die Anzahl der Metastasenherde in jedem Blickfeld, dann überein die Anzahl für eine abschließende Gesamt pro Embryo. Dies für die sechs Embryonen in jeder Gruppe eine durchschnittliche Zahl o liefernf metastatischen Foci pro Behandlung. </li></ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

Die Autoren haben nichts zu offenbaren.

Aufgrund der inhärenten Kosten und Risiken im Zusammenhang mit klinischen Studien, es notwendig ist, bessere und strengere präklinischen Testverfahren, um neue Anti-Krebs-Behandlung nicht ausreichend adäquat bewerten zu entwickeln. Strom häufigsten verwendeten Techniken alle Schwächen aufweisen, die ihre Fähigkeit, zwischen potentiell vielversprechende therapeutische Ziele / Agenten diskriminieren begrenzen kann, und jene, die weniger wirksam sein kann. Wir entwickelten ein Protokoll, um neue anti-Krebs Ansätze, ...

Erworbener Resistenz gegen gezielte und / oder zytotoxischen Krebsbehandlung ist ein wichtiges klinisches Problem, die zum Therapieversagen, Rückfall führen kann, und eine erhöhte Patientensterblichkeit 1. Angesichts der hohen Heterogenität in den meisten Tumoren, es ist eine mathematische Gewissheit, dass ein Tumor ausreichend hohe Zellzahl wird eine Untergruppe von Zellen resistent gegen einzelne oder kombinierte Therapien, die molekularen Wege, auf denen diese Zellen hängen zum Überleben 2,3 enthalten. Solche Tumorzellen können für den während der Behandlung ausgewählt werden, was zu einem Rezidiv. Entwicklung neuer Therapien, die gleichzeitig unterschiedliche Zielkrebszellüberlebensmechanismen, entweder vor oder nach der Behandlung vermittelte Selektion ist deshalb klinisch wichtig. Ein hohes Maß an Genominstabilität und Mutation in Tumor Genome ist eine grundlegende Eigenschaft, die Krebszellen aus Nicht-Tumorwirtszellen 4 unterscheidet. Folglich wird ein useful-Strategie, um die Wirksamkeit von DNA-schädigenden Chemotherapie zu erhöhen und die Entwicklung einer Resistenz zu verhindern ist, DNA-Reparatur hemmen aktiv in Tumorzellen 5. Dies ist ein aktives Forschungsgebiet und eine Vielzahl von neuen DNA-Reparatur-Ziele werden in einem präklinischen Einstellung erforscht. Eine Anzahl von kleinen Molekülen oder Antisense-basierte Inhibitoren dieser Ziele entwickelt und werden in der Erprobung 6-8. Das Ziel ist es, die vielversprechendsten präklinischen Kandidaten in klinischen Studien zu erkennen und bewerten ihre Sicherheit und Wirksamkeit. Die hohen Kosten der klinischen Versuche und die Gefahr einer Störung (für eine Vielzahl von Gründen, einschließlich suboptimaler präklinische Bewertung) sind gewaltige Hindernisse in die Entwicklung von neuen Therapien 9 voran. Die Verwendung geeigneter und strengen präklinischen Modellen angemessen neue therapeutische Targets und Wirkstoffkandidaten beurteilen kann die hohe Ausfallrate von 10 klinischen Studien zu verringern </sup&gt;. A) Messung der Fähigkeit, die Tumorzellproliferation in vitro (Zellproliferationsassays), b) Therapie-induzierte Verringerung der Kapazität von Tumorzellen zu verringern: Einige häufig verwendete vorklinischen Verfahren, die Wirksamkeit von neuen Antikrebs-Therapien sind, beurteilen Form Gewebekulturkolonien (kolonieBildungsTests), c) Therapie-induzierte Verringerung des Tumorzellstoffwechselaktivität in vitro (Redoxfarbstoff Umwandlung), d) Therapie-induzierte Induktion in vitro Tumorzelltodes (Apoptose, Nekrose, phage, zugeordnet mit der Mitose und weitere) 11, und e) in vivo-Therapie-induzierte Reduktion des Wachstums oder der Ablation von menschlichen und Maus-Xenotransplantaten 12-14. Eine Hauptschwäche der angeführten in vitro Verfahren ist, dass keine von ihnen eine kontinuierliche Echtzeit-Auswertung der Wirkung der Kandidatentherapie. Vielmehr nur an ausgewählten, weit auseinanderZeitPunkten liefern sie Informationenwährend des Verlaufs der Behandlung. Solche Messungen haben Kapazitäten, um die Größe und den Zeitpunkt des Tumorzellantworten genau widerspiegeln vermindert. In vivo-Maus-Xenograft-Modelle werden auch durch hohe Kosten, Zeitdauer in Anspruch, und das Risiko von suboptimalen Dosierungen und Verabreichungszeitpunkt (Scheduling) begrenzt. Darüber hinaus gibt es Hinweise, dass Nager Xenotransplantatmodellen begrenzt Prädiktoren für die klinische Wirksamkeit in Menschen im Vergleich zu in-vitro-Bewertung der Reaktionen von primären humanen Tumorzellen und etablierten menschlichen Tumorzellinien Kandidaten therapeutische Interventionen 15,16. Wir entwickelten eine neuartige Kombinationsprotokoll neue Arzneimittelkombinationen vorklinisch auszuwerten, in einer Weise, die die Schwächen der oben genannten üblichere Verfahren adressiert. An die Stelle der Proliferation, Koloniebildung oder Redoxfarbstoff Umwandlung Tests verwendeten wir einen Stoffwechsel Maßeinheit Zelladhäsion, Atmung und die Versauerung in Echtzeit zu analysierenwährend des gesamten Behandlungszeitraums 17. Gleichzeitig untersuchten wir die Auswirkungen der Behandlung Kombination in vivo durch die Verwendung eines Hühnerembryo Chorioallantoismembran (CAM) Modell der Invasion und Metastasierung von 18,19. Wir verwendeten diese Methoden, um die Fähigkeit eines Antisense-Oligonukleotid (ASO) Targeting BRCA2, um die Wirksamkeit der üblicherweise verwendeten chemotherapeutischen Arzneimittel Cisplatin potenzieren bewerten.

<table border="0" cellpadding="0" cellspacing="0" >
	<tbody>
		<tr >
			<td >Name of Material/ Equipment</td>
			<td >Company</td>
			<td >Catalog Number</td>
			<td >Comments/Description</td>
		</tr>
		<tr >
			<td >A549 cells</td>
			<td >ATCC</td>
			<td >CCL-185</td>
			<td>http://www.atcc.org/products/all/CCL-185.aspx</td>
		</tr>
		<tr >
			<td >AeraSeal film&#160;</td>
			<td >Carl Roth GmbH</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >AMEM</td>
			<td >Wisent Bioproducts</td>
			<td >210-011-QK</td>
			<td></td>
		</tr>
		<tr >
			<td >Antisense oligodeoxynucleotides</td>
			<td >Avecia</td>
			<td ></td>
			<td>BRCA2 target sequence: 5&#39; - UAAGGAACGUCAAGAGAUAC - 3&#39; (bases 7241-7259 )</td>
		</tr>
		<tr >
			<td >Axio Zoom V16 Microscope</td>
			<td >Carl Zeiss</td>
			<td ></td>
			<td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td>
		</tr>
		<tr >
			<td >Bionas Biosensor Chips</td>
			<td >Bionas GmbH and Micronas GmbH</td>
			<td >BIS8001D</td>
			<td></td>
		</tr>
		<tr >
			<td >Bionas Discovery 2500 System&#160;</td>
			<td >Bionas GmbH</td>
			<td ></td>
			<td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td>
		</tr>
		<tr >
			<td >Cisplatin</td>
			<td >Sigma Aldrich</td>
			<td >479306</td>
			<td></td>
		</tr>
		<tr >
			<td >Fertilized chicken eggs</td>
			<td >Sourced locally</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Fetal bovine serum&#160;</td>
			<td >Gibco - Life Technologies</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Lipofectamine 2000&#160;</td>
			<td >Invitrogen - Life Technologies&#160;</td>
			<td >12566014</td>
			<td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td>
		</tr>
		<tr >
			<td >PBS</td>
			<td >Wisent Bioproducts</td>
			<td >311-010-CL</td>
			<td></td>
		</tr>
		<tr >
			<td >Trypsin (0.25%)/EDTA</td>
			<td >Wisent Bioproducts</td>
			<td >325-043-CL</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

Aufgrund der hohen Heterogenität und Mutationen in der menschlichen Krebsarten, einzelnes Mittel Therapien oder Kombinationstherapien, die den gleichen Weg zielen, sind wahrscheinlich versagen. Der Nachdruck auf die Hemmung der Pfade bei der intrinsischen und / oder adaptive Therapieresistenz verantwortlich sind, platziert werden. Ein aktives Forschungsgebiet ist die Entwicklung und Erprobung von DNA-Reparatur-Inhibitoren, die die Wirkung von zu fördern und zu verhindern, Widerstand gegen, häufig verwendete Chemotherapie und Strahlentherapie. Wir verwendeten eine neue Methode, um die Wirksamkeit der BRCA2 Hemmung als Mittel zur Tumorzellen mit der DNA-schädigenden Medikament Cisplatin sensibilisieren bewerten. Tumorzellstoffwechsel (Versauerung und Atmung) wurde in Echtzeit über einen Zeitraum von 72 Stunden, um die Wirksamkeit der Behandlung auf einem von Minute zu Minute Grundlage abzugrenzen überwacht. In Kombination, eine Bewertung der metastatischen Frequenz führten wir mit einem Hühnerembryo Chorioallantoismembran (CAM) Modell der Extravasation und Invasion. DieseProtokoll behandelt einige Schwächen üblicherweise in vitro und in vivo-Verfahren verwendet werden, um neue Krebstherapieschemata zu bewerten. Es kann neben üblichen Methoden wie Zellproliferationsassays, Zelltod Assays verwendet werden, und in vivo murine Xenograft Studien genauer unter in Frage kommenden Zielen und Mitteln unterscheiden und wählt nur die aussichtsreichsten Kandidaten für eine weitere Entwicklung.

Ergebnisse und Zahlen mit Genehmigung aus veröffentlichten Arbeiten 22 angepasst. BRCA2 Hemmung induziert eine Abnahme der Atmung in Cisplatin behandelten Tumorzellen Menschen A549 Lungenkrebszellen mit BRCA2-Targeting ASO und Cisplatin zeigte eine frühe und irreversible Abnahme der Atmung, im Vergleich zu Zellen, die Steuer ASO und Cisplatin allein erhielt behandelt; nach 24 h Behandlung mit Cisplatin die Differenz in der Atmung zwischen BR...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

Bewertung der Wirksamkeit der Krebsmedikament Sensibilisierung<em&gt; In-vitro-</em&gt; Und<em&gt; In-vivo-</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

8.2K Aufrufe.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

Serie: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent until many years after removal of the primary tumor and adjuvant therapy. A likely explanation of this phenomenon is that tumor cells have seeded metastatic sites, are resistant to conventional therapies, and remain dormant for long periods of time 1-4.
The existence of dormant cancer cells at secondary sites has been described previously as quiescent solitary cells that neither proliferate nor undergo apoptosis 5-7. Moreover, these solitary cells has been shown to disseminate from the primary tumor at an early stage of disease progression 8-10 and reside growth-arrested in the patients' bone marrow, blood and lymph nodes 1,4,11. Therefore, understanding mechanisms that regulate dormancy or the switch to a proliferative state is critical for discovering novel targets and interventions to prevent disease recurrence. However, unraveling the mechanisms regulating the switch from tumor dormancy to metastatic growth has been hampered by the lack of available model systems.
in vivo and ex vivo model systems to study metastatic progression of tumor cells have been described previously 1,12-14. However these model systems have not provided in real time and in a high throughput manner mechanistic insights into what triggers the emergence of solitary dormant tumor cells to proliferate as metastatic disease. We have recently developed a 3D in vitro system to model the in vivo growth characteristics of cells that exhibit either dormant (D2.OR, MCF7, K7M2-AS.46) or proliferative (D2A1, MDA-MB-231, K7M2) metastatic behavior in vivo . We demonstrated that tumor cells that exhibit dormancy in vivo at a metastatic site remain quiescent when cultured in a 3-dimension (3D) basement membrane extract (BME), whereas cells highly metastatic in vivo readily proliferate in 3D culture after variable, but relatively short periods of quiescence. Importantly by utilizing the 3D in vitro model system we demonstrated for the first time that the ECM composition plays an important role in regulating whether dormant tumor cells will switch to a proliferative state and have confirmed this in in vivo studies15-17. Hence, the model system described in this report provides an in vitro method to model tumor dormancy and study the transition to proliferative growth induced by the microenvironment.

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

A modified 3-D in vitro system is presented in which growth characteristics of several tumor cell lines in reconstituted basement membrane correlate with the dormant or proliferative behavior of the tumor cells at a metastatic secondary site in vivo.

Ein In Vitro System zur Tumor Vegetationsruhe und die Umstellung auf Metastasen Study

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent ...

Forschung

Medizin

Multi-modal Imaging of Angiogenesis in a Nude Rat Model of Breast Cancer Bone Metastasis Using Magnetic Resonance Imaging, Volumetric Computed Tomography and Ultrasound

Angiogenesis is an essential feature of cancer growth and metastasis formation. In bone metastasis, angiogenic factors are pivotal for tumor cell proliferation in the bone marrow cavity as well as for interaction of tumor and bone cells resulting in local bone destruction. Our aim was to develop a model of experimental bone metastasis that allows in vivo assessment of angiogenesis in skeletal lesions using non-invasive imaging techniques.
For this purpose, we injected 105 MDA-MB-231 human breast cancer cells into the superficial epigastric artery, which precludes the growth of metastases in body areas other than the respective hind leg1. Following 25-30 days after tumor cell inoculation, site-specific bone metastases develop, restricted to the distal femur, proximal tibia and proximal fibula1. Morphological and functional aspects of angiogenesis can be investigated longitudinally in bone metastases using magnetic resonance imaging (MRI), volumetric computed tomography (VCT) and ultrasound (US).
MRI displays morphologic information on the soft tissue part of bone metastases that is initially confined to the bone marrow cavity and subsequently exceeds cortical bone while progressing. Using dynamic contrast-enhanced MRI (DCE-MRI) functional data including regional blood volume, perfusion and vessel permeability can be obtained and quantified2-4. Bone destruction is captured in high resolution using morphological VCT imaging. Complementary to MRI findings, osteolytic lesions can be located adjacent to sites of intramedullary tumor growth. After contrast agent application, VCT angiography reveals the macrovessel architecture in bone metastases in high resolution, and DCE-VCT enables insight in the microcirculation of these lesions5,6. US is applicable to assess morphological and functional features from skeletal lesions due to local osteolysis of cortical bone. Using B-mode and Doppler techniques, structure and perfusion of the soft tissue metastases can be evaluated, respectively. DCE-US allows for real-time imaging of vascularization in bone metastases after injection of microbubbles7.
In conclusion, in a model of site-specific breast cancer bone metastases multi-modal imaging techniques including MRI, VCT and US offer complementary information on morphology and functional parameters of angiogenesis in these skeletal lesions.

In the pathogenesis of bone metastasis, angiogenesis is a crucial process and therefore represents a target for imaging and therapy. Here, we present a rat model of site-specific breast cancer bone metastasis and describe strategies to non-invasively image angiogenesis in vivo using magnetic resonance imaging, volumetric computed tomography and ultrasound.

Multimodale Bildgebung von Angiogenese in einem Nude Rattenmodell der Brustkrebs Knochenmetastasen mittels Magnetresonanztomographie, volumetrische Computertomographie und Ultraschall

Angiogenesis is an essential feature of cancer growth and metastasis formation. In bone metastasis, angiogenic factors are pivotal for tumor cell ...

Live Imaging of Drug Responses in the Tumor Microenvironment in Mouse Models of Breast Cancer

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional co-culture systems are frequently used to explicate tumor-stroma interactions, including their role in drug responses. However, many of the interactions that occur in vivo in the intact microenvironment cannot be completely replicated in these in vitro settings. Thus, direct visualization of these processes in real-time has become an important tool in understanding tumor responses to therapies and identifying the interactions between cancer cells and the stroma that can influence these responses. Here we provide a method for using spinning disk confocal microscopy of live, anesthetized mice to directly observe drug distribution, cancer cell responses and changes in tumor-stroma interactions following administration of systemic therapy in breast cancer models. We describe procedures for labeling different tumor components, treatment of animals for observing therapeutic responses, and the surgical procedure for exposing tumor tissues for imaging up to 40 hours. The results obtained from this protocol are time-lapse movies, in which such processes as drug infiltration, cancer cell death and stromal cell migration can be evaluated using image analysis software.

We describe a method for imaging response to anti-cancer treatment in vivo and at single cell resolution.

Live-Imaging of Drug Responses in der Tumor-Mikroumgebung in Mausmodellen von Brustkrebs

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional ...

Slow-release Drug Delivery through Elvax 40W to the Rat Retina: Implications for the Treatment of Chronic Conditions

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these diseases. Chronic retinal diseases such as retinal oedema or neovascularization usually require multiple intraocular injections to effectively treat the condition. However, the risks associated with these injections increase with repeated delivery of the drug. Therefore, alternative delivery methods need to be established in order to minimize the risks of reinjection. Several other investigations have developed methods to deliver drugs over extended time, through materials capable of releasing chemicals slowly into the eye. In this investigation, we outline the use of Elvax 40W, a copolymer resin, to act as a vehicle for drug delivery to the adult rat retina. The resin is made and loaded with the drug. The drug-resin complex is then implanted into the vitreous cavity, where it will slowly release the drug over time. This method was tested using 2-amino-4-phosphonobutyrate (APB), a glutamate analogue that blocks the light response of the retina. It was demonstrated that the APB was slowly released from the resin, and was able to block the retinal response by 7 days after implantation. This indicates that slow-release drug delivery using this copolymer resin is effective for treating the retina, and could be used therapeutically with further testing.

This paper details how Elvax 40W can be used as a slow-release method for drug delivery to the adult rat retina. The protocol for preparing, loading, and delivering the drug-resin complex to the eye is described.

Slow-Release-Drug Delivery durch Elvax 40W, um die Ratte Retina: Implikationen für die Behandlung von chronischen Erkrankungen

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these ...

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study model. As the use of mouse models are often a vital step in preclinical drug discovery and drug development1-8, it is necessary to design a system to introduce drugs into mice in a uniform, reproducible manner. Ideally, the system should permit the collection of blood samples at regular intervals over a set time course. The ability to measure drug concentrations by mass-spectrometry, has allowed investigators to follow the changes in plasma drug levels over time in individual mice1, 9, 10. In this study, paclitaxel was introduced into transgenic mice as a continuous arterial infusion over three hours, while blood samples were simultaneously taken by retro-orbital bleeds at set time points. Carotid artery infusions are a potential alternative to jugular vein infusions, when factors such as mammary tumors or other obstructions make jugular infusions impractical. Using this technique, paclitaxel concentrations in plasma and tissue achieved similar levels as compared to jugular infusion. In this tutorial, we will demonstrate how to successfully catheterize the carotid artery by preparing an optimized catheter for the individual mouse model, then show how to insert and secure the catheter into the mouse carotid artery, thread the end of the catheter out through the back of the mouse&#8217;s neck, and hook the mouse to a pump to deliver a controlled rate of drug influx. Multiple low volume retro-orbital bleeds allow for analysis of plasma drug concentrations over time.

This method was developed with the goal of delivering a steady drug solution via the carotid artery, to assess the pharmacokinetics of novel drugs in mouse models.

Halsschlagader Infusionen für pharmakokinetischen und pharmakodynamischen Analyse von Taxanen in Mäusen

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study ...

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of women are alive 5 years after diagnosis. The omentum is a preferred site of HGSC metastasis formation. Despite the clinical importance of this microenvironment, the contribution of omental adipose tissue to ovarian cancer progression remains understudied. Omental adipose is unusual in that it contains structures known as milky spots, which are comprised of B, T, and NK cells, macrophages, and progenitor cells surrounding dense nests of vasculature. Milky spots play a key role in the physiologic functions of the omentum, which are required for peritoneal homeostasis. We have shown that milky spots also promote ovarian cancer metastatic colonization of peritoneal adipose, a key step in the development of peritoneal metastases. Here we describe the approaches we developed to evaluate and quantify milky spots in peritoneal adipose and study their functional contribution to ovarian cancer cell metastatic colonization of omental tissues both in vivo and ex vivo. These approaches are generalizable to additional mouse models and cell lines, thus enabling the study of ovarian cancer metastasis formation from initial localization of cells to milky spot structures to the development of widespread peritoneal metastases.

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

We outline a protocol that implements both in vivo and ex vivo approaches to study ovarian cancer colonization of peritoneal adipose tissues, particularly the omentum. Furthermore, we present a protocol to quantitate and analyze immune cell-structures in the omentum known as milky spots, which promote metastases of peritoneal adipose.

In vivo und ex vivo Ansätze für Eierstockkrebs Metastatische Colonization von Milky Punktstrukturen in Peritoneal Fettgewebe Studieren

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Studieren Bauchspeicheldrüsenkrebs Stammzelleigenschaften für die Entwicklung neuer Behandlungsstrategien

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Depletion of Mouse Cells from Human Tumor Xenografts Significantly Improves Downstream Analysis of Target Cells

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic patient tumors in different assays1. Human tumor xenografts represent the gold standard with respect to tumor biology, drug discovery, and metastasis research 2-4. Tumor xenografts can be derived from different types of material like tumor cell lines, tumor tissue from primary patient tumors4 or serially transplanted tumors. When propagated in vivo, xenografted tissue is infiltrated and vascularized by cells of mouse origin. Multiple factors such as the tumor entity, the origin of xenografted material, growth rate and region of transplantation influence the composition and the amount of mouse cells present in tumor xenografts. However, even when these factors are kept constant, the degree of mouse cell contamination is highly variable.
Contaminating mouse cells significantly impair downstream analyses of human tumor xenografts. As mouse fibroblasts show high plating efficacies and proliferation rates, they tend to overgrow cultures of human tumor cells, especially slowly proliferating subpopulations. Mouse cell derived DNA, mRNA, and protein components can bias downstream gene expression analysis, next-generation sequencing, as well as proteome analysis 5. To overcome these limitations, we have developed a fast and easy method to isolate untouched human tumor cells from xenografted tumor tissue. This procedure is based on the comprehensive depletion of cells of mouse origin by combining automated tissue dissociation with the benchtop tissue dissociator and magnetic cell sorting. Here, we demonstrate that human target cells can be can be obtained with purities higher than 96% within less than 20 min independent of the tumor type.

Human tumor xenografts are vascularized and infiltrated by cells of mouse origin during the growth phase in vivo. To circumvent the bias caused by these contaminating cells during downstream analysis, we developed a method allowing for comprehensive depletion of all mouse cells by magnetic cell sorting.

Depletion von Maus-Zellen aus menschlichem Tumorxenografte deutlich verbessert Downstream-Analyse von Zielzellen

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Forskolin-induzierte Quellung in Intestinale Organoide: Ein<em&gt; In Vitro</em&gt; Assay für Fibrosis Patienten in Cystic Drug Response-Beurteilung

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic study in the liver. Here, numerous assays are described to comprehensively measure the phenotype and parameters of hepatic steatosis in mouse and hepatocyte models. 
Combining the physiological, histological, and biochemical methods, this system can be used to assess the progress of hepatic steatosis. In vivo, the measurements of body weight and nuclear magnetic resonance (NMR) provide a general understanding of mice in a non-invasive manner. Hematoxylin and Eosin (H&amp;E) and Oil Red O staining determine the histological morphology and lipid deposition of liver tissue under nutrient overload conditions, such as high-fat diet feeding. Next, the total lipid contents are isolated by chloroform/methanol extraction, which are followed by a biochemical analysis for triglyceride and cholesterol. Moreover, mouse primary hepatocytes are treated with high glucose plus insulin to stimulate lipid accumulation, an efficient in vitro model to mimic diet-induced hyperglycemia and hyperinsulinemia in vivo. Then, the lipid deposition is measured by Oil Red O staining and chloroform/methanol extraction. Oil Red O staining determines intuitive hepatic steatotic phenotypes, while the lipid extraction analysis determines the parameters that can be analyzed statistically. The present protocols are of interest to scientists in the fields of fatty liver diseases, insulin resistance, and type 2 diabetes.

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Here, optimized methods to generate in vivo and in vitro models of hepatic steatosis and to analyze the steatotic phenotypes and related physiological parameters are described.

Optimierte Analyse von<em&gt; In Vivo</em&gt; und<em&gt; In Vitro</em&gt; Hepatosteatose

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Bewertung der Wirksamkeit der Krebsmedikament Sensibilisierung

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video