המחברים רוצים להודות Gráinne טירני לסיוע העריכה.

הפרוטוקול עוקב אחר הקווים המנחים של ועדת האתיקה IRST מחקר אנושי.
הערה: הליך זה היא תוכננה במיוחד עבור זיהוי מספר נמוך של cDNA מולקולות ברקמות אנושיות מוקפאות. הסעיפים רקמות צומצמו בקרח יבש, בעוד עדיין קפוא, הגידול המאומת בעבר נגזר החולה קיבה או דגימות רקמה נורמלית.
1. RNA בידוד וטיהור
<ol><li>
החילוץ-RNA הערה: בידוד RNA מתבצע מתחת למכסה המנוע באמצעות מוצר מסוים (ראה טבלה של חומרים). עם זאת, מגוון רחב של אלייזה זמינים מסחרית.<ol>
<li>Homogenize 50-100 מ"ג של דגימת הרקמות קפוא טרי חתוך דק צינור 1.5 מ עם 1 מ"ל של RNA בידוד ריאגנט ו מערבולת נמרצות עבור Incubate ס' 15 הצינורות ב-80 מעלות צלזיוס למשך הלילה.</li>
		<li>דגירה של שפופרת המכילה את הדגימה בטמפרטורת החדר במשך 5 דקות, מערבבים על-ידי vortexing עבור 15 s.</li>
		<li>לשמור את הצינורית על קרח, להוסיף 200 µL של כלורופורם, מערבולת נמרצות במשך 15 s.</li>
		<li>דגירה של הצינורות בטמפרטורת החדר במשך 60 s, צנטריפוגה ב 12,000 x g למשך 15 דקות ב 4 º C.</li>
		<li>להעביר את השלב מימית צינור 1.5 מ"ל ולהוסיף 20 µg של גליקוגן. הערה: חשוב להימנע בקפידה העברת לאטמוספרה או שכבה אורגני כדי לצמצם זיהום.</li>
		<li>להוסיף 500 µL של אלכוהול איזופרופיל, היפוך את הצינור כדי לערבב, דגירה על קרח למשך 10 דקות.</li>
		<li>Centrifuge את הצינור ב g x 12,000 למשך 15 דקות ב 4 ° C, כדי לזרז את ה-RNA. הערה: RNA יהיה נוכח גלולה דמוי ג'ל בצד ולמטה של הרכבת התחתית, לעתים קרובות בלתי נראה לאחר צנטריפוגה.</li>
		<li>הסר את תגובת שיקוע מבלי להפריע את התמיסה, לשטוף אותו עם 1 מ"ל של 75% אתנול על-ידי pipetting.</li>
		<li>Centrifuge את הצינור ב 7,500 g x עבור 5 דקות ב 4 ° C ולהסיר את תגובת שיקוע מבלי להפריע בגדר.</li>
		<li>תן בגדר יבש עד התמיסה הופכת לשקופה, לפזר זאת בתוך µL 50 RNase ללא מים.</li>
		<li>להקפיא את הדגימות ב-80 מעלות צלזיוס לפחות ללילה לפני כמת.</li>
	</ol>
</li>
	<li>
חיסול דנ א גנומי וטיהור RNA הערה: צעד עיכול DNase, ואחריו טיהור RNA מבוססי עמודה, מומלצת עבור ניתוחים של מטרות נמוך-שפע כדי לעכל דנ משחיתה.<ol>
<li>להמיס את DNase lyophilized אני (1,500 קוניץ יחידות) ב 550 µL של נטול RNase מים באמצעות מזרק, לערבב בעדינות על-ידי היפוך המבחנה, ולא לחלק את הפתרון מניות משוקם aliquots.</li>
		<li>העברת צינור 1.5 mL הנפח מחושב של הדגימה עם 15 µg של RNA µL 10 DNase העיכול מאגר הערכה (הרשומים בטבלה של חומרים), 2.5 µL של DNase אני הפתרון מניות, נטולת RNase למים ל 100 µL. Incubate בטמפרטורת החדר במשך 10 דקות.</li>
		<li>להוסיף 350 µL מאגר פירוק רקמת (הערכה, ראה טבלה של חומרים) על ידי pipetting.</li>
		<li>להוסיף 250 µL של 100% אתנול וביו -מיקס על ידי pipetting.</li>
		<li>להעביר את כל אמצעי האחסון (700 µL) לתוך עמודה חדשה ספין צנטריפוגה ב 12,000 x g 15 s.</li>
		<li>להעביר את המסנן לתוך צינור אוסף חדש, להוסיף 500 µL של 80% כוהל העמודה ואת צנטריפוגה ב 12,000 x g למשך 2 דקות.</li>
		<li>פותחים את המכסה של עמודה ספין, צנטריפוגה ב 12,000 x g עבור 5 דקות עם צינור אוסף חדש כדי לייבש את המסנן; ואז להעביר את המסנן צינור 1.5 מ.</li>
		<li>להוסיף µL 14 של מים נטולי RNase ישירות סינון העמודה ואילו צנטריפוגה ב 12,000 x g עבור 1 דקות.</li>
		<li>שומרים את הדגימות על הקרח להמשיך כימות באמצעות 2 µL של המדגם על ספקטרופוטומטרים ספסל-העליון או לאחסן את הרנ א ב-80 מעלות צלזיוס עד השימוש.</li>
	</ol>
</li>
</ol>2. cDNA סינתזה
<ol><li>במקום 1,000 ng של RNA, µL 4 של מיקס מאסטר, µL 1 של רוורס טרנסקריפטאז ומים ללא RNase לאמצעי הסופי של 20 µL בשפופרת PCR סטרילי. לערבב בעדינות, ספין למטה.</li>
	<li>דגירה המיקס התגובה ב הצנטרפוגה תרמי, החלת התנאים הבאים: 5 דקות 25 ° c, 30 דקות ב- 42 ° C, 5 דקות ב 85 מעלות צלזיוס.</li>
	<li>Centrifuge הצינורות בקצרה להמשיך dPCR ניתוח או לאחסן ב-20 ° C עד שהוא נדרש.</li>
</ol>3. PCR דיגיטלי תגובת להגדיר
<ol><li>
התגובה dPCR לערבב, לטעום הכנה
	<ol>
<li>להפשיר את תערובת הבסיס ואת וזמינותו בטמפרטורת החדר במשך לפחות 20 דקות.</li>
		<li>לדלל את דגימות cDNA ריכוז של 300 ng ב- 6 µL של מים.</li>
		<li>בעדינות מערבולת המאסטר לערבב, להכין את התמהיל בשפופרת סטרילי עם 8.7 µL של מיקס מאסטר, µL 0.87 של CDH1a assay מעוצב מותאם אישית ומהצמיגים 1.83 µL של מים נטולי נוקלאז נפח סופי של 11.4 µL. הערה: לקבלת CDH1a assay מעוצב מותאם אישית פריימר פרטים ראה את הטבלה של חומרים.</li>
		<li>µL 11.4 של המיקס מוכן להעביר הדגימה cDNA מדולל, מערבבים בעדינות, בקצרה צנטריפוגה. הערה: אמצעי אחסון כוללים 20% עודף כדי לפצות על אובדן נפח של pipetting. להכין את התערובת כל דוגמאות ופקד אין תבנית (NTC).</li>
	</ol>
</li>
	<li>
הכנת צ'יפס הערה: לקבלת תוצאות אופטימליות לטעון את האסימונים בהקדם האפשרי.<ol>
<li>הכנס מטעין שבב והמתן עד שנורית החיווי הופך לירוק.</li>
		<li>להסיר את הכובע של המזרק נוזלים טבילה על-ידי בעדינות למשוך בחזרה על הבוכנה 1-2 מ מ, משחררים אותו כדי להקל על שלב זה, ולהחליף אותו עם טיפ.</li>
		<li>שבב חדש ואין לרשום הקוד שנכתב על המכסה כדי לשייך אותה המדגם.</li>
		<li>להחזיק את המכסה בזהירות על ידי הצד שלו, הקילוף הסרט המגן ולמקם את המכסה עם הפנים נדבקים למעלה לכיוון הנכון.</li>
		<li>. ובזהירות לאסוף שבב, מטפל לא לגעת החלק הפנימי, להעמיס אותם על הקן שבב בתנוחה הנכונה על ידי לחיצה הידית כדי לפתוח את המלחציים</li>
		<li>לטעון להב הטעינה חדש לתוך מטעין ודחף אותו בעדינות כדי לוודא שהוא מחובר בחוזקה במקום.</li>
		<li>העברת µL 14.5 של המיקס תגובה dPCR על גבי הלהב הטעינה מבלי לבצע בועות אוויר הסחה הלהב, לאחר תודה השחור טעינת כפתור כדי להפיץ את עוצמת הקול על השבב.</li>
		<li>להשתמש במזרק נוזלים טבילה להעביר כ 20 טיפות על גבי משטח השבב מקפיד לא לעלות על פני השטח עם הקצה. הערה: חשוב לכסות את השטח כולו מבלי לשפוך נוזל פינות.</li>
		<li>לסובב את הזרוע מטעין כדי להפוך את המכסה לבוא במגע עם השבב ולחץ מטה עבור 15 s.</li>
		<li>לחץ על לחצן המכסה כדי לשחרר את השבב ולחזור הזרוע את מיקומו.</li>
		<li>להחזיק את השבב שהורכב בזווית של 45° בקפידה לוותר על הנוזל טבילה עם המזרק דרך היציאה מילוי, לסובב מעט את השבב, ודא כי קיימים אין בועות אוויר ו להסיר את כל הנוזלים העודפים עם מגבון סטרילי.</li>
		<li>לאטום את התיק שבב על ידי בעדינות פילינג משם את התווית על גבי שבב פנים העיתונות מעל הנמל למלא לפחות 5 s.</li>
		<li>לאחסן את השבב בחושך עד מוכן לטעון הצנטרפוגה תרמי. הערה: צ'יפס מוכן אמור לשמש בתוך שעתיים.</li>
	</ol>
</li>
	<li>
תגובה dPCR
	<ol>
<li>פותחים את המכסה, להתקין מתאמי של שני בלוקים, אפילו כאשר בלוק יחיד משמש.</li>
		<li>מניחים את הז'יטונים על הרחוב דגימה בתנוחה הנכונה. הערה: הנמל המילוי חייב להיות מכוון לכיוון החלק הקדמי של הצנטרפוגה תרמי במיקום גבוה כדי לאפשר בועות אוויר כדי לצוף למעלה מבלי להפריע את החלון של השבב. השתמש שבבי ריק כדי לאזן את שני רחובות.</li>
		<li>שכב משטח תרמי על הרחוב דגימה לכסות לגמרי את האסימונים.</li>
		<li>סגור את המכסה. ולהתחיל את PCR לרוץ, החלת התנאים הבאים: להחזיק ב 96 מעלות צלזיוס למשך 10 דקות; 45 מחזורים של 60 מעלות צלזיוס למשך 2 דקות ו- 98 ° C ל 30 s; להחזיק ב 60 מעלות צלזיוס למשך 2 דקות; . תחזיק על 4 מעלות צלזיוס. כבה הצנטרפוגה תרמי ואת להפשיר את האסימונים בטמפרטורת החדר במשך לפחות 10 דקות. הערה: ניתוח שבב חייב להתבצע בתוך שעה אחת.</li>
	</ol>
</li>
	<li>
ניתוח צ'יפ
	<ol>
<li>פתח את המכסה של הכלי, להסיר את רפידות תרמי ולאחר מכן להסיר את האסימונים המתאמים. הערה: אחסן את האסימונים במיקום כהה, נקי עד הניתוח.</li>
		<li>לנקות את השטח שבב עם אלכוהול איזופרופיל ולנגב סטרילי. הערה: לבדוק כל שבב נזילות או בעיות פוטנציאליות.</li>
		<li>הכנס ה-USB לתוך מערכת גלאי כדי לשמור את הנתונים.</li>
		<li>פתח את מגש שבב של מערכת גלאי, לטעון את השבב הפנים כלפי מעלה בתנוחה הנכונה ולאחר מכן סגור את המגש.</li>
		<li>המתן 30 s לעיבוד, ואז להסיר את השבב והכנס הבא.</li>
		<li>מחכים ניתוח להשלים עבור כל האסימונים מעובד ואז להוסיף את ה-USB למחשב. כדי להעביר את הקבצים. הערה: הזמן הכולל לניתוח הוא בסביבות 2 דקות 3/שבב.</li>
	</ol>
</li>
</ol>4. נתוני ניתוח ופרשנות
<ol><li>להתחבר פלטפורמת תוכנה מבוססי ענן הדרושים לביצוע כל הבדיקות במורד הזרם.</li>
	<li>יצירת פרוייקט, לייבא את כל קבצי הנתונים של האסימונים של עניין.</li>
	<li>הזן את השם מדגם; בחר את צבען ואת וזמינותו להשתמש בכרטיסיה "להגדיר צ'יפס".</li>
	<li>לקבוע אם השבב הוא מקובל דמיין זאת בכרטיסיה "סקירת נתונים", בודק איך ביסודיות המדגם היה טעון על גבי השבב, כמה נקודות הנתונים הן להערכה. הערה: דוחים צ'יפס עם פחות מ-13,000 נקודות נתונים להערכה.</li>
	<li>לעבור העלילה פיזור של השבב שנבחר בצד ימין של המסך. להחיל את הסף של 6,000 עבור אותות צבע (ציר y) כתב amidite (FAM) fluorescein על כל האסימונים. הערה: הסף להגדיר עשויים להשתנות על בסיס מבחני בשימוש.</li>
	<li>הסרה של סימנים חיוביים מפוקפק כדי למנוע תוצאות חיוביות שגויות על-ידי בחירת המקום היחסי על הפיזור מגרש באמצעות הכלי לאסו והקשה על "לא ידוע". כל נקודות חיוביות הנותרים את נוכחותם cDNA עותקים של המטרה נדיר מנותח.</li>
</ol>

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

המחברים מדווחים שאין ניגודי אינטרסים לעבודה זו.

dPCR פותחה במקור עבור ה-DNA מדידות מולקולרית10,11,12,13 , בזמן שטכנולוגיה זו הותאמה עבור כימות של מיקרו Rna ו- RNA תעתיקים5, 14,15. ב פרוטוקול זה הרחבנו את רשימת יישומים לכלול גילוי ש?...

הגן CDH1 מקודד עבור E-קדהרין, גורם מפתח מעורב קיומם של האפיתל קיבה רגיל באמצעות ויסות תא אדהזיה, הישרדות, הפצה, העברה1. איבוד חלבון E-קדהרין כתוצאה germline ברישול או שינויים סומאטית של CDH1 היה קשור עם התפתחות GC2,3. Non-קנונית תעתיקים הנובעים אינטרון 2 של הגן יש גם היה שיערו לשחק תפקיד carcinogenesis קיבה4,5. בפרט, אחד תעתיק כזה, CDH1a, הוכח להתבטא שורות תאים GC אבל הוא נעדר מן בקיבה נורמלי4. לאחרונה גילינו CDH1a GC דגימות רקמות מחולים GC משתמש המבוסס על שבב dPCR5. dPCR שימש כדי להעריך, בפעם הראשונה, הנוכחות של בתמליל ג'ין CDH1a GC מעיים, רקמה נורמלית.
השיטה תקן הזהב כדי לקבוע ביטוי גנים היא PCR כמותי בזמן אמת (qPCR). עם זאת, הנתונים המתקבלים לפעמים יכול להיות משתנה, באיכות ירודה, במיוחד כאשר רמת היעד במדגם הוא נמוך. ההשתנות יכולה להיגרם על ידי מזהמים, ומפריעים פולימראז פעילות של פריימר חישול, המוביל שאינם ספציפיים הגברה צידו התחרותי תגובות6.
העקרונות הבסיסיים הביוכימי של dPCR אמנם דומים לאלה של qPCR, dPCR מראה כמה יתרונות, מתן אפשרות עבור מדידות מדויקות מאוד של דנ א גנומי (gDNA) / משלימים במולקולות דנ א (cDNA). אכן, dPCR הוא לתגובה מובילים המסתמך על מכוילת חלוקת מדגם לאלפי וולס, כך שכל אחד טוב מכיל אפס או מולקולה יעד בודד. הגברה ואז מתרחשת רק אצל הבארות המכיל עותק של המטרה, הוא הצביע על ידי אות ניאון. המספר המוחלט של היעד מולקולות במדגם המקורי ואז יכול להיות מחושב על-ידי קביעת יחס חיובי הכולל מחיצות באמצעות פואסון בינומי סטטיסטיקה7.
בנוסף, הטכניקה dPCR מבטל את הצורך להפעיל עיקול רגיל ומכאן הטיה המשויך ולשינויים, המאפשרות כימות ישירה של מטרות8,9; הוא מייצר תוצאות מדויקות יותר לשחזור ללא תלות מזהמים ויעילות בשל שלה עמידות גבוהה בפני מעכבי10; זה הוא רגיש יותר ספציפית יותר qPCR, והוא לכן שיטה אמינה עבור זיהוי מטרה נדיר. לבסוף, חלוקת המדגם לתוך תגובות מרובות מפחיתה את התחרות עם רקע מולקולות ומשפר את הגבול של גילוי מטרה, כך הגברה מאפשר והקלה הגילוי של מולקולות יחיד של gDNA/cDNA6 . זיהוי, כימות של חומצות גרעין על ידי מבוססי שבב dPCR יותר ויותר הוחל להעתיק מספר וריאציות, כימות של ה-DNA שברים, וניתוחים מוטציה11,12,13, נתן דיוק של החומר נמוכה קלט דרישה של השיטה. בנוסף, dPCR לאחרונה שולב הניתוח של שני מיקרו Rna14 וג'ין תעתיקים5,15.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

CDH1a, תעתיק קאנונית של הגן CDH1 , נמצאה לבוא לידי ביטוי כמה שורות תאים של סרטן קיבה (GC), ואילו זה נעדר ב רירית קיבה נורמלית. לאחרונה, הבחנו variant תעתיק CDH1a ברקמות הגידול מוקפאות המתקבל חולים עם GC. הביטוי של זה וריאנט של דגימות רקמה נחקר על ידי מבוססי שבב דיגיטלי PCR (dPCR) הגישה המובאת כאן. dPCR מציע את הפוטנציאל מדידה מדויקת, חזקים, רגישה מאוד של חומצות גרעין, הוא מנוצל יותר ויותר עבור יישומים רבים בתחומים שונים. dPCR הוא מסוגל גילוי מטרות נדיר; בנוסף, dPCR מציע את האפשרות על כימות מוחלטת ומדויק של חומצות גרעין ללא צורך כיילים ועיקולים סטנדרטי. למעשה, התגובה למחיצות מעשיר את המטרה מהרקע, אשר משפר את עמידות בפני מעכבי ויעילות הגברה. תכונות אלה להפוך dPCR כלי אופטימלית עבור זיהוי בתמליל נדירים CDH1a .

באמצעות ההליך המובאת כאן, בדקנו עבור הביטוי של variant התעתיק נדיר CDH1a ברקמות מוקפאות קיבה. ניתוח הנתונים על-ידי dPCR היה הופיעה על 21-זוגי רגיל וסרטן דגימות רקמה 11 דגימות הגידול נוספים. CDH1a היה לזיהוי גידולים 15 מתוך 32 (47%), ואילו דגימות רקמה נורמלית לא הראה הנוכחות של התע...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

זיהוי של Variant התעתיק נדיר CDH1 ברקמות מוקפאות סרטן קיבה על ידי מבוססי שבב דיגיטלי PCR

כתב היד מתאר מבוססי שבב דיגיטלי PCR assay לזהות נדיר CDH1 התעתיק variant (CDH1a) רגילה מוקפאות ורקמות הגידול המתקבל בחולים עם סרטן קיבה.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

detection-cdh1-rare-transcript-variant-fresh-frozen-gastric-cancer

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

6.1K Views.  Istituto Scientifico Romagnolo per lo Studio e la Cura dei Tumori (IRST) IRCCS. כתב היד מתאר מבוססי שבב דיגיטלי PCR assay לזהות נדיר CDH1 התעתיק variant (CDH1a) רגילה מוקפאות ורקמות הגידול המתקבל בחולים עם סרטן קיבה.

Video: Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We developed an in vitro fully human preclinical model of a co-culture of breast cancer cells and monocytes undergoing differentiation towards osteoclasts. We optimized a model of osteoclastogenesis starting from a sample of peripheral blood collected from healthy donors. Peripheral blood mononuclear cells (PBMCs) were first separated by density gradient centrifugation, seeded at a high density and induced to differentiate by adding two growth factors (GFs): receptor activator of nuclear factor-&#954;B ligand (RANKL) and macrophage colony-stimulating factor (MCSF). The cells were left in culture for 14 days and then fixed and analyzed by downstream analysis. In osteolytic bone metastases, one of the effects of cancer cell arrival in bone is the induction of osteoclastogenesis. We thus challenged our model with co-cultures of breast cancer cells to study the differentiation power of cancer cells with respect to GFs. A straightforward way of studying cancer cell-osteoclast interaction is to perform indirect co-cultures based on the use of conditioned medium collected from breast cancer cell cultures and mixed with fresh medium. This mixture is then used to induce osteoclast differentiation. We also optimized a method of direct co-culture in which cancer cells and monocytes undergoing differentiation share the medium and exchange secreted factors. This is a significant improvement over the original indirect co-culture method as researchers can observe the reciprocal interactions of the two cell types and perform downstream analyses for both cancer cells and osteoclasts. This method enables us to study the effect of drugs on the metastatic bone microenvironment and to seed cell lines other than those derived from breast cancer. The model can also be used to study other diseases such as osteoporosis or other bone conditions.

This protocol describes development of an in vitro human preclinical model of osteoclastogenesis from peripheral blood monocytes cultured with breast cancer cell lines to mimic the cancer cell-osteoclast interaction. The model could be used to further our understanding of bone metastasis formation and improve therapeutic options.

התפתחות מודל פרה האנושית של Osteoclastogenesis של דם היקפיים ומונוציטים תרבותי משותף עם שורות תאים של סרטן השד

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. However, the application of this method is challenging due to its low sensitivity in analyzing the trace amount of ctDNA in the blood. Furthermore, the method may generate false positive and negative results from this sequencing and subsequent analysis. To improve the feasibility and reliability of ctDNA detection in the clinic, here we present a technique which enriches rare mutations for sequencing, Enrich Rare Mutation Sequencing (ER-Seq). ER-Seq can distinguish a single mutation out of 1 x 107 wild-type nucleotides, which makes it a promising tool to detect extremely low frequency genetic alterations and thus will be very useful in studying disease heterogenicity. By virtue of the unique sequencing adapter&#39;s ligation, this method enables an efficient recovery of ctDNA molecules, while at the same time correcting for errors bidirectionally (sense and antisense). Our selection of 1021 kb probes enriches the measurement of target regions that cover over 95% of the tumor-related driver mutations in 12 tumors. This cost-effective and universal method enables a uniquely successful accumulation of genetic data. After efficiently filtering out background error, ER-seq can precisely detect rare mutations. Using a case study, we present a detailed protocol demonstrating probe design, library construction, and target DNA capture methodologies, while also including the data analysis workflow. The process to carry out this method typically takes 1-2 days.

This manuscript describes a technique for detecting mutations of low frequency in ctDNA, ER-Seq. This method is differentiated by its unique use of two-directional error correction, a special background filter, and efficient molecular acquirement.

זיהוי של מוטציות נדירות CtDNA באמצעות רצף הדור הבא

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, and prediction of treatment resistance. Starting from the hypothesis that androgen receptor (AR) gene copy number (CN) gain is a frequent event in metastatic castration resistance prostate cancer (mCRPC), we propose to analyze this event in cfDNA as a potential predictive biomarker.
We evaluated AR CN in cfDNA using 2 different real-time PCR assays and 2 reference genes (RNaseP and AGO1). DNA amount of 60 ng was used for each assay combination. AR CN gain was confirmed using Digital PCR as a more accurate method. CN variation analysis has already been demonstrated to be informative for the prediction of treatment resistance in the setting of mCRPC, but it could be useful also for other purposes in different patient settings. CN analysis on cfDNA has several advantages: it is non-invasive, rapid and easy to perform, and it starts from a small volume of serum or plasma material.

This manuscript describes the copy number variation analysis performed in serum or plasma DNA using real-time PCR approach. This method is suitable for the prediction of drug resistance in castration resistant prostate cancer patients, but it could be informative also for other diseases.

סרום ו פלזמה עותק מספר זיהוי באמצעות PCR בזמן אמת

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and eosin (H&amp;E) staining but can be visualized through elastic staining. One of the important benefits of elastic staining is that it makes it easy to determine whether tumor cells have invaded beyond the elastic lamina. This helps in examining the extent of peritoneal surface invasion, thereby distinguishing the pT3 and pT4 stages in gastrointestinal cancer. In this study, we present a protocol to identify elastic fibers in the formalin-fixed, paraffin-embedded pT3N0M0 gastric cancer tissue sections. We prepare 5-&#181;m paraffin sections fixed on slides, and then all the slides are deparaffinated and rehydrated during the staining procedure. Subsequently, all the sections are oxidized by potassium permanganate, bleached by oxalic acid, stained by elastic staining, and counterstained by Van Gieson's. Finally, we examine the effect of staining; elastic lamina is stained blue-black and collagen fibers are stained red, while the cancer cells are stained in varying shades of yellow. We also describe in detail the methods used for determining the positional relationship between cancer cells and elastic lamina. This method is simple, low-cost, and widely applicable in the identification of peritoneal surface invasion in gastrointestinal cancer because of its outstanding selectivity for elastic fibers and authentic results.

Here, we present a protocol of elastic staining to identify elastic fibers in pT3N0M0 gastric cancer tissues on formalin-fixed, paraffin-embedded sections. Subsequently, we describe a method to determine whether tumor cells invade beyond the elastic lamina.

מכתים אלסטי על פרפין-שקופיות מוטבעות של רקמת סרטן pT3N0M0 קיבה

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image analysis. Digital scanning is a fast way to scan a stack of slides and produce digital images with high quality. It can produce concordant results with conventional light microscopy (CLM) by pathologists. Furthermore, the availability of digital images makes it possible that the same slide can be concurrently observed by multiple people. Moreover, digital images of slides can be stored in a database, which means the long-term deterioration of glass slides is avoided. The limitations of this technique are as follows. First, it needs high-quality prepared tissue and the original immunohistochemistry (IHC) slides without any damage or excess sealant residue. Second, tumor or nontumor areas should be specified by experienced pathologists before the analysis using software, in order to avoid any confusion about the tumor or nontumor areas during scoring. Third, the operator needs to control the color reproduction throughout the digitization process in whole-slide imaging.

ZW10 interacting protein (ZWINT) participates in the mitotic spindle checkpoint and the pathogenesis of carcinoma. Here, we introduce a methodology of the immunostaining of ZWINT in human lung cancer tissues, followed by the digital scanning of whole slides and image analysis. This methodology can provide high-quality digital images and reliable results.

ניתוח דיגיטלי של מעטפת חיסונית של חלבון ZW10 אינטראקציה רקמות ריאות האדם

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using electrophoresis through a resolving gel embedded with a degradable substrate. This method differs from traditional gel zymography in that a quenched fluorogenic peptide is covalently incorporated into the resolving gel instead of full length proteins, such as gelatin or casein. Use of the fluorogenic peptides enables direct detection of proteolytic activity without additional staining steps. Enzymes within the biological samples cleave the quenched fluorogenic peptide, resulting in an increase in fluorescence. The fluorescent signal in the gels is then imaged with a standard fluorescent gel scanner and quantified using densitometry. The use of peptides as the degradable substrate greatly expands the possible proteases detectable with zymographic techniques.

Here, we present a detailed protocol for a modified zymographic technique in which fluorescent peptides are used as the degradable substrate in place of native proteins. Electrophoresis of biological samples in fluorescent peptide zymograms enables detection of a wider range of proteases than previous zymographic techniques.

זיהוי של פרוטאז פעילות על-ידי ניאון פפטידים Zymography

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. Although there are many established gastric cancer cell lines and many conventional transgenic mouse models for preclinical research, the disadvantages of these in vitro and in vivo models limit their applications. Because the characteristics of these models have changed in culture, they no longer model tumor heterogeneity, and their responses have not been able to predict responses in humans. Thus, alternative models that better represent tumor heterogeneity are being developed. Patient-derived xenograft (PDX) models preserve the histologic appearance of cancer cells, retain intratumoral heterogeneity, and better reflect the relevant human components of the tumor microenvironment. However, it usually takes 4-8 months to develop a PDX model, which is longer than the expected survival of many gastric patients. For this reason, establishing primary cancer cell lines may be an effective complementary method for drug response studies. The current protocol describes methods to establish PDX models and primary cancer cell lines from surgical gastric cancer samples. These methods provide a useful tool for drug development and cancer biology research.

The current protocol describes methods to establish patient-derived xenograft (PDX) models and primary cancer cell lines from surgical gastric cancer samples. The methods provide a useful tool for drug development and cancer biology research.

הקמת החולה סרטן קיבה-מודלים נגזרים הנגזרות וקווי התא הראשי

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so by a process called retrotransposition wherein they transcribe to form an mRNA intermediate which is then consequently inserted into the genome by reverse transcription. Despite being silent in normal cells, LINE-1s are highly active in different epithelial tumors. De novo LINE-1 insertions can potentially drive tumorigenesis, and hence it is important to systematically study LINE-1 retrotransposition in cancer. Out of ~150 retrotransposition-competent LINE-1s present in the human genome, only a handful of LINE-1 loci, also referred to as &#34;hot&#34; LINE-1s, account for the majority of de novo LINE-1 insertion in different cancer types. We have developed a simple polymerase chain reaction (PCR)-based method to monitor retrotransposition activity of these hot LINE-1s. This method, based on long-distance inverse (LDI)-PCR, takes advantage of 3&#180; transduction, a mechanism by which a LINE-1 mobilizes its flanking non-repetitive region, which can subsequently be used to identify de novo LINE-1 3&#180; transduction events stemming from a particular hot LINE-1.

This article outlines a simple PCR-based assay to monitor the activity of an active LINE-1 retrotransposon and to map de novo retrotranspositions in a given genome. Using the MCF7 cell line, we demonstrate herein how this method can be applied to detect activity of a LINE-1 located at 22q12.1.

זיהוי הפעילות הרטרוטרנספוזיציה של קו חם-1s באמצעות PCR הופכי למרחקים ארוכים

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic alterations in oncogenes such as the KRAS oncogene, which constitutes ~25% of lung cancer cases. The difficulty in therapeutically targeting KRAS-driven lung cancer partly stems from having poor models that can mimic the progression of the disease in the lab. We describe a method that permits the relative quantification of primary KRAS lung tumors in a Cre-inducible LSL-KRAS G12D mouse model via ultrasound imaging. This method relies on brightness (B)-mode acquisition of the lung parenchyma. Tumors that are initially formed in this model are visualized as B-lines and can be quantified by counting the number of B-lines present in the acquired images. These would represent the relative tumor number formed on the surface of the mouse lung. As the formed tumors develop with time, they are perceived as deep clefts within the lung parenchyma. Since the circumference of the formed tumor is well-defined, calculating the relative tumor volume is achieved by measuring the length and width of the tumor and applying them in the formula used for tumor caliper measurements. Ultrasound imaging is a non-invasive, fast and user-friendly technique that is often used for tumor quantifications in mice. Although artifacts may appear when obtaining ultrasound images, it has been shown that this imaging technique is more advantageous for tumor quantifications in mice compared to other imaging techniques such as computed tomography (CT) imaging and bioluminescence imaging (BLI). Researchers can investigate novel therapeutic targets using this technique by comparing lung tumor initiation and progression between different groups of mice.

This protocol describes the steps taken to induce KRAS lung tumors in mice as well as the quantification of formed tumors by ultrasound imaging. Small tumors are visualized in early timepoints as B-lines. At later timepoints, relative tumor volume measurements are achieved by the measurement tool in the ultrasound software.

זיהוי של התקדמות הגידול ריאה בעכברים על ידי הדמיה אולטרסאונד

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...

Pathological Analysis of Lung Metastasis Following Lateral Tail-Vein Injection of Tumor Cells

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous metastasis models are available. Thus, the experimental metastasis model involving tail-vein injection of suitable cell lines is a mainstay of metastasis research. When cancer cells are injected into the lateral tail-vein, the lung is their preferred site of colonization. A potential limitation of this technique is the accurate quantification of the metastatic lung tumor burden. While some investigators count macrometastases of a pre-defined size and/or include micrometastases following sectioning of tissue, others determine the area of metastatic lesions relative to normal tissue area. Both of these quantification methods can be exceedingly difficult when the metastatic burden is high. Herein, we demonstrate an intravenous injection model of lung metastasis followed by an advanced method for quantifying metastatic tumor burden using image analysis software. This process allows for investigation of multiple end-point parameters, including average metastasis size, total number of metastases, and total metastasis area, to provide a comprehensive analysis. Furthermore, this method has been reviewed by a veterinary pathologist board-certified by the American College of Veterinary Pathologists (SEK) to ensure accuracy.

Intravenous injection of cancer cells is often used in metastasis research, but the metastatic tumor burden can be difficult to analyze. Herein, we demonstrate a tail-vein injection model of metastasis and include a novel approach to analyze the resulting metastatic lung tumor burden.

ניתוח פתולוגי של גרורות ריאות בעקבות הזרקת וריד זנב לרוחב של תאים סרטניים

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous ...