Mapping R-Loops and RNA:DNA Hybrids with S9.6-Based Immunoprecipitation Methods

Summary

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.

Abstract

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.

Introduction

R-loops are three-stranded nucleic acid structures that form primarily during transcription upon hybridization of the nascent RNA transcript to the template DNA strand. This results in the formation of an RNA:DNA hybrid and causes the displacement of the non-template DNA strand in a single-stranded looped state. Biochemical reconstitution^1,2,3,4 and mathematical modeling⁵, in combination with other biophysical measurements^6,7, have established that R-loops are....

Protocol

The following protocol is optimized for the human Ntera-2 cell line grown in culture, but it has been successfully adapted without modification to a range of other human cell lines (HEK293, K562, HeLa, U2OS), primary cells (fibroblasts, B-cells) as well as in other organisms with small modifications (mice, flies).

1. Cell harvest and lysis

1. Culture Ntera-2 cells to 75%-85% confluency. Ensure that the optimal cell count is 5 to 6 million cells with >90% viable counts to start any.......

Discussion

Described here are two protocols to map R-loop structures in potentially any organism using the S9.6 antibody. DRIP-seq represents the first genome-wide R-loop mapping technique developed. It is an easy, robust, and reproducible technique that allows one to map the distribution of R-loops along any genome. The second technique, termed sDRIP-seq, is also robust and reproducible but achieves higher resolution and strand-specificity owing to the inclusion of a sonication step and a stranded sequencing library construction p.......

Materials

Name	Company	Catalog Number	Comments
15 mL tube High density Maxtract phase lock gel	Qiagen	129065
2 mL tube phase lock gel light	VWR	10847-800
Agarose A/G beads	ThermoFisher Scientific	20421
Agencourt AMPure XP beads	Beckman Coulter	A63881
AmpErase Uracil N-glycosylase	ThermoFisher Scientific	N8080096
Index adapters	Illumina		Corresponds to the TrueSeq Single indexes
Klenow fragment (3’ to 5’ exo-)	New England BioLabs	M0212S
NEBNext End repair module	New England BioLabs	E6050
PCR primers for library amplification			primer 1.0 P5 (5’ AATGATACGGCGACCACCGAGA TCTACACTCTTTCCCTACACGA 3’)
PCR primers for library amplification			PCR primer 2.0 P7 (5’ CAAGCAGAAGACGGCATACG AGAT 3’)
Phenol/Chloroform Isoamyl alcohol 25:24:1	Affymetrix	75831-400ML
Phusion Flash High-Fidelity PCR master mix	ThermoFisher Scientific	F548S
Quick Ligation Kit	New England BioLabs	M2200S
Ribonuclease H	New England BioLabs	M0297S
S9.6 Antibody	Kerafast	ENH001	These three sources are equivalent
S9.6 Antibody	Millipore/Sigma	MABE1095
S9.6 Antibody	Abcam	ab234957