Die Autoren danken Gráinne Tierney für redaktionelle Unterstützung.

Das Protokoll folgt den Richtlinien des menschlichen Ethik-Forschungskommission IRST.
Hinweis: Dieses Verfahren ist speziell für die Erkennung von eine geringe Anzahl von cDNA-Moleküle im menschlichen Tiefkühlfrische Geweben entwickelt. Die Gewebeschnitte wurden auf Trockeneis, gekürzt, während noch gefroren, aus zuvor validierten Patienten abgeleitet Magen-Tumor oder normalen Gewebeproben.
(1) RNA Isolierung und Reinigung
<ol><li>
RNA-Extraktion Hinweis: RNA Isolierung erfolgt unter der Haube mit einem spezifischen Produkt (siehe Tabelle der Materialien). Jedoch eine Vielzahl von Isolierung Kits sind im Handel erhältlich.<ol>
<li>Homogenisieren Sie 50-100 mg von fein geschnittenen Tiefkühlfrische Gewebeprobe in einem 1,5 mL Röhrchen mit 1 mL RNA Isolierung Reagenz und Vortex energisch für 15 S. Inkubation der Rohre bei-80 ° C über Nacht.</li>
		<li>Inkubieren Sie das Rohr mit der Probe bei Raumtemperatur für 5 min und Mischung von vortexen für 15 s.</li>
		<li>Halten Sie das Rohr auf dem Eis, fügen Sie 200 µL Chloroform und kräftig vortexen 15 s.</li>
		<li>Inkubieren Sie die Rohre bei Raumtemperatur für 60 s und Zentrifuge bei 12.000 x g für 15 min bei 4 ° c</li>
		<li>Übertragen der wässrigen Phase in einem 1,5 mL Röhrchen und fügen Sie 20 µg von Glykogen. Hinweis: Es ist wichtig, sorgfältig zu vermeiden Übertragung der Interphase oder organischen Schicht um Kontamination zu reduzieren.</li>
		<li>Fügen Sie 500 µL Isopropanol, invertieren die Röhre zu mischen, und inkubieren Sie für 10 min auf Eis.</li>
		<li>Zentrifugieren Sie das Rohr auf 12.000 x g für 15 min bei 4 ° C, RNA auszufällen. Hinweis: RNA wird in eine Gel-artige Pellet auf der Seite und Boden des Röhrchens, oft unsichtbar nach Zentrifugation vorhanden sein.</li>
		<li>Entfernen Sie den Überstand ohne Störung des Niederschlags zu und waschen Sie ihn mit 1 mL 75 % Ethanol durch pipettieren.</li>
		<li>Das Rohr auf 7.500 x g für 5 min bei 4 ° C zentrifugiert und den Überstand zu entfernen, ohne zu stören das Pellet.</li>
		<li>Lassen Sie die Pellets trocknen, bis der Niederschlag transparent wird und in 50 µL RNase-freies Wasser auflösen.</li>
		<li>Die Proben bei-80 ° C vor der Quantifizierung mindestens über Nacht einfrieren.</li>
	</ol>
</li>
	<li>
Genomische DNA-Beseitigung und Reinigung der RNA Hinweis: Ein DNase Verdauung Schritt, gefolgt von einer spaltenbasierten RNA Läuterung, Analysen von niedrig-Fülle Ziele empfiehlt sich für um kontaminierende DNA zu verdauen.<ol>
<li>Lösen Sie die gefriergetrockneten DNase auf (1.500 Kunitz Einheiten) in 550 µL RNase-freies Wasser mit einer Spritze, Mischung sanft durch die Durchstechflasche umdrehen / unterteilen die rekonstituierte Stammlösung in Aliquote.</li>
		<li>In einer 1,5 mL Tube das berechnete Volumen der Probe mit 15 µg RNA übertragen, 10 µL der DNase Verdauung Puffer aus dem Kit (im Table of Materials), 2,5 µL DNase I-Stammlösung und RNase-freies Wasser zu 100 µL. Inkubation bei Raumtemperatur für 10 Minuten.</li>
		<li>Fügen Sie 350 µL Gewebe Lyse Puffer (aus dem Kit, siehe Tabelle of Materials) und Mischen von pipettieren.</li>
		<li>Fügen Sie 250 µL aus 100 % Ethanol und Mischung von pipettieren.</li>
		<li>Übertragen Sie das gesamte Volumen (700 µL) in einer neuen Spin-Spalte und Zentrifuge bei 12.000 x g für 15 s.</li>
		<li>Übertragen Sie den Filter in eine neue Kollektion-Röhre, die Spalte und die Zentrifuge bei 12.000 x g für 2 min fügen Sie 500 µL von 80 % Ethanol hinzu.</li>
		<li>Öffnen Sie den Deckel des Spin-Spalte und Zentrifuge bei 12.000 x g für 5 min mit einem neuen Sammlung Schlauch um den Filter zu trocknen; übertragen Sie dann den Filter auf eine 1,5 mL-Tube.</li>
		<li>Fügen Sie direkt auf die Filterspalte und Zentrifuge bei 12.000 x g für 1 min 14 µL RNase-freies Wasser.</li>
		<li>Die Proben auf Eis und fahren Sie mit Quantifizierung mit 2 µL der Probe auf einem Benchtop-Spektralphotometer oder speichern Sie, die RNA bei-80 ° C bis zur Verwendung.</li>
	</ol>
</li>
</ol>(2) cDNA Synthese
<ol><li>Statt 1.000 ng RNA, 4 µL des master-Mix, 1 µL Reverse Transkriptase und RNase-freies Wasser zu einem Endvolumen von 20 µL in ein steriles Röhrchen PCR. Vorsichtig mischen und spin-down.</li>
	<li>Inkubieren Sie die Reaktion-Mix in einem Thermocycler, die folgenden Bedingungen: 5 min bei 25 ° C, 30 min bei 42 ° C, 5 min bei 85 ° C.</li>
	<li>Zentrifugieren Sie die Rohre kurz und gehen Sie zum dPCR Analyse oder Lagerung bei-20 ° C bis benötigt.</li>
</ol>3. digitale PCR-Reaktion einrichten
<ol><li>
dPCR Reaktion mischen und Probenvorbereitung
	<ol>
<li>Tauen Sie den master-Mix und die Probe bei Raumtemperatur für mindestens 20 Minuten.</li>
		<li>Verdünnen Sie die cDNA-Proben zu einer Konzentration von 300 ng in 6 µL Wasser.</li>
		<li>Sanft Wirbel Master mischen und die Mischung in ein steriles Röhrchen mit 8,7 µL des master-Mix, 0,87 µL der CDH1a benutzerdefinierte gestaltete Assay Grundierung und 1,83 µL Nuklease-freies Wasser einem Endvolumen von 11,4 µL vorbereiten. Hinweis: CDH1a benutzerdefinierte gestaltete Assay Grundierung Details finden Sie in der Tabelle der Materialien.</li>
		<li>11.4 µL der vorbereiteten Mischung der verdünnten cDNA-Probe übertragen, vorsichtig mischen und kurz zentrifugieren. Hinweis: Bände enthalten 20 % Selbstbeteiligung Volumenverlust von Pipettieren zu kompensieren. Bereiten Sie die Mischung für alle Proben und einem keine Vorlage-Kontrolle (NTC).</li>
	</ol>
</li>
	<li>
Chip-Vorbereitung Hinweis: Für optimale Ergebnisse laden Sie die Chips so bald wie möglich.<ol>
<li>Der Chip-Lader stecken Sie ein und warten Sie, bis die Kontrolllampe grün leuchtet.</li>
		<li>Entfernen Sie die Kappe der Immersion Flüssigkeit Spritze durch den Kolben vorsichtig zurückziehen 1-2 mm und loslassen, um diesen Schritt zu erleichtern, und ersetzen Sie es mit einer Spitze.</li>
		<li>Nehmen Sie einen neuen Chip und notieren Sie den Code auf dem Deckel der Probe zuzuordnende geschrieben.</li>
		<li>Halten Sie den Deckel sorgfältig an ihrer Seite, ziehen Sie die Schutzfolie und legen Sie den Deckel mit dem klebrigen Gesicht nach oben in der richtigen Ausrichtung.</li>
		<li>Sorgfältig holen Sie einen Chip, kümmert sich nicht um den internen Teil berühren ab und laden Sie es auf die Chipnest in der richtigen Position durch herunterdrücken des Hebels um die Klemme zu öffnen.</li>
		<li>Laden Sie ein neues laden-Blatt auf den Loader zu und schieben Sie ihn sanft, um sicherzustellen, dass es fest im Ort ist.</li>
		<li>14.5 µL dPCR Reaktion Mischung auf die Beladung Klinge ohne Luftblasen zu übertragen oder Ablenkung die Klinge nach dem Drücken der schwarzes laden Schaltfläche, um die Lautstärke auf dem Chip zu verteilen.</li>
		<li>Verwenden Sie die Immersion Flüssigkeit Spritze ca. 20 Tropfen auf die Chipoberfläche kümmert sich nicht um die Oberfläche mit der Spitze berühren zu übertragen. Hinweis: Es ist wichtig, die gesamte Fläche zu decken, ohne zu verschütten Flüssigkeit über die Kanten.</li>
		<li>Drehen Sie den Lader Arm machen den Deckel kommen in Kontakt mit dem Chip und drücken Sie für 15 s.</li>
		<li>Taste die Deckel lassen Sie den Chip und den Arm in seine Position zurück.</li>
		<li>Den montierten Chip in einem Winkel von 45° zu halten und sorgfältig verzichten die Immersionflüssigkeit mit der Spritze durch die Einfüllöffnung, Drehen des Chips leicht um sicherzustellen, dass keine Luftblasen vorhanden sind und überschüssigen Flüssigkeit mit einem sterilen Tuch zu entfernen.</li>
		<li>Versiegeln den Chip-Fall sanft Peeling entfernt das Etikett auf dem Chip Deckel und Presse über die Einfüllöffnung für mindestens 5 s.</li>
		<li>Speichern Sie den Chip im Dunkeln erst unmittelbar in den Thermocycler zu laden. Hinweis: Vorbereitete Chips sollten innerhalb von 2 h eingesetzt werden.</li>
	</ol>
</li>
	<li>
dPCR Reaktion
	<ol>
<li>Öffnen Sie den Deckel und installieren Sie die Adapter für beide Blöcke zu, auch wenn ein einzelner Block verwendet wird.</li>
		<li>Legen Sie die Chips auf die probenblock in der richtigen Position. Hinweis: Die Einfüllöffnung muss auf der Vorderseite der Thermocycler in einer erhöhten Position um Luftblasen zu schweben nach oben zu ermöglichen, ohne zu stören das Fenster des Chips ausgerichtet werden. Verwenden Sie leere Chips, die beiden Blöcke auszugleichen.</li>
		<li>Legen Sie das Wärmeleitpad auf der probenblock vollständig bedecken die Chips.</li>
		<li>Schließen Sie den Deckel und starten Sie die PCR ausführen, die folgenden Bedingungen: halten Sie bei 96 ° C für 10 min; 45 Zyklen von 60 ° C für 2 min und 98 ° C für 30 s; halten Sie bei 60 ° C für 2 min; bei 4 ° c zu halten Schalten Sie den Thermocycler und tauen Sie die Chips bei Raumtemperatur mindestens 10 min lang. Hinweis: Chip-Analyse muss innerhalb einer Stunde durchgeführt werden.</li>
	</ol>
</li>
	<li>
Chip-Analyse
	<ol>
<li>Öffnen Sie den Deckel des Gerätes und entfernen Sie die Wärmeleitpads, dann entfernen Sie die Späne aus dem Adapter. Hinweis: Bewahren Sie die Chips in einer dunklen, saubere Lage bis zur Analyse.</li>
		<li>Reinigen Sie die Chipoberfläche mit Isopropanol und ein steriles Tuch. Hinweis: Untersuchen Sie jeder Chip auf Lecks oder potenzielle Probleme.</li>
		<li>Stecken Sie den USB in das Detektorsystem zum Speichern der Daten.</li>
		<li>Öffnen Sie die Spänewanne das Detektorsystem, laden Sie den Chip nach oben in die richtige Position und schließen Sie das Fach.</li>
		<li>Warten Sie 30 s für Verarbeitung, dann entfernen Sie den Chip und setzen Sie die nächsten ein.</li>
		<li>Warten Sie, bis die Analyse für die verarbeiteten Chips abgeschlossen sein, dann stecken den USB an einen Computer übertragen. Hinweis: Die Gesamtzeit für die Analyse ist etwa 2 bis 3 min/Chip.</li>
	</ol>
</li>
</ol>(4) Daten-Analyse und Interpretation
<ol><li>Schließen Sie an die Cloud-basierte Software-Plattform erforderlich, um alle nachgeschalteten Analysen durchführen.</li>
	<li>Erstellen Sie ein Projekt und importieren Sie alle Datendateien des Chips von Interesse.</li>
	<li>Geben Sie den Probennamen; Wählen Sie die Farbe und Assay verwendet im Register "Definieren Chips".</li>
	<li>Bestimmen Sie, ob der Chip ist durch die Visualisierung es im Reiter "Daten", überprüfen, wie gründlich die Probe auf den Chip geladen wurde und wie viele Datenpunkte auswertbar sind akzeptabel. Hinweis: Lehnen Sie Chips mit weniger als 13.000 auswertbaren Datenpunkte ab.</li>
	<li>Fahren Sie mit dem Streudiagramm des ausgewählten Chips auf der rechten Seite des Bildschirms; alle Chips eine Schwelle von 6.000 für die Fluorescein Amidite (FAM) Reporter Farbstoff Signale (Y-Achse) zuweisen. Hinweis: Die Schwelle richten Sie variieren aufgrund der Assays verwendet.</li>
	<li>Entfernen Sie keine dubiosen positive Signale zu falsch-positive Ergebnisse zu vermeiden, durch die Auswahl der relativen Stelle auf die Streuung plot mit dem Lasso-Werkzeug und drücken auf "unbestimmt". Alle verbleibenden positiven Punkte deuten auf das Vorhandensein von cDNA Exemplare des seltenen Ziels analysiert.</li>
</ol>

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

Die Autoren berichten keine Interessenkonflikte für diese Arbeit.

dPCR wurde ursprünglich entwickelt für DNA-molekulare Messungen10,11,12,13 und in der Zeit, die diese Technologie adaptiert wurde für die Quantifizierung von Micro-RNA und RNA Transkripte5, 14,15. In diesem Protokoll haben wir erweitert die Liste der Anwendungen zur Erkennung von seltenen Transkrip...

Das CDH1 -Gen kodiert für E-Cadherin, ein entscheidender Faktor bei der Aufrechterhaltung der normalen Magen Epithel durch die Regulierung der Zelle Adhäsion, überleben, Proliferation und Migration1beteiligt. Verlust von E-Cadherin-Protein durch schädliche Keimbahn oder somatischen Veränderungen des CDH1 wurde die Entwicklung von GC2,3zugeordnet. Nicht-kanonische Transkripte aus Intron 2 des Gens haben auch vermutet, um eine Rolle im Magen Karzinogenese4,5. Insbesondere eine solche Abschrift, CDH1a, hat gezeigt, dass im GC Zell-Linien ausgedrückt werden aber fehlt aus dem normalen Magen-4. Wir haben vor kurzem CDH1a in GC Gewebeproben von GC Patienten mittels Chip-basierte dPCR5festgestellt. dPCR wurde verwendet, um zum ersten Mal das Vorhandensein der CDH1a gen Abschrift im Darm GC und im Normalgewebe zu bewerten.
Die Gold-Standard-Methode zur Bestimmung der Genexpression ist real-time quantitative PCR (qPCR). Die resultierenden Daten können jedoch manchmal Variable und von schlechter Qualität, vor allem wenn das Ziel in der Probe ist gering. Diese Variabilität kann durch Verunreinigungen, die Polymeraseaktivität und Grundierung glühen, hemmen, führt zu unspezifischen Verstärkung und wettbewerbsfähige Seite Reaktionen6verursacht werden.
Obwohl die biochemischen Grundlagen der dPCR ähnlich denen der qPCR sind dPCR zeigt einige Vorteile, so dass für sehr genaue Messungen von genomischer DNA (gDNA) / ergänzende DNA (cDNA) Moleküle. In der Tat ist dPCR ein Endpunkt Reaktion, die stützt sich auf die kalibrierten Partitionierung einer Probe in Tausende von Brunnen, so dass jeder gut Null oder ein Einzelziel-Molekül enthält. Verstärkung dann tritt nur in den Vertiefungen, die mit einer Kopie des Ziels und wird durch ein Fluoreszenzsignal angezeigt. Die absolute Zahl der Zielmoleküle in der ursprünglichen Probe kann dann berechnet werden, bestimmen das Verhältnis von positiven zu total Partitionen mit binomischen Poisson Statistiken7.
Darüber hinaus die dPCR Technik eliminiert die Notwendigkeit für eine Standardkurve ausgeführt und somit die damit verbundenen Vorurteile und Variabilität, so dass für eine direkte Quantifizierung der Ziele8,9; Es liefert präzise und reproduzierbare Ergebnisse unabhängig von Verunreinigungen und Effizienz durch seine hohe Toleranz gegenüber Inhibitoren10; Es ist empfindlicher und spezifischer als qPCR und ist somit eine zuverlässige Methode zum Nachweis von seltenen Ziel. Schließlich die Aufteilung der Probe in mehrere Reaktionen reduziert den Wettbewerb mit Hintergrund-Moleküle und verbessert die Grenze der Zielerfassung, wodurch Verstärkung möglich und erleichtert die Erkennung von einzelnen Molekülen gDNA/cDNA6 . Die Erkennung und Quantifizierung von Nukleinsäuren durch Chip-basierte dPCR zunehmend zum Kopieren von Nummer Variante angewendet wurde, Quantifizierung von DNA-Fragmenten und Mutation analysiert11,12,13, angesichts der Präzision und geringen Material Eingang Anforderung der Methode. Darüber hinaus wurde vor kurzem dPCR in die Analyse der beiden Micro-RNAs14 und gen Transkripte5,15integriert.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

CDH1a, eine nicht-kanonischen Abschrift des CDH1 -Gens hat gefunden worden, um in einigen Zelllinien von Magenkrebs (GC) ausgedrückt werden, während er fehlt in normale Magenschleimhaut. Vor kurzem erkannt wir CDH1a Abschrift Variante in Tiefkühlfrische Tumorgewebe von Patienten mit GC erhalten. Der Ausdruck dieser Variante in Gewebeproben wurde von der Chip-basierten digitalen PCR (dPCR) Ansatz hier vorgestellten untersucht. dPCR bietet das Potential für eine präzise, robust und hochempfindlichen Messung von Nukleinsäuren und wird zunehmend für viele Anwendungen in verschiedenen Bereichen genutzt. dPCR ist in der Lage erkennen selten Ziele; Darüber hinaus bietet dPCR die Möglichkeit für absolute und präzise Quantifizierung von Nukleinsäuren ohne die Notwendigkeit für Kalibratoren und Standardkurven. In der Tat bereichert die Reaktion Partitionierung das Ziel aus dem Hintergrund, der Verstärkung Effizienz und Toleranz gegenüber Inhibitoren verbessert. Diese Eigenschaften machen dPCR ein optimales Tool für die Erkennung der CDH1a selten Abschrift.

Bei der hier vorgestellten Verfahren haben wir uns für den Ausdruck der seltenen Transkript Variante CDH1a im Magen Tiefkühlfrische Gewebe. Die Analyse von dPCR wurde auf 21 gepaart normalen und Krebszellen Gewebeproben und in 11 zusätzliche Tumorproben durchgeführt. CDH1a war in 15 von 32 (47 %) Tumoren nachweisbar, wobei keine normalen Gewebeproben die Anwesenheit von dieser seltenen Transkript5 zeigte. In unserer Analyse wurden Chips mit we...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Erkennung einer CDH1 selten Transkript Variante in Tiefkühlfrische Magenkrebs Geweben durch Chip-basierte digitale PCR

Das Manuskript beschreibt einen Chip-basierte digitale PCR-Assay zu erkennen, eine seltene CDH1 Transkript Variante (CDH1a) in Tiefkühlfrische normalen und Tumorgewebe von Patienten mit Magenkrebs erhalten.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

detection-cdh1-rare-transcript-variant-fresh-frozen-gastric-cancer

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

6.1K Aufrufe.  Istituto Scientifico Romagnolo per lo Studio e la Cura dei Tumori (IRST) IRCCS. Das Manuskript beschreibt einen Chip-basierte digitale PCR-Assay zu erkennen, eine seltene CDH1 Transkript Variante (CDH1a) in Tiefkühlfrische normalen und Tumorgewebe von Patienten mit Magenkrebs erhalten.

Serie: Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We developed an in vitro fully human preclinical model of a co-culture of breast cancer cells and monocytes undergoing differentiation towards osteoclasts. We optimized a model of osteoclastogenesis starting from a sample of peripheral blood collected from healthy donors. Peripheral blood mononuclear cells (PBMCs) were first separated by density gradient centrifugation, seeded at a high density and induced to differentiate by adding two growth factors (GFs): receptor activator of nuclear factor-&#954;B ligand (RANKL) and macrophage colony-stimulating factor (MCSF). The cells were left in culture for 14 days and then fixed and analyzed by downstream analysis. In osteolytic bone metastases, one of the effects of cancer cell arrival in bone is the induction of osteoclastogenesis. We thus challenged our model with co-cultures of breast cancer cells to study the differentiation power of cancer cells with respect to GFs. A straightforward way of studying cancer cell-osteoclast interaction is to perform indirect co-cultures based on the use of conditioned medium collected from breast cancer cell cultures and mixed with fresh medium. This mixture is then used to induce osteoclast differentiation. We also optimized a method of direct co-culture in which cancer cells and monocytes undergoing differentiation share the medium and exchange secreted factors. This is a significant improvement over the original indirect co-culture method as researchers can observe the reciprocal interactions of the two cell types and perform downstream analyses for both cancer cells and osteoclasts. This method enables us to study the effect of drugs on the metastatic bone microenvironment and to seed cell lines other than those derived from breast cancer. The model can also be used to study other diseases such as osteoporosis or other bone conditions.

This protocol describes development of an in vitro human preclinical model of osteoclastogenesis from peripheral blood monocytes cultured with breast cancer cell lines to mimic the cancer cell-osteoclast interaction. The model could be used to further our understanding of bone metastasis formation and improve therapeutic options.

Entwicklung eines menschlichen präklinischen Modell der Osteoclastogenesis aus peripherem Blut Monozyten Co mit Brustkrebszelllinien kultiviert

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

Forschung

Krebsforschung

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. However, the application of this method is challenging due to its low sensitivity in analyzing the trace amount of ctDNA in the blood. Furthermore, the method may generate false positive and negative results from this sequencing and subsequent analysis. To improve the feasibility and reliability of ctDNA detection in the clinic, here we present a technique which enriches rare mutations for sequencing, Enrich Rare Mutation Sequencing (ER-Seq). ER-Seq can distinguish a single mutation out of 1 x 107 wild-type nucleotides, which makes it a promising tool to detect extremely low frequency genetic alterations and thus will be very useful in studying disease heterogenicity. By virtue of the unique sequencing adapter&#39;s ligation, this method enables an efficient recovery of ctDNA molecules, while at the same time correcting for errors bidirectionally (sense and antisense). Our selection of 1021 kb probes enriches the measurement of target regions that cover over 95% of the tumor-related driver mutations in 12 tumors. This cost-effective and universal method enables a uniquely successful accumulation of genetic data. After efficiently filtering out background error, ER-seq can precisely detect rare mutations. Using a case study, we present a detailed protocol demonstrating probe design, library construction, and target DNA capture methodologies, while also including the data analysis workflow. The process to carry out this method typically takes 1-2 days.

This manuscript describes a technique for detecting mutations of low frequency in ctDNA, ER-Seq. This method is differentiated by its unique use of two-directional error correction, a special background filter, and efficient molecular acquirement.

Nachweis von seltenen Mutationen im CtDNA mit Next Generation Sequencing

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, and prediction of treatment resistance. Starting from the hypothesis that androgen receptor (AR) gene copy number (CN) gain is a frequent event in metastatic castration resistance prostate cancer (mCRPC), we propose to analyze this event in cfDNA as a potential predictive biomarker.
We evaluated AR CN in cfDNA using 2 different real-time PCR assays and 2 reference genes (RNaseP and AGO1). DNA amount of 60 ng was used for each assay combination. AR CN gain was confirmed using Digital PCR as a more accurate method. CN variation analysis has already been demonstrated to be informative for the prediction of treatment resistance in the setting of mCRPC, but it could be useful also for other purposes in different patient settings. CN analysis on cfDNA has several advantages: it is non-invasive, rapid and easy to perform, and it starts from a small volume of serum or plasma material.

This manuscript describes the copy number variation analysis performed in serum or plasma DNA using real-time PCR approach. This method is suitable for the prediction of drug resistance in castration resistant prostate cancer patients, but it could be informative also for other diseases.

Serum und Plasma Kopie Nummer Erkennung mittels Real-Time PCR

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and eosin (H&amp;E) staining but can be visualized through elastic staining. One of the important benefits of elastic staining is that it makes it easy to determine whether tumor cells have invaded beyond the elastic lamina. This helps in examining the extent of peritoneal surface invasion, thereby distinguishing the pT3 and pT4 stages in gastrointestinal cancer. In this study, we present a protocol to identify elastic fibers in the formalin-fixed, paraffin-embedded pT3N0M0 gastric cancer tissue sections. We prepare 5-&#181;m paraffin sections fixed on slides, and then all the slides are deparaffinated and rehydrated during the staining procedure. Subsequently, all the sections are oxidized by potassium permanganate, bleached by oxalic acid, stained by elastic staining, and counterstained by Van Gieson's. Finally, we examine the effect of staining; elastic lamina is stained blue-black and collagen fibers are stained red, while the cancer cells are stained in varying shades of yellow. We also describe in detail the methods used for determining the positional relationship between cancer cells and elastic lamina. This method is simple, low-cost, and widely applicable in the identification of peritoneal surface invasion in gastrointestinal cancer because of its outstanding selectivity for elastic fibers and authentic results.

Here, we present a protocol of elastic staining to identify elastic fibers in pT3N0M0 gastric cancer tissues on formalin-fixed, paraffin-embedded sections. Subsequently, we describe a method to determine whether tumor cells invade beyond the elastic lamina.

Elastische Färbung auf Paraffin-eingebetteten Dias von pT3N0M0 Magenkrebsgewebe

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image analysis. Digital scanning is a fast way to scan a stack of slides and produce digital images with high quality. It can produce concordant results with conventional light microscopy (CLM) by pathologists. Furthermore, the availability of digital images makes it possible that the same slide can be concurrently observed by multiple people. Moreover, digital images of slides can be stored in a database, which means the long-term deterioration of glass slides is avoided. The limitations of this technique are as follows. First, it needs high-quality prepared tissue and the original immunohistochemistry (IHC) slides without any damage or excess sealant residue. Second, tumor or nontumor areas should be specified by experienced pathologists before the analysis using software, in order to avoid any confusion about the tumor or nontumor areas during scoring. Third, the operator needs to control the color reproduction throughout the digitization process in whole-slide imaging.

ZW10 interacting protein (ZWINT) participates in the mitotic spindle checkpoint and the pathogenesis of carcinoma. Here, we introduce a methodology of the immunostaining of ZWINT in human lung cancer tissues, followed by the digital scanning of whole slides and image analysis. This methodology can provide high-quality digital images and reliable results.

Digitale Analyse der Immunostainierung von ZW10 Interacting Protein in menschlichen Lungengeweben

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using electrophoresis through a resolving gel embedded with a degradable substrate. This method differs from traditional gel zymography in that a quenched fluorogenic peptide is covalently incorporated into the resolving gel instead of full length proteins, such as gelatin or casein. Use of the fluorogenic peptides enables direct detection of proteolytic activity without additional staining steps. Enzymes within the biological samples cleave the quenched fluorogenic peptide, resulting in an increase in fluorescence. The fluorescent signal in the gels is then imaged with a standard fluorescent gel scanner and quantified using densitometry. The use of peptides as the degradable substrate greatly expands the possible proteases detectable with zymographic techniques.

Here, we present a detailed protocol for a modified zymographic technique in which fluorescent peptides are used as the degradable substrate in place of native proteins. Electrophoresis of biological samples in fluorescent peptide zymograms enables detection of a wider range of proteases than previous zymographic techniques.

Erkennung von Protease-Aktivität durch fluoreszierende Peptid Zymography

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. Although there are many established gastric cancer cell lines and many conventional transgenic mouse models for preclinical research, the disadvantages of these in vitro and in vivo models limit their applications. Because the characteristics of these models have changed in culture, they no longer model tumor heterogeneity, and their responses have not been able to predict responses in humans. Thus, alternative models that better represent tumor heterogeneity are being developed. Patient-derived xenograft (PDX) models preserve the histologic appearance of cancer cells, retain intratumoral heterogeneity, and better reflect the relevant human components of the tumor microenvironment. However, it usually takes 4-8 months to develop a PDX model, which is longer than the expected survival of many gastric patients. For this reason, establishing primary cancer cell lines may be an effective complementary method for drug response studies. The current protocol describes methods to establish PDX models and primary cancer cell lines from surgical gastric cancer samples. These methods provide a useful tool for drug development and cancer biology research.

The current protocol describes methods to establish patient-derived xenograft (PDX) models and primary cancer cell lines from surgical gastric cancer samples. The methods provide a useful tool for drug development and cancer biology research.

Etablierung von vom Magenkrebs abgeleiteten Xenograft-Modellen und Primärzelllinien

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so by a process called retrotransposition wherein they transcribe to form an mRNA intermediate which is then consequently inserted into the genome by reverse transcription. Despite being silent in normal cells, LINE-1s are highly active in different epithelial tumors. De novo LINE-1 insertions can potentially drive tumorigenesis, and hence it is important to systematically study LINE-1 retrotransposition in cancer. Out of ~150 retrotransposition-competent LINE-1s present in the human genome, only a handful of LINE-1 loci, also referred to as &#34;hot&#34; LINE-1s, account for the majority of de novo LINE-1 insertion in different cancer types. We have developed a simple polymerase chain reaction (PCR)-based method to monitor retrotransposition activity of these hot LINE-1s. This method, based on long-distance inverse (LDI)-PCR, takes advantage of 3&#180; transduction, a mechanism by which a LINE-1 mobilizes its flanking non-repetitive region, which can subsequently be used to identify de novo LINE-1 3&#180; transduction events stemming from a particular hot LINE-1.

This article outlines a simple PCR-based assay to monitor the activity of an active LINE-1 retrotransposon and to map de novo retrotranspositions in a given genome. Using the MCF7 cell line, we demonstrate herein how this method can be applied to detect activity of a LINE-1 located at 22q12.1.

Erkennung der Retrotranspositionsaktivität von Hot LINE-1s durch inverse Langstrecken-PCR

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic alterations in oncogenes such as the KRAS oncogene, which constitutes ~25% of lung cancer cases. The difficulty in therapeutically targeting KRAS-driven lung cancer partly stems from having poor models that can mimic the progression of the disease in the lab. We describe a method that permits the relative quantification of primary KRAS lung tumors in a Cre-inducible LSL-KRAS G12D mouse model via ultrasound imaging. This method relies on brightness (B)-mode acquisition of the lung parenchyma. Tumors that are initially formed in this model are visualized as B-lines and can be quantified by counting the number of B-lines present in the acquired images. These would represent the relative tumor number formed on the surface of the mouse lung. As the formed tumors develop with time, they are perceived as deep clefts within the lung parenchyma. Since the circumference of the formed tumor is well-defined, calculating the relative tumor volume is achieved by measuring the length and width of the tumor and applying them in the formula used for tumor caliper measurements. Ultrasound imaging is a non-invasive, fast and user-friendly technique that is often used for tumor quantifications in mice. Although artifacts may appear when obtaining ultrasound images, it has been shown that this imaging technique is more advantageous for tumor quantifications in mice compared to other imaging techniques such as computed tomography (CT) imaging and bioluminescence imaging (BLI). Researchers can investigate novel therapeutic targets using this technique by comparing lung tumor initiation and progression between different groups of mice.

This protocol describes the steps taken to induce KRAS lung tumors in mice as well as the quantification of formed tumors by ultrasound imaging. Small tumors are visualized in early timepoints as B-lines. At later timepoints, relative tumor volume measurements are achieved by the measurement tool in the ultrasound software.

Nachweis der Lungentumorprogression bei Mäusen durch Ultraschall-Bildgebung

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...

Pathological Analysis of Lung Metastasis Following Lateral Tail-Vein Injection of Tumor Cells

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous metastasis models are available. Thus, the experimental metastasis model involving tail-vein injection of suitable cell lines is a mainstay of metastasis research. When cancer cells are injected into the lateral tail-vein, the lung is their preferred site of colonization. A potential limitation of this technique is the accurate quantification of the metastatic lung tumor burden. While some investigators count macrometastases of a pre-defined size and/or include micrometastases following sectioning of tissue, others determine the area of metastatic lesions relative to normal tissue area. Both of these quantification methods can be exceedingly difficult when the metastatic burden is high. Herein, we demonstrate an intravenous injection model of lung metastasis followed by an advanced method for quantifying metastatic tumor burden using image analysis software. This process allows for investigation of multiple end-point parameters, including average metastasis size, total number of metastases, and total metastasis area, to provide a comprehensive analysis. Furthermore, this method has been reviewed by a veterinary pathologist board-certified by the American College of Veterinary Pathologists (SEK) to ensure accuracy.

Intravenous injection of cancer cells is often used in metastasis research, but the metastatic tumor burden can be difficult to analyze. Herein, we demonstrate a tail-vein injection model of metastasis and include a novel approach to analyze the resulting metastatic lung tumor burden.

Pathologische Analyse der Lungenmetastasierung nach lateraler Schwanzveneninjektion von Tumorzellen

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous ...