We thank Chris Benner for implementing the X. tropicalis genome (xenTro2, xenTro2r) into HOMER and the Gilchrist lab for discussions on post-sequencing analysis. I.P. assisted the GO term analysis. G.E.G and J.C.S. were supported by the Wellcome Trust and are now supported by the Medical Research Council (program number U117597140).

<ol>
	<li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+protein-DNA+interactions+in+vivo:+distribution+of+RNA+polymerase+on+specific+bacterial+genes.">Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes.</a> Proc Natl Acad Sci U S A. 81 (14), 4275-4279 (1984).</li><li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+interactions+of+RNA+polymerase+II+with+genes+of+Drosophila+melanogaster.">In vivo interactions of RNA polymerase II with genes of Drosophila melanogaster.</a> Mol Cell Biol. 5 (8), 2009-2018 (1985).</li><li>Solomon, M. J., Larsen, P. L., Varshavsky, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+protein-DNA+interactions+in+vivo+with+formaldehyde:+evidence+that+histone+H4+is+retained+on+a+highly+transcribed+gene.">Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene.</a> Cell. 53 (6), 937-947 (1988).</li><li>Ren, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+location+and+function+of+DNA+binding+proteins.">Genome-wide location and function of DNA binding proteins.</a> Science. 290 (5500), 2306-2309 (2000).</li><li>Johnson, D., Mortazavi, A., Myers, R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+in+vivo+protein-DNA+interactions.">Genome-wide mapping of in vivo protein-DNA interactions.</a> Science. 316 (5830), 1497-1502 (2007).</li><li>Hellsten, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genome+of+the+Western+clawed+frog+Xenopus+tropicalis.">The genome of the Western clawed frog Xenopus tropicalis.</a> Science. 328 (5978), 633-636 (2010).</li><li>Lee, T. I., Johnstone, S. E., Young, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+microarray-based+analysis+of+protein+location.">Chromatin immunoprecipitation and microarray-based analysis of protein location.</a> Nature Protocols. 1 (2), 729-748 (2006).</li><li>Blythe, S. A., Reid, C. D., Kessler, D. S., Klein, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+in+early+Xenopus+laevis+embryos.">Chromatin immunoprecipitation in early Xenopus laevis embryos.</a> Dev Dyn. 238 (6), 1422-1432 (2009).</li><li>Gentsch, G. E., Smith, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+physical+chromatin+associations+across+the+Xenopus+genome+by+chromatin+immunoprecipitation.">Investigating physical chromatin associations across the Xenopus genome by chromatin immunoprecipitation.</a> Cold Spring Harb Protoc. 2014 (5), (2014).</li><li>Ubbels, G. A., Hara, K., Koster, C. H., Kirschner, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+functional+role+of+the+cytoskeleton+in+determination+of+the+dorsoventral+axis+in+Xenopus+laevis+eggs.">Evidence for a functional role of the cytoskeleton in determination of the dorsoventral axis in Xenopus laevis eggs.</a> J Embryol Exp Morphol. 77, 15-37 (1983).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Brief Bioinform. 14 (2), 178-192 (2013).</li><li>Imoto, S., Nolan, J., Bioinformatics Miyano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> 20 (9), 1453-1454 (2004).</li><li>Camacho, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLAST+:+architecture+and+applications.">BLAST+: architecture and applications.</a> BMC Bioinformatics. 10, 421 (2009).</li><li>Conesa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blast2GO:+a+universal+tool+for+annotation,+visualization+and+analysis+in+functional+genomics+research.">Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research.</a> Bioinformatics. 21 (18), 3674-3676 (2005).</li><li>Sive, H., Grainger, R., Harland, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Early development of Xenopus laevis: A laboratory manual. , (2000).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evaluation+of+factors+influencing+ChIP-seq+fidelity.">Systematic evaluation of factors influencing ChIP-seq fidelity.</a> Nat Methods. 9 (6), 609-614 (2012).</li><li>Sharov, A. A., Ko, M. S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exhaustive+search+for+over-represented+DNA+sequence+motifs+with+CisFinder.">Exhaustive search for over-represented DNA sequence motifs with CisFinder.</a> DNA Res. 16 (5), 261-273 (2009).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucl Acids Res. 37 (2), W202-W208 (2009).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq:+advantages+and+challenges+of+a+maturing+technology.">ChIP-seq: advantages and challenges of a maturing technology.</a> Nat Rev Genet. 10 (10), 669-680 (2009).</li><li>Gentsch, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+T-box+transcription+factor+profiling+reveals+joint+regulation+of+embryonic+neuromesodermal+bipotency.">In vivo T-box transcription factor profiling reveals joint regulation of embryonic neuromesodermal bipotency.</a> Cell Rep. 4 (6), 1185-1196 (2013).</li><li>Barabasi, A. L., Oltvai, Z. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Network+biology:+understanding+the+cell's+functional+organization.">Network biology: understanding the cell's functional organization.</a> Nat Rev Genet. 5 (2), 101-113 (2004).</li><li>Biggin, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+transcription+networks+as+highly+connected,+quantitative+continua.">Animal transcription networks as highly connected, quantitative continua.</a> Dev Cell. 21 (4), 611-626 (2011).</li><li>Nieuwkoop, P. D., Faber, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Normal table of Xenopus laevis (Daudin): a systematical and chronological survey of the development from the fertilized egg till the end of metamorphosis. , (1994).</li><li>Akkers, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hierarchy+of+H3K4me3+and+H3K27me3+acquisition+in+spatial+gene+regulation+in+Xenopus+embryos.">A hierarchy of H3K4me3 and H3K27me3 acquisition in spatial gene regulation in Xenopus embryos.</a> Dev Cell. 17 (3), 425-434 (2009).</li><li>Yoon, S. J., Wills, A. E., Chuong, E., Gupta, R., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> HEB and E2A function as SMAD/FOXH1 cofactors. Genes Dev. 25 (15), 1654-1661 (2011).</li><li>Jallow, Z., Jacobi, U. G., Weeks, D. L., Dawid, I. B., Veenstra, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+and+redundant+roles+of+TBP+and+a+vertebrate-specific+TBP+paralog+in+embryonic+gene+regulation+in+Xenopus.">Specialized and redundant roles of TBP and a vertebrate-specific TBP paralog in embryonic gene regulation in Xenopus.</a> Proc Natl Acad Sci U S A. 101 (37), 13525 (2004).</li><li>Buchholz, D. R., Paul, B. D., Shi, Y. -. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene-specific+changes+in+promoter+occupancy+by+thyroid+hormone+receptor+during+frog+metamorphosis.+Implications+for+developmental+gene+regulation.">Gene-specific changes in promoter occupancy by thyroid hormone receptor during frog metamorphosis. Implications for developmental gene regulation.</a> J Biol Chem. 280 (50), 41222-41228 (2005).</li><li>Wills, A. E., Guptaa, R., Chuonga, E., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+deep+sequencing+in+Xenopus+tropicalis+and+Xenopus+laevis.">Chromatin immunoprecipitation and deep sequencing in Xenopus tropicalis and Xenopus laevis.</a> Methods. 66 (3), 410-421 (2014).</li><li>Metz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+formaldehyde-induced+modifications+in+proteins:+reactions+with+model+peptides.">Identification of formaldehyde-induced modifications in proteins: reactions with model peptides.</a> J Biol Chem. 279 (8), 6235-6243 (2004).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Deal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+method+for+gene+expression+and+chromatin+profiling+of+individual+cell+types+within+a+tissue.">A simple method for gene expression and chromatin profiling of individual cell types within a tissue.</a> Dev Cell. 18 (6), 1030-1040 (2010).</li><li>Bonn, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue-specific+analysis+of+chromatin+state+identifies+temporal+signatures+of+enhancer+activity+during+embryonic+development.">Tissue-specific analysis of chromatin state identifies temporal signatures of enhancer activity during embryonic development.</a> Nat Genet. 44 (2), 148-156 (2012).</li></ol>

The authors declare that they have no competing financial interests.

Unser Protokoll beschreibt, wie zu machen und zu analysieren, genomweite Chromatin Profile Xenopus-Embryonen. Es umfasst alle Schritte von vernetzenden Proteinen an endogenen Loci in vivo auf die Verarbeitung Millionen liest, die angereicherten genomische Websites in silico. Da immer mehr Genom Entwürfe zur Verfügung stehen, sollte dieses Protokoll auf andere Modell und nicht-Modellorganismen sein. Die wichtigsten experimentellen Teil, der dieses Protokoll von bisherigen Arbeit 8,31,33,34 stellt, ist die nach der Fixierung vor, um vernetzte Kerne zu extrahieren. Es ermöglicht die effiziente Chromatin Solubilisierung und Scher und einfach Upscaling. Zusammen mit verbesserten Wirkungsgraden von Bibliothek Vorbereitung dieses Protokoll erlaubt den Aufbau hochkomplexe ChIP-Seq-Bibliotheken von eineinhalb bis zwei Millionen Zellen der Chromatin-assoziierte Epitop von Interesse exprimieren. Für ChIP-qPCR-Experimente, einige zehntausend dieser Zellen sind in der Regel genug,für DNA Bereicherung auf vielleicht sechs verschiedenen genomischen Loci zu überprüfen. Diese Zahlen sind vorsichtige Schätzungen, kann aber je nach Expressionsniveau Protein, Antikörper Qualität abhängig, Vernetzungseffizienz und Epitop Zugänglichkeit. Als Richtwert ca. 4000 Zellen in der Mitte Blastulastadium (8,5 nach Nieuwkoop und Faber 29) enthält eine einzige Xenopus Embryo, 40.000 Zellen in der späten Gastrula-Stadium (12) und 100.000 Zellen in einem frühen Schwanzknospe Bühne (20). Die exakte Fixierung Zeit für eine effiziente Immunfällung muss empirisch durch ChIP-qPCR (§ 10) ermittelt werden. Im allgemeinen werden mehr Fixierungszeiten benötigt, wenn das Experiment beinhaltet X. laevis Embryonen frühen Entwicklungsstadien, und schwach (oder indirekte) DNA-Bindungseigenschaften. Es wird jedoch nicht empfohlen Befestigungs Xenopus Embryonen länger als 40 Minuten, oder Verarbeitung mehr Embryonen als angegeben (Abschnitt 3), Chromatin Scher wird weniger effizient. Es ist wichtig,jede Glycin nach der Fixierung als dieser gemeinsamen Schritt zum Abschrecken Formaldehyd Kernentnahme aus dotterreichen Embryonen sehr schwierig machen zu verwenden. Derzeit ist der Grund hierfür nicht bekannt. Es ist denkbar, dass die Formaldehyd-Glycin-Addukt ferner mit N-terminalen Amino-Gruppen oder Argininresten 35 reagiert. Der Antikörper ist der Schlüssel für ein Chip-Experiment und ausreichende Kontrollen müssen durchgeführt, um ihre Spezifität für das Epitop von Interesse zeigen werden (siehe Richtlinien Landt et al. 36). Wenn kein ChIP Grade Antikörper verfügbar ist, kann die Einführung von entsprechenden Epitop markierte Fusionsproteine ​​eine legitime Alternative sein, da diese Proteine ​​Bindungsstellen besetzen 37 endogen. In diesem Fall sind nicht injizierten Embryonen am besten, als negative Kontrolle eher als ein Chip mit unspezifischen Serum zu verwenden. Diese Strategie kann auch angewendet werden, wenn das Protein von Interesse auf einem niedrigen Niveau, was zu der schlechten Rückgewinnung des enri ausdrückenched DNA. Als zur Herstellung ChIP-Seq Bibliotheken, wegen der geringen Menge an DNA, im Gebrauch, ist es empfehlenswert, für Verfahren, die die Anzahl der Reinigungsschritte zu verringern und um eine Reaktion zu kombinieren, um den Verlust von DNA auf ein Minimum zu entscheiden. Die Adapter und Grundierungen müssen mit Multiplex-Sequenzierung und der NGS-Plattform kompatibel sind (siehe Tabelle der spezifischen Materialien / Geräte). Bei der Verwendung von Y-Adaptern (mit langen Einzelstrang-Arme), ist es wichtig vor, verstärken die Bibliothek drei bis fünf PCR-Runden vor size-Auswahl DNA-Insertionen (z. B. 100 bis 300 bp) durch Gelelektrophorese. Einzelsträngigen Enden verursachen DNA Fragmente heterogen migrieren. Testläufe mit verschiedenen Mengen an Ausgangs-DNA (zB 0,1, 0,5, 1, 2, 5, 10 und 20 ng) werden empfohlen, um die Gesamtzahl der PCR-Zyklen zu bestimmen (weniger als oder gleich 18 Zyklen) erforderlich, um eine Größe zu machen -Ausgewählte Bibliothek von 100 bis 200 ng. Verringerung der Anzahl der PCR-Zyklen macht die Sequenzierung redundant liest weniger wahrscheinlich. Die Festphasen-reversible Immobilisierung Perlen sind gute Reinigung Reagenzien zur effizienten Wiederherstellung der DNA von Interesse und zuverlässig entfernen Sie alle freien Adaptern und Dimere von Ligation und PCR-Reaktionen. In Bezug auf die Anzahl, Art und Länge der liest, um 20 bis 30 Millionen Single-End liest von 36 bp ist genug für die meisten ChIP-Seq-Experimente, die ganze Xenopus Genom mit ausreichender Tiefe zu decken. Die häufigsten NGS Maschinen sind routinemäßig in der Lage, die diese Kriterien erfüllen. Es kann jedoch von Vorteil sein, um die Anzahl zu erhöhen der liest, wenn eine breite Verteilung der liest wird erwartet, da mit Histon-Modifikationen zu beobachten, anstatt scharfe Spitzen. Für viele ChIP-Seq Experimenten 4 bis 5 unterschiedlich indizierten Bibliotheken gepoolt und in einer Durchflusszelle Fahrspur unter Verwendung einer Hochleistungsmaschine NGS sequenziert werden. Manchmal ist auch ratsam, die Lese Länge und Sequenz an beiden Enden der DNA-Vorlage (Paired-End), um Abbildbarkeit w erhöhen verlängernHenne Analyse Chromatin innerhalb repetitiven genomischen Regionen. Dieses Protokoll wurde erfolgreich in einer Vielzahl von Chromatin Funktionen wie Transkriptionsfaktoren, Signalmediatoren und posttranslationale Histonmodifizierungen aufgebracht. Allerdings Embryonen gewinnen einen zunehmenden Grad an zellulärer Heterogenität, wie sie sich entwickeln und Chromatin-Profile schwerer zu interpretieren. Erste Schritte auf in Arabidopsis und Drosophila gewebsspezifisch Profil Chromatin Landschaften durch Extrahieren zelltypspezifische Kerne 38,39 erzielt. Unser Protokoll umfasst eine Kernextraktionsschritt, der den Weg für die gewebespezifische ChIP-Seq anderer Embryonen bahnen könnte.

The first attempts to characterize protein-DNA interactions in vivo were reported about 30 years ago in an effort to understand RNA polymerase-mediated gene transcription in bacteria and in the fruit fly1,2. Since then, the use of immunoprecipitation to enrich distinct chromatin features (ChIP) has been widely adopted to capture binding events and chromatin states with high efficiency3. Subsequently, with the emergence of powerful microarray technologies, this method led to the characterization of genome-wide chromatin landscapes4. More recently, chromatin profiling has become even more comprehensive and high-resolution, because millions of co-immunoprecipitated DNA templates can now be sequenced in parallel and mapped to the genome (ChIP-Seq)5. As increasing numbers of genome assemblies are available, ChIP-Seq is an attractive approach to learn more about the genome regulation that underlies biological processes. 
Here we provide a protocol to perform ChIP-Seq on yolk-rich embryos such as those of the frog Xenopus. Drafts of the genomes of both widely used Xenopus species&#8212;X. tropicalis and X. laevis&#8212;have now been released by the International Xenopus Genome Consortium6. The embryos of Xenopus species share many desirable features that facilitate and allow the interpretation of genome-wide chromatin studies, including the production of large numbers of high-quality embryos, the large size of the embryos themselves, and their external development. In addition, the embryos are amenable to classic and novel manipulations like cell lineage tracing, whole-mount in situ hybridisation, RNA overexpression, and TALEN/CRISPR-mediated knockout technology.
The following protocol builds on the work of Lee et al., Blythe et al. and Gentsch et al.7-9. Briefly, Xenopus embryos are formaldehyde-fixed at the developmental stage of interest to covalently bind (cross-link) proteins to their associated genomic DNA. After nuclear extraction, cross-linked chromatin is fragmented to focus subsequent sequencing on specific genomic binding or modification sites, and to minimize the contributions of flanking DNA sequences. Subsequently, the chromatin fragments are immunoprecipitated with a ChIP-grade antibody to enrich those containing the protein of interest. The co-immunoprecipitated DNA is stripped from the protein and purified before creating an indexed (paired-end) library for next-generation sequencing (NGS). At the end, simple command lines are offered for the post-sequencing analysis of ChIP-Seq data.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>1/16 inch tapered microtip</td>
			<td>Qsonica</td>
			<td>4417</td>
			<td>This microtip is compatible with Sonicator 3000 from Misonix and Q500/700 from Qsonica.</td>
		</tr>
		<tr>
			<td>8 ml glass sample vial with cap</td>
			<td>Wheaton</td>
			<td>224884</td>
			<td>8 ml clear glass sample vials for aqueous samples with 15-425 size phenolic rubber-lined screw caps.</td>
		</tr>
		<tr>
			<td>Adaptor</td>
			<td>IDT or Sigma</td>
			<td>NA</td>
			<td>TruSeq universal adaptor, 
AATGATACGGCGACCACCGAG 
ATCTACACTCTTTCCCTACAC 
GACGCTCTTCCGATC*T. TruSeq indexed adaptor, 
P-GATCGGAAGAGCACACGTC 
TGAACTCCAGTCAC &#8208;NNNNNN&#8208; 
ATCTCGTATGCCGTCT TCTGCTT*G. *, phosphorothioate bondphosphate group at 5&#39; end. NNNNNN, index (see TruSeq ChIP Sample Preparation Guide for DNA sequence). Order adaptors HPLC purified. Adaptors can be prepared by combining equimolar amounts (each 100 &#181;M) of the universal and the indexed adaptor and cooling them down slowly from 95 &#176;C to room temperature. Use 1.5 pmol per ng of input DNA. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>b2g4pipe (software)</td>
			<td>Blast2GO</td>
			<td>non-commercial</td>
			<td>http://www.blast2go.com/data/blast2go/b2g4pipe_v2.5.zip</td>
		</tr>
		<tr>
			<td>BLAST+ (software)</td>
			<td>Camacho et al.</td>
			<td>non-commercial</td>
			<td>http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&#38;DOC_TYPE=Download</td>
		</tr>
		<tr>
			<td>Bowtie (software)</td>
			<td>Langmead et al.</td>
			<td>non-commercial</td>
			<td>http://bowtie-bio.sourceforge.net/index.shtml</td>
		</tr>
		<tr>
			<td>cisFinder (software)</td>
			<td>Sharov et al.</td>
			<td>non-commercial</td>
			<td>http://lgsun.grc.nia.nih.gov/CisFinder/</td>
		</tr>
		<tr>
			<td>Chip for capillary electrophoresis</td>
			<td>Agilent Technologies</td>
			<td>5067-1504</td>
			<td>Load this chip with 1 &#181;l DNA for library quality control. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Chip-based capillary electrophoresis system</td>
			<td>Agilent Technologies</td>
			<td>G2940CA</td>
			<td>The Agilent 2100 BioAnalyzer is used to check the quality of ChIP-Seq libraries. Keep reagents at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>ChIP-Seq library preparation kit (KAPA Hyper Prep Kit)</td>
			<td>Kapa Biosystems</td>
			<td>KK8504</td>
			<td>Kit contains KAPA end repair and A-tailing enzyme mix, end Repair and A-tailing buffer, DNA ligase, ligation buffer, KAPA HiFi HotStart ReadyMix (2X), and KAPA library amplification primer mix (10X) (see also PCR primers). Adaptors are not included. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>ChIP-Seq library preparation kit (alternative, ThruPLEX-FD Prep Kit)</td>
			<td>Rubicon Genomics</td>
			<td>R40048</td>
			<td>Kit uses their own stem-loop adaptors and primers. This kit eliminates intermediate purification steps and is as sensitive as the KAPA Hyper Prep Kit. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Cluster3 (software)</td>
			<td>de Hoon et al.</td>
			<td>non-commercial</td>
			<td>http://bonsai.hgc.jp/~mdehoon/software/cluster</td>
		</tr>
		<tr>
			<td>FastQC (software)</td>
			<td>Simon Andrews</td>
			<td>non-commercial</td>
			<td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc</td>
		</tr>
		<tr>
			<td>Fluorometer</td>
			<td>life technologies</td>
			<td>Q32866</td>
			<td>Qubit 2.0 Fluorometer</td>
		</tr>
		<tr>
			<td>Fluorometer reagents</td>
			<td>life technologies</td>
			<td>Q32851</td>
			<td>The kit provides concentrated assay reagent, dilution buffer, and pre-diluted DNA standards for the Qubit fluorometer. Store DNA standards at 4 &#176;C, buffer and dye at room temperature.</td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Sigma</td>
			<td>F8775-4X25ML</td>
			<td>Formaldehyde solution, for molecular biology, 36.5-38% in H2O, stabilised with 10-15% methanol. Store at room temperature. CAUTION: Formaldehyde is corrosive and highly toxic.</td>
		</tr>
		<tr>
			<td>Gel (E-Gel EX agarose , 2%)</td>
			<td>life technologies</td>
			<td>G4010</td>
			<td>Pre-cast gel with 11 wells, openable format. Leave one lane between ladder and library empty to avoid cross-contamination. Store gels at room temperature.</td>
		</tr>
		<tr>
			<td>Gel electrophoresis system</td>
			<td>life technologies</td>
			<td>G6465</td>
			<td>E-Gel iBase and E-Gel Safe Imager combo kit for size-selecting ChIP-Seq libraries.</td>
		</tr>
		<tr>
			<td>Gel extraction kit</td>
			<td>Qiagen</td>
			<td>28706</td>
			<td>Store all reagents at room temperature. Use 500 &#181;l of QG buffer per 100 mg of 2% agarose gel slice to extract DNA. Use MinElute columns (from MinElute PCR purification kit) to elute DNA twice.</td>
		</tr>
		<tr>
			<td>HOMER (software)</td>
			<td>Chris Benner</td>
			<td>non-commercial</td>
			<td>http://homer.salk.edu/homer/index.html</td>
		</tr>
		<tr>
			<td>Hybridization oven</td>
			<td>Techne</td>
			<td>FHB1D</td>
			<td>Hybridizer HB-1D</td>
		</tr>
		<tr>
			<td>IGV (software)</td>
			<td>Robinson et al.</td>
			<td>non-commercial</td>
			<td>http://www.broadinstitute.org/igv/home</td>
		</tr>
		<tr>
			<td>Illumina CASAVA-1.8 quality filter (software)</td>
			<td>Assaf Gordon</td>
			<td>non-commercial</td>
			<td>http://cancan.cshl.edu/labmembers/gordon/fastq_illumina_filter</td>
		</tr>
		<tr>
			<td>Java TreeView (software)</td>
			<td>Alok Saldanha</td>
			<td>non-commercial</td>
			<td>http://jtreeview.sourceforge.net</td>
		</tr>
		<tr>
			<td>Laboratory jack</td>
			<td>Edu-Lab</td>
			<td>CH0642</td>
			<td>This jack is used to elevate sample in sound enclosure for sonication.</td>
		</tr>
		<tr>
			<td>Ladder, 100 bp</td>
			<td>New England BioLabs</td>
			<td>N3231</td>
			<td>Keep 1x solution at room temperature. Store stock at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Ladder, 1 kb</td>
			<td>New England BioLabs</td>
			<td>N3232</td>
			<td>Keep 1x solution at room temperature. Store stock at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Low-retention 1.5-ml microcentrifuge tubes</td>
			<td>life technologies</td>
			<td>AM12450</td>
			<td>nonstick, RNase-free microfuge tubes, 1.5 ml</td>
		</tr>
		<tr>
			<td>MACS2 (software)</td>
			<td>Tao Liu</td>
			<td>non-commercial</td>
			<td>https://github.com/taoliu/MACS</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>11201D</td>
			<td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-mouse IgG covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>11203D</td>
			<td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-rabbit IgG covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>10001D</td>
			<td>These Dynabeads are superparamagnetic beads with recombinant protein A covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>10003D</td>
			<td>These Dynabeads are superparamagnetic beads with recombinant protein G covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>life technologies</td>
			<td>12321D</td>
			<td>DynaMag-2 magnet</td>
		</tr>
		<tr>
			<td>MEME</td>
			<td>Bailey et al.</td>
			<td>non-commercial</td>
			<td>http://meme.nbcr.net/meme/</td>
		</tr>
		<tr>
			<td>Na3VO4</td>
			<td>New England BioLabs</td>
			<td>P0758</td>
			<td>Sodium orthovanadate (100 mM) is a commonly used general inhibitor for protein phosphotyrosyl phosphatases. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>NaF</td>
			<td>New England BioLabs</td>
			<td>P0759</td>
			<td>Sodium fluoride (500 mM) is commonly used as general inhibitor of phosphoseryl and phosphothreonyl phosphatases. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>NGS machine</td>
			<td>Illumina</td>
			<td>SY-301-1301</td>
			<td>Genome Analyzer IIx</td>
		</tr>
		<tr>
			<td>NGS machine (high performance)</td>
			<td>Illumina</td>
			<td>SY-401-2501</td>
			<td>HiSeq</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2028</td>
			<td>Use as control for goat polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2025</td>
			<td>Use as control for mouse polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2027</td>
			<td>Use as control for rabbit polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Nucleic acid staining solution</td>
			<td>iNtRON</td>
			<td>21141</td>
			<td>Use RedSafe nucleic acid staining solution at 1:50,000. Store at room temperature.</td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Sigma</td>
			<td>O3756-25G</td>
			<td>1-Phenylazo-2-naphthol-6,8-disulfonic acid disodium salt. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>PCR primers</td>
			<td>e.g., IDT or Sigma</td>
			<td>NA</td>
			<td>Primers to enrich adaptor-ligated DNA fragments by PCR: AATGATACGGCGACCACCGA*G and CAAGCAGAAGACGGCATACGA*G, phosphorothioate bond. Primers designed by Ethan Ford. Combine primers at 5 &#181;M each. Use 5 &#181;l in a 50 &#181;l PCR reaction. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>MinElute PCR purification kit&#160;</td>
			<td>Qiagen</td>
			<td>28006</td>
			<td>for purification of ChIP-qPCR and shearing test samples. Store MinElute spin columns at 4 &#176;C, all other buffers and collection tubes at room temperature.</td>
		</tr>
		<tr>
			<td>Phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.9)</td>
			<td>life technologies</td>
			<td>AM9730</td>
			<td>Phenol:Chloroform:IAA (25:24:1) is premixed and supplied at pH 6.6. Use provided Tris alkaline buffer to raise pH to 7.9. Store at 4 &#176;C. CAUTION: phenol:chloroform:isoamyl alcohol is corrosive, highly toxic and combustible.</td>
		</tr>
		<tr>
			<td>Primer3 (software)</td>
			<td>Steve Rozen &#38; Helen Skaletsky</td>
			<td>non-commercial</td>
			<td>http://biotools.umassmed.edu/bioapps/primer3_www.cgi</td>
		</tr>
		<tr>
			<td>Protease inhibitor tablets</td>
			<td>Roche</td>
			<td>11836170001</td>
			<td>cOmplete, Mini, EDTA-free. Use 1 tablet per 10 ml. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Protease inhibitor tablets</td>
			<td>Roche</td>
			<td>11873580001</td>
			<td>cOmplete, EDTA-free. Use 1 tablet per 50 ml. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>life technologies</td>
			<td>AM2548</td>
			<td>proteinase K solution (20 &#181;g/&#181;l). Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>life technologies</td>
			<td>12091-039</td>
			<td>RNase A (20 &#181;g/&#181;l). Store at room temperature.</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Stuart</td>
			<td>SB3</td>
			<td>Rotator SB3</td>
		</tr>
		<tr>
			<td>SAMtools (software)</td>
			<td>Li et al.</td>
			<td>non-commercial</td>
			<td>http://samtools.sourceforge.neta</td>
		</tr>
		<tr>
			<td>Solid phase reversible immobilisation beads</td>
			<td>Beckman Coulter</td>
			<td>A63882</td>
			<td>The Agencourt AMPure XP beads are used to minimise adaptor dimer contamination in ChIP-Seq libraries. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Sonicator 3000</td>
			<td>Misonix/Qsonica</td>
			<td>NA</td>
			<td>Newer models are now available. Q125, Q500 or Q700 are all suitable for shearing crosslinked chromatin.</td>
		</tr>
		<tr>
			<td>Sound enclosure</td>
			<td>Misonix/Qsonica</td>
			<td>NA</td>
			<td>optional: follow the manufacturer&#39;s recommendation to obtain the correct sound enclosure.</td>
		</tr>
		<tr>
			<td>Thermomixer</td>
			<td>eppendorf</td>
			<td>22670000</td>
			<td>Thermomixer for 24 x 1.5 mL tubes. Precise temperature control from 4 &#176;C above room temperature to 99 &#176;C.</td>
		</tr>
	</tbody>
</table>

genome-wide snapshot of chromatin regulators and states in xenopus embryos by chip-seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and organ formation during development. Determining the locations and levels of such chromatin features in vivo will provide valuable information about the spatio-temporal regulation of genomic elements, and will support aspirations to mimic embryonic tissue development in vitro. The most commonly used method for genome-wide and high-resolution profiling is chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq). This protocol outlines how yolk-rich embryos such as those of the frog Xenopus can be processed for ChIP-Seq experiments, and it offers simple command lines for post-sequencing analysis. Because of the high efficiency with which the protocol extracts nuclei from formaldehyde-fixed tissue, the method allows easy upscaling to obtain enough ChIP material for genome-wide profiling. Our protocol has been used successfully to map various DNA-binding proteins such as transcription factors, signaling mediators, components of the transcription machinery, chromatin modifiers and post-translational histone modifications, and for this to be done at various stages of embryogenesis. Lastly, this protocol should be widely applicable to other model and non-model organisms as more and more genome assemblies become available.

Gleichwertige Ergebnisse liefern wie die hier vorgestellt werden erwartet, wenn das Protokoll wird gut ausgeführt und der Antikörper verwendet wird von ChIP-Grade-Qualität (siehe Diskussion). Dieses Protokoll ermöglicht die Gewinnung von Zellkernen aus Formaldehyd fixierten Xenopus-Embryonen und die effiziente Scher Chromatin durch Beschallung (1A-C). Geschert Chromatin zeigt eine asymmetrische Verteilung von DNA-Fragmenten vor allem im Bereich von 100 bis 1.000 bp und Peaking zwischen 300 und 500 bp (Abbildung 1C). Eine minimale 50 pg von immunpräzipitierten DNA wird benötigt, um erfolgreich zu machen eine indizierte Paired-End ChIP-Seq-Bibliothek mit ähnlich großen DNA-Inserts (Abbildung 2A). Die Bibliothek sollte weitgehend frei von Dimeren Adapter, die auf dem Elektropherogramm bei etwa 120 bp gesehen werden kann. Nach Sequenzierung-durch-Synthese, vorverarbeitet Lesewerte werden in das Genom (Abbildung 2B, C) ​​abgebildet. In einem erfolgreichen Versuch mit <em&gt; X. tropicalis Embryonen liest von 40 bp in der Regel 50 bis 70% der Einendmaschine eindeutig zum Genom Zusammenbau v7.1 mit maximal zwei Fehlpaarungen zugeordnet werden. Während einliest auszurichten ziemlich gleichmßig über das Genom, die Ausrichtung des Chips liest ergibt strangspezifische Anreicherung, die die Chromatinstruktur Merkmal von Interesse flankieren. Dies ist, da alle Fragmente werden von dem 5&#39;-Ende (2C) 25 sequenziert. Die Ausweitung der Ausrichtung in Leserichtung zu einer durchschnittlichen Fragmentgröße ermöglicht exakte Profile für einzelne Chromatin Funktionen wie Transkriptionsfaktor-Bindungsereignisse. Diese DNA-Belegungen erscheinen als Peaks, wenn in IGV oder einem anderen kompatiblen Genom-Browser visualisiert. Peak Anrufern wie MACs verwendet, um den Ort dieser Peaks (3A) zu bestimmen. Auf diese Weise Zehntausende von Bindungsstellen wurden in der X. bestimmt tropicalis-Genoms für die T-Box-Transkriptionsfaktoren wie VEGT 26. ChIP-qPCR Erfahgen sollte die lokale Anreicherung von ChIP-Seq (3B) gefunden zu bestätigen. ChIP-Seq-Experimente erlauben die Erkundung genomweiten Eigenschaften von Chromatin-Funktionen. Beispielsweise kann die Berechnung der Lese- Verteilung über genomischen Elemente wie Transkriptionsstart und Terminationsstellen keine räumliche Bindungspräferenzen rund Gene (3C) zu markieren. Ebenso ist eine Heatmap der Lese Distributionen zu Stoßstellen wird verwendet, um verschiedene Chromatin Features auf einen genomweiten Skala (3D) zu vergleichen. Bestimmte Transkriptionsfaktoren binden DNA sequenzspezifisch. De novo-Motiv-Analyse der genomischen DNA zugrunde liegenden Peaks können diese Art von Informationen, einschließlich Co-angereicherten Motive potentieller Kofaktoren (3E) abzurufen. Die große Mehrheit der Zielgene zeigen DNA-Belegung zu einem niedrigeren und nicht höhere Ebene (3F). Diese Skala freie Funktion scheint recht häufig bei transcription Faktoren und schlägt vor, daß nur ein kleiner Bruchteil der Zielgene sind direkt mit biologischer Relevanz 27,28 geregelt. Die Analyse der angereicherten GO Begriffe oder andere Eigenschaften wie beispielsweise die differentielle Expression von Zielgenen können ferner offenbaren Einblicke in die biologische Funktion des Chromatins Funktion im Xenopus Embryo (Figur 3G). <img alt="Figur 1" src="/files/ftp_upload/52535/52535fig1highres.jpg" /> Abbildung 1. Chromatin Immunopräzipitation Verfahren für Xenopus-Embryonen. (A) Die Embryonen sind Formaldehyd fixierten in der Entwicklungsphase von Interesse kovalent binden (vernetzen) alle Proteine ​​mit genomischer DNA assoziiert. Bei der Kerngewinnung (B), wird vernetzt Chromatin fragmentiert, um gezieltere genomischen DNA-Bindung oder Chromatinmodifizierung Websites durch Minimierung der flankierenden DNEine Sequenz (C). Anschließend werden die Chromatin-Fragmente mit einem Chip-Grade-Antikörper immunpräzipitiert zu denen, die das Epitop von Interesse (D) anzureichern. Die co-immunpräzipitiert DNA wird das Protein ausgezogen und vor dem Erstellen der ChIP Fragmentbibliothek für NGS (Abbildung 2) gereinigt (E). <a href="https://www.jove.com/files/ftp_upload/52535/52535fig1large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.</a> <img alt="Abbildung 2" src="/files/ftp_upload/52535/52535fig2highres.jpg" /> Abbildung 2. ChIP-Seq Bibliothek Vorbereitung, Sequenzierung-durch-Synthese, die Kartierung und Spitzen Berufung. (A) Das Elektropherogramm zeigt eine gute ChIP-Seq-Bibliothek mit DNA-Matrizen von 250 bis 450 bp. Diese Vorlagen beinhalten die DNA-Insert von Interesse durch die universelle (58 bp) flankiert und die indexierte (63 bp) Adapter. (B) </strong&gt; Millionen von Clustern, wobei jeder Cluster mit identischen Vorlagen sind sequenziert Base für Base in Gegenwart von allen vier Nukleotiden besitzen, reversible, deutliche Fluorophor und identische Kündigungs Eigenschaften. Fluoreszenzbilder werden in Echtzeit verarbeitet werden, um entsprechenden Basen, die letztlich zusammengebaut in liest nennen. (C) nur liest, dass Karte eindeutig dem Xenopus Genom aufbewahrt. Da alle Fragmente werden von dem 5&#39;-Ende sequenziert, zur Kartierung der ChIP liest ergibt strangspezifischen Peaks, die die Chromatinstruktur Merkmal von Interesse flankieren. Dabei Spitzen Anrufer erkennen die Bereicherung durch die Immunpräzipitation stammt und erweitern das heißt zu einer durchschnittlichen Fragmentlänge genau zu lokalisieren Chromatin Funktionen. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig2large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.</a> <img alt = &quot;3&quot; src = &quot;/ files / ftp_upload / 52.535 / 52535fig3highres.jpg&quot; /&gt; Figur 3 Ein Beispiel einer Post Sequenzierung Analyse und Visualisierung von Daten mittels des zygotischen T-Box-Transkriptionsfaktor VEGT (zVegT). Alle Lesezählungen hier dargestellt sind normalisiert auf 10 Millionen eindeutig abgebildet und nichtredundanten liest. (A) Auszug der genomweiten Profil zVegT verbindlich in X. tropicalis Gastrula Embryos (Stadium 11 bis 12,5 nach Nieuwkoop und Faber 29). Jeder Peak, eine Anhäufung von erweiterten liest, stellt eine Bindungsstelle. Diese Spitzen sind durch MACS2 mit einem falschen Discovery Rate (FDR) von weniger als 1% genannt. Jeder MESP-Gens zeigt sehr proximalen und stromauf zVegT Bindung, sondern nur mespa und mespb durch diese Stufe (RNA-Seq-Daten 30) ausgedrückt. (B) DNA Belegungsniveaus zVegT durch ChIP-qPCR an verschiedenen Loci bestimmt (einschließlich eines nicht -gebundenen Region 0,5 kb stromaufwärts von β-Aktin) Konfirm die spezifische Anreicherung von ChIP-Seq gefunden. Ergebnisse für mespa mit Peak genannt (roter Balken) in (A) vergleichen. Die DNA Belegungspegel als Prozentsatz der Eingang für beide, den Chip mit der VEGT Antikörper (polyklonaler Kaninchen-IgG-Isotyp) und dem Chip mit dem Antikörper-Kontrolle (normales Kaninchen IgG) visualisiert. Fehlerbalken geben die Standardabweichung von zwei biologischen Replikaten. (C) METAGENE Analyse zeigt Präferenz zVegT Bindung (Tags über 25 bp klassierten) mit dem Promotor in Bezug auf jede andere Genombereich um und in Gen Körpern. (D) Bewegungsradius zeigt k-Mittelwert Cluster (k = 5) DNA Auslastung der zVegT und Smad2 / Smad3 (ChIP-Seq Daten 31) bezogen auf alle zVegT gebundenen Regionen Gastrulastadium (Tags über 25 bp klassierte). Die Heatmap ist log 2 basiert und bei 5 Tags pro bp zentriert. (E) De-novo-Motiv-Analyse entdeckt die kanonische T-Box-Transkriptionsfaktor-Bindungsmotiv in 38% der zVegT-Regionen gebunden, wenn die zugrunde liegende Motiv Wertung ist auf einer Entdeckungsrate von 5% im Hintergrund Sequenzen. Die Dichte Karte zeigt höchsten Anreicherung für den T-Box-Motiv in der Mitte zVegT Bindungsstellen, wobei die kanonische Smad2 / Smad3 Bindungsmotiv kaum angereichert. (F) Histogramm zeigt DNA Belegungsniveaus zVegT, die für jedes Ziel-Gen berechnet werden von allen Gipfeln (+/- 200 bp) zwischen 5 kb stromaufwärts [-]. und 1 kb stromabwärts [+] der entsprechenden Transkriptionsstartstellen (G) Top 300 Gene, die mit höchsten DNA-Auslastung innerhalb -5 kb und 1 kb sind für biologische Prozesse der frühen Embryonalentwicklung bereichert. Diese GO Begriffe sind im Einklang mit der vermeintlichen Funktion zVegT. Der FDR auf einem zweiseitigen Fisher-Test basiert und für multiples Testen korrigiert. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig3large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.</a>

Watch this Scientific Journal Video about Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq at JoVE.com

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

Die Frage, wie Chromatin Regulierungsbehörden und Chromatin-Staaten betreffen das Genom in vivo ist der Schlüssel zum Verständnis, wie frühe Zellschicksal Entscheidungen werden in den sich entwickelnden Embryo gemacht. ChIP-Seq-die beliebteste Ansatz zur Chromatin Funktionen auf globaler Ebene, wird hier für Xenopus Embryonen beschrieben untersuchen.

Genomweite Snapshot von Chromatin Regulierungsbehörden und Staaten in<em&gt; Xenopus</em&gt; Embryonen von ChIP-Seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and ...

genome-wide-snapshot-chromatin-regulators-states-xenopus-embryos-chip

Research

JoVE Journal

Developmental Biology

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

12.1K Aufrufe.  MRC National Institute for Medical Research.  Die Frage, wie Chromatin Regulierungsbehörden und Chromatin-Staaten betreffen das Genom in vivo ist der Schlüssel zum Verständnis, wie frühe Zellschicksal Entscheidungen werden in den sich entwickelnden Embryo gemacht. ChIP-Seq-die beliebteste Ansatz zur Chromatin Funktionen auf globaler Ebene, wird hier für Xenopus Embryonen beschrieben untersuchen. 

Serie: Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

Amphibian eggs have been widely used to study embryonic development. Early embryonic development is driven by maternally stored factors accumulated during oogenesis. In order to study roles of such maternal factors in early embryonic development, it is desirable to manipulate their functions from the very beginning of embryonic development. Conventional ways of gene interference are achieved by injection of antisense oligonucleotides (oligos) or mRNA into fertilized eggs, enabling under- or over-expression of specific proteins, respectively. However, these methods normally require more than several hours until protein expression is affected, and, hence, the interference of gene functions is not effective during early embryonic stages. Here, we introduce an experimental system in which expression levels of maternal proteins can be altered before fertilization. Xenopus laevis oocytes obtained from ovaries are defolliculated by incubating with enzymes. Antisense oligos or mRNAs are injected into defolliculated oocytes at the germinal vesicle (GV) stage. These oocytes are in vitro matured to eggs at the metaphase II (MII) stage, followed by intracytoplasmic sperm injection (ICSI). By this way, up to 10% of ICSI embryos can reach the swimming tadpole stage, thus allowing functional tests of specific gene knockdown or overexpression. This approach can be a useful way to study roles of maternally stored factors in early embryonic development.

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

We describe methods of manipulating Xenopus laevis immature oocytes, in vitro maturation of oocytes to eggs, and intracytoplasmic sperm injection. This protocol allows degradation of some maternal proteins and overexpression of genes of interest at fertilization, and hence is valuable to study roles of specific factors in early embryonic development.

Manipulation und<em&gt; In-vitro-</em&gt; Ausbau der<em&gt; Xenopus laevis</em&gt; Eizellen, von Intrazytoplasmatische Spermieninjektion gefolgt, um embryonale Entwicklungsstudie

Amphibian eggs have been widely used to study embryonic development. Early embryonic development is driven by maternally stored factors accumulated during ...

Forschung

Entwicklungsbiologie

Accurate and Phenol Free DNA Sexing of Day 30 Porcine Embryos by PCR

Research into prenatal programming in the pig has shown that the sex of the developing embryo or fetus can influence the developmental outcome. Therefore, the ability to determine an embryo&#39;s sex is necessary in many experiments particularly regarding early development. The present protocol demonstrates an inexpensive, rapid and non-toxic preparation of pig genomic DNA for use with PCR. Day 30 embryos must be humanely collected according to the guidelines established by Institutional Animal Policy and Welfare Committees for the present protocol. The preparation of the whole embryo for this PCR based sexing technique simply involves grinding the frozen embryo to a fine powder using a pre-chilled mortar and pestle. PCR-quality DNA is released from a small amount of embryo powder by applying a hot incubation in an alkaline lysis reagent. Next, the DNA solution is mixed with neutralization buffer and used directly for PCR. Two primer pairs are generated to detect specific sex determining region of the Y- chromosome (SRY) and ZFX region of the X- chromosome with high accuracy and specificity. The same protocol can be applied to other elongated embryos (Day 10 to Day 14) earlier than Day 30. Also, this protocol can be carried with 96-welled plates when screening a large number of embryos, making it feasible for automation and high-throughput sex typing.

This protocol describes an accurate, inexpensive, rapid and non-toxic method to determine the sex of Day 30 porcine embryo using PCR method after grinding an embryo into powder without phenol chloroform extraction and DNA column purification.

Präzise und Phenol Freie DNA Geschlechtsbestimmung von Tag 30 Schweineembryonen mittels PCR

Research into prenatal programming in the pig has shown that the sex of the developing embryo or fetus can influence the developmental outcome. Therefore, ...

Technique to Target Microinjection to the Developing Xenopus Kidney

The embryonic kidney of Xenopus&#160;laevis (frog), the pronephros, consists of a single nephron, and can be used as a model for kidney disease. Xenopus embryos are large, develop externally, and can be easily manipulated by microinjection or surgical procedures. In addition, fate maps have been established for early Xenopus embryos. Targeted microinjection into the individual blastomere that will eventually give rise to an organ or tissue of interest can be used to selectively overexpress or knock down gene expression within this restricted region, decreasing secondary effects in the rest of the developing embryo. In this protocol, we describe how to utilize established Xenopus fate maps to target the developing Xenopus kidney (the pronephros), through microinjection into specific blastomere of 4- and 8-cell embryos. Injection of lineage tracers allows verification of the specific targeting of the injection. After embryos have developed to stage 38 - 40, whole-mount immunostaining is used to visualize pronephric development, and the contribution by targeted cells to the pronephros can be assessed. The same technique can be adapted to target other tissue types in addition to the pronephros.

Technique to Target Microinjection to the Developing Xenopus Kidney

Here, we present a protocol to use fate maps and lineage tracers to target injections into individual blastomeres that give rise to the kidney of Xenopus laevis embryos.

Technik auf Zielmikroinjektions an die Entwicklungs<em&gt; Xenopus</em&gt; Kidney

The embryonic kidney of Xenopus&#160;laevis (frog), the pronephros, consists of a single nephron, and can be used as a model for kidney disease. Xenopus ...

Generation of Parabiotic Zebrafish Embryos by Surgical Fusion of Developing Blastulae

Surgical parabiosis of two animals of different genetic backgrounds creates a unique scenario to study cell-intrinsic versus cell-extrinsic roles for candidate genes of interest, migratory behaviors of cells, and secreted signals in distinct genetic settings. Because parabiotic animals share a common circulation, any blood or blood-borne factor from one animal will be exchanged with its partner and vice versa. Thus, cells and molecular factors derived from one genetic background can be studied in the context of a second genetic background. Parabiosis of adult mice has been &#160;used extensively to research aging, cancer, diabetes, obesity, and brain development. More recently, parabiosis of zebrafish embryos has been used to study the developmental biology of hematopoiesis. In contrast to mice, the transparent nature of zebrafish embryos permits the direct visualization of cells in the parabiotic context, making it a uniquely powerful method for investigating fundamental cellular and molecular mechanisms. The utility of this technique, however, is limited by a steep learning curve for generating the parabiotic zebrafish embryos. This protocol provides a step-by-step method on how to surgically fuse the blastulae of two zebrafish embryos of different genetic backgrounds to investigate the role of candidate genes of interest. In addition, the parabiotic zebrafish embryos are tolerant to heat shock, making temporal control of gene expression possible. This method does not require a sophisticated set-up and has broad applications for studying cell migration, fate specification, and differentiation in vivo during embryonic development.

This protocol provides step-by-step instruction on how to generate parabiotic zebrafish embryos of different genetic backgrounds. When combined with the unparalleled imaging capabilities of the zebrafish embryo, this method provides a uniquely powerful means to investigate cell-autonomous versus non-cell-autonomous functions for candidate genes of interest.

Die Erzeugung von Parabiotic Zebrabärbling Embryonen, die durch chirurgische Fusion der Entwicklung Blastulae

Surgical parabiosis of two animals of different genetic backgrounds creates a unique scenario to study cell-intrinsic versus cell-extrinsic roles for ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos. 
Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

Biosensing Motor Neuron Membran Potenzial in Live Zebrafisch Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Visualization and Quantitative Analysis of Embryonic Angiogenesis in Xenopus tropicalis

Blood vessels supply oxygen and nutrients throughout the body, and the formation of the vascular network is under tight developmental control. The efficient in vivo visualization of blood vessels and the reliable quantification of their complexity are key to understanding the biology and disease of the vascular network. Here, we provide a detailed method to visualize blood vessels with a commercially available fluorescent dye, human plasma acetylated low density lipoprotein DiI complex (DiI-AcLDL), and to quantify their complexity in Xenopus tropicalis. Blood vessels can be labeled by a simple injection of DiI-AcLDL into the beating heart of an embryo, and blood vessels in the entire embryo can be imaged in live or fixed embryos. Combined with gene perturbation by the targeted microinjection of nucleic acids and/or the bath application of pharmacological reagents, the roles of a gene or of a signaling pathway on vascular development can be investigated within one week without resorting to sophisticated genetically engineered animals. Because of the well-defined venous system of Xenopus and its stereotypic angiogenesis, the sprouting of pre-existing vessels, vessel complexity can be quantified efficiently after perturbation experiments. This relatively simple protocol should serve as an easily accessible tool in diverse fields of cardiovascular research.

Visualization and Quantitative Analysis of Embryonic Angiogenesis in Xenopus tropicalis

This protocol demonstrates a fluorescence-based method to visualize the vasculature and to quantify its complexity in Xenopus tropicalis. Blood vessels can be imaged minutes after the injection of a fluorescent dye into the beating heart of an embryo after genetic and/or pharmacological manipulations to study cardiovascular development in vivo.

Visualisierung und quantitative Analyse der embryonalen Angiogenese in<em&gt; Xenopus tropicalis</em

Blood vessels supply oxygen and nutrients throughout the body, and the formation of the vascular network is under tight developmental control. The ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and zebrafish embryos. Our system comprises a chamber featuring a simple setup that is nevertheless robust to induce and maintain a specific oxygen concentration and temperature in any experimental solution of choice. The presented system is very cost-effective but highly functional, it allows induction and sustainment of hypoxia for direct experiments in vivo and for various time periods up to 48 h.
To monitor and study the effects of hypoxia, we have employed two methods - measurement of levels of hypoxia-inducible factor 1alpha (HIF-1&#945;) in whole embryos or specific tissues and determination of retinal stem cell proliferation by 5-ethynyl-2&#8242;-deoxyuridine (EdU) incorporation into the DNA. HIF-1&#945; levels can serve as a general hypoxia marker in the whole embryo or tissue of choice, here embryonic retina. EdU incorporation into the proliferating cells of embryonic retina is a specific output of hypoxia induction. Thus, we have shown that hypoxic embryonic retinal progenitors decrease proliferation within 1 h of incubation under 5% oxygen of both frog and zebrafish embryos.
Once mastered, our setup can be employed for use with small aquatic model organisms, for direct in vivo experiments, any given time period and under normal, hypoxic or hyperoxic oxygen concentration or under any other given gas mixture.

We introduce a novel hypoxic chamber system for use with aquatic organisms such as frog and zebrafish embryos. Our system is simple, robust, cost-effective and allows the induction and sustainment of hypoxia in vivo and for up to 48 h. We present 2 reproducible methods to monitor the effectiveness of hypoxia.

Induktion von Hypoxie im lebenden Frosch und Zebrafisch Embryonen

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

CARIP-Seq and ChIP-Seq: Methods to Identify Chromatin-Associated RNAs and Protein-DNA Interactions in Embryonic Stem Cells

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, epigenetic regulators, and post-translation modifications of histones that combinatorially influence the gene expression state of nearby genes. RNA has also been shown to interact with various proteins to regulate chromatin dynamics&#160;and gene expression. Chromatin-associated RNA immunoprecipitation (CARIP) followed by next-generation sequencing (CARIP-Seq) is a novel method to survey RNAs associated with chromatin proteins, while chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq) is a powerful genomics technique to map the location of post-translational modification of histones, transcription factors, and epigenetic modifiers on a global-scale in ES cells. Here, we describe methods to perform CARIP-Seq and ChIP-Seq, including library construction for next-generation sequencing, to generate global chromatin-associated RNA and epigenomic maps in ES cells.

Here, we describe methods to perform ChIP-Seq and CARIP-Seq, including library preparation for next-generation sequencing, to generate global epigenomic and chromatin-associated RNA maps in ES cells.

CARIP-Seq und ChIP-Seq: Methoden zur Ermittlung von Chromatin-assoziierter RNA und Protein-DNA-Wechselwirkungen in embryonale Stammzellen

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is the formation of the transient organizers, the node and notochordal plate, from cells that have passed through the primitive streak. The proper formation of these signaling centers is essential for the development of the body plan and techniques to visualize them are of high interest to mouse developmental biologists. The node and notochordal plate lie on the ventral surface of gastrulating mouse embryos around embryonic day (E) 7.5 of development. The node is a cup-shaped structure whose cells possess a single slender cilium each. The proper subcellular localization and rotation of the cilia in the node pit determines left-right asymmetry. The notochordal plate cells also possess single cilia albeit shorter than those of the node cells. The notochordal plate forms the notochord which acts as an important signaling organizer for somitogenesis and neural patterning. Because the cells of the node and notochordal plate are transiently present on the surface and possess cilia, they can be visualized using scanning electron microscopy (SEM). Among other techniques used to visualize these structures at the cellular level is whole mount immunofluorescence (WMIF) using the antibodies against the proteins that are highly expressed in the node and notochordal plate. In this report, we describe our optimized protocols to perform SEM and WMIF of the node and notochordal plate in developing mouse embryos to help in the assessment of tissue shape and cellular organization in wild-type and gastrulation mutant embryos.

The node and notochordal plate are transient signaling organizers in developing mouse embryos that can be visualized using several techniques. Here, we describe in detail how to perform two of the techniques to study their structure and morphogenesis: 1) scanning electron microscopy (SEM); and 2) whole mount immunofluorescence (WMIF).

Visualisierung der Knoten und Notochordal Platte In Gastrulating Maus-Embryonen mittels Rasterelektronenmikroskopie und ganze Mount Immunfluoreszenz

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Microinjection of DNA into Eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

The primary visual projection of tadpoles of the aquatic frog Xenopus laevis serves as an excellent model system for studying mechanisms that regulate the development of neuronal connectivity. During establishment of the retino-tectal projection, optic axons extend from the eye and navigate through distinct regions of the brain to reach their target tissue, the optic tectum. Once optic axons enter the tectum, they elaborate terminal arbors that function to increase the number of synaptic connections they can make with target interneurons in the tectum. Here, we describe a method to express DNA encoding green fluorescent protein (GFP), and gain- and loss-of-function gene constructs, in optic neurons (retinal ganglion cells) in Xenopus embryos. We explain how to microinject a combined DNA/lipofection reagent into eyebuds of one day old embryos such that exogenous genes are expressed in single or small numbers of optic neurons. By tagging genes with GFP or co-injecting with a GFP plasmid, terminal axonal arbors of individual optic neurons with altered molecular signaling can be imaged directly in brains of intact, living Xenopus tadpoles several days later, and their morphology can be quantified. This protocol allows for determination of cell-autonomous molecular mechanisms that underlie the development of optic axon arborization in vivo.

Microinjection of DNA into Eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

This protocol aims to demonstrate how to microinject a DNA/DOTAP mixture into eyebuds of one day old Xenopus laevis embryos, and how to image and reconstruct individual green fluorescent protein (GFP) expressing optic axonal arbors in tectal midbrains of intact, living Xenopus tadpoles.

Mikroinjektion von DNA in Augenknospen in Xenopus laevis Embryonen und Bildgebung von GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

The primary visual projection of tadpoles of the aquatic frog Xenopus laevis serves as an excellent model system for studying mechanisms that regulate the ...