Este trabajo fue apoyado por las subvenciones de los Institutos Nacionales de Salud (NIH): RO1 EY012085 (a J.X.J) y F32DK134051 (a F.M.A.), y la subvención de la Fundación Welch: AQ-1507 (a J.X.J.). El contenido es responsabilidad exclusiva de los autores y no representa necesariamente los puntos de vista oficiales de los Institutos Nacionales de Salud. Las figuras fueron creadas parcialmente con Biorender.com.

Este estudio se llevó a cabo de conformidad con la Ley de Bienestar Animal y el Reglamento de Implementación de Bienestar Animal de acuerdo con los principios de la Guía para el Cuidado y Uso de Animales de Laboratorio. Todos los procedimientos con animales fueron aprobados por el Comité Institucional de Cuidado y Uso de Animales del Centro de Ciencias de la Salud de la Universidad de Texas en San Antonio. Para obtener información general sobre el protocolo, consulte la Figura 1; consulte la Tabla de materiales para obtener detalles sobre todos los materiales, reactivos e instrumentos utilizados en este protocolo.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65727/65727fig01.jpg"> Figura 1: Esquema experimental. 1 . El primer paso del protocolo es la determinación de una proteína diana específica, la identificación de la(s) secuencia(s) genética(s) asociada(s) y la generación de fragmentos de ADN. 2 . Clonación de la(s) secuencia(s) genética(s) en un vector retroviral mediante clonación inicial en un vector adaptador, 3. seguido de un vector viral . 4 . Preparación de partículas virales de alto título utilizando celdas de empaque para cosechar y concentrar. 5 . El paso final, y el enfoque de este protocolo, es la microinyección de las partículas virales RCAS(A) en el lumen del cristalino. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig01large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a>
1. Preparación de retrovirus recombinantes de alto título
<ol><li>Reacción en cadena de la polimerasa (PCR) para producir fragmentos de ADN de proteínas diana NOTA: Esta sección tiene como objetivo amplificar la secuencia de ADN correspondiente a la proteína del cristalino diana. Para más detalles, véase 7,8.<ol><li>Diseñar cebadores para PCR, correspondientes a la proteína de interés, para hacer fragmentos de ADN con su extremo carboxilo en el marco con o sin una secuencia de epítopos FLAG (5'-GACTACAAGGACGACGATGACAAG-3'), un codón de parada y un sitio de enzima de restricción (es decir, EcoRI) presente dentro de la región polienlazadora de CLa12NCO)) de acuerdo con las especificaciones señaladas en protocolos publicados anteriormente, con secuencias para enzimas de restricción adecuadas1, 7,8,10,11.</li>
		<li>Realizar la reacción de PCR10. Combine 100 pmol de sentido y antisentido de los cebadores diseñados con 0,5 μg de ADNc de conexina (como Cx50, Cx43 o combinaciones quiméricas de Cx50*43L), con el tampón de reacción de PCR de su elección. Realice 30 ciclos cada uno de 94 °C durante 1 min, 58 °C durante 1 min y 72 °C durante 1 min, seguidos de una extensión final durante 10 min a 72 °C.</li>
		<li>Aísle y purifique los productos de PCR con un kit de purificación en gel.</li>
		<li>Digiera los productos de PCR purificados utilizando las enzimas de restricción de su elección de acuerdo con las instrucciones del fabricante.</li>
	</ol></li>
	<li>Clonación de insertos de ADN en plásmido adaptador NOTA: La inserción de fragmentos de ADN en un vector adaptador elimina la necesidad de células/virus auxiliares para aumentar la estabilidad del vector RCAS(A)14. Para más detalles, véase 7,8.<ol><li>El ADN subclonado se fragmenta en un plásmido adaptador, Cla12NCO mediante una reacción de ligadura de extremo pegajoso. Mezclar los fragmentos de PCR con enzimas de restricción y Cla12NCO en una proporción de 2-5:1. Realizar la ligadura y la transformación del ADN utilizando células competentes.</li>
		<li>Aísle el ADN con un kit de aislamiento de ADN.</li>
		<li>Secuenciar el ADN para garantizar la precisión.</li>
	</ol></li>
	<li>Clonación en el vector viral RCAS(A) NOTA: Los fragmentos de ADN se insertan en un vehículo (retrovirus RCAS(A)) para la transducción estable de un gen en las células del embrión de pollo en desarrollo14,15. Para obtener más detalles, consulte 7,8,15.<ol><li>Digiera el fragmento de ADN Cla12NCO del vector que contiene interés con ClaI (1 unidad por 1 μg de ADN) y aísle los fragmentos.</li>
		<li>Subclonar los fragmentos de ADN en un plásmido RCAS(A) linealizado por ClaI. Utilice la enzima de restricción SalI para distinguir el sitio ClaI en el plásmido RCAS(A).</li>
		<li>Confirmar la correcta orientación de los fragmentos insertados en las construcciones mediante digestión con enzimas de restricción ClaI y SalI.</li>
		<li>Aísle el ADN con un kit de aislamiento de ADN.</li>
		<li>Determina la concentración de ADN.</li>
	</ol></li>
	<li>Transfección de células de fibroblastos embrionarios de pollo (CEF) y recolección de RCAS(A) NOTA: Las células de empaquetamiento de virus, CEF, se utilizan para obtener/cosechar medios de cultivo celular que contienen partículas virales15,16. Para obtener más detalles, consulte 7,8,15.<ol><li>Transfecte células CEF con construcciones de ADN retroviral recombinante utilizando el agente de transfección de acuerdo con las instrucciones del fabricante.</li>
		<li>Realizar Western blot de las células transfectadas para examinar su expresión de la proteína de interés.</li>
		<li>Cuando las células transfectadas alcancen la confluencia, comience a recolectar el medio sobrenadante, procesándolo/filtrándolo adecuadamente (para eliminar cualquier residuo celular usando un filtro de 0,22 μm) y almacene a -80 °C hasta que esté listo para la concentración.</li>
	</ol></li>
	<li>Concentración y titulación de las cepas virales NOTA: Los gránulos y los grandes volúmenes de medios derivados de las células que contienen las partículas virales deben filtrarse. Además, se debe realizar un ensayo de título viral para establecer la fuerza del virus contra las células huésped. Para obtener más detalles, consulte 6,7,8,15.<ol><li>Descongelar los medios de cultivo que contienen los viriones.</li>
		<li>Centrifugar el medio de cultivo a 72.000 × g durante 2 h a 4 °C.</li>
		<li>Decantar el sobrenadante y resuspender el gránulo viral con el medio residual (~50 μL) y almacenar a -80 °C hasta su uso, en cepas virales de ~10 μL.</li>
		<li>Para la titulación, utilizando células QT-6 o CEF, transfecte las células con una dilución en serie de las existencias virales.</li>
		<li>Después de la confluencia, fije las celdas con formaldehído al 4%.</li>
		<li>Inmunotinción para proteínas gag virales o proceso histoquímico para fosfatasa alcalina para obtener el título, definido como UFC (unidades formadoras de colonias) por mililitro (UFC/mL).</li>
	</ol></li>
</ol><img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65727/65727fig02.jpg"> Figura 2: Instrumentos y configuración para la microinyección de lentes de pollito . (A) Extractor manual de micropipetas de microelectrodos verticales P-30. (1) recuadro que muestra una micropipeta de vidrio que se está tirando. (B) (2) Incubadora de huevos. Incubar el huevo de gallina durante ~65-68 h en una incubadora a 37 °C hasta alcanzar el estadio 18 (con un lumen central sellado y vacío) para la inyección de retrovirus. (C) Configuración de microinyección. (3) equipo de iluminación, (4) pico-inyector, (5) microscopio de disección, (6) micromanipulador Drummond, (7) computadora/cámara para visualización. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig02large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a>
2. Microinyección de lente de pollito
<ol><li>Preparación de insumos<ol><li>Preparación de micropipetas de vidrio para microinyección17 NOTA: Los capilares de vidrio se utilizan para fabricar micropipetas de vidrio con una punta y un diámetro exterior (OD) de ~11 μm para microinyección. La configuración se muestra en la Figura 2A.<ol><li>Fije el capilar de vidrio de borosilicato a los clips acolchados de goma en el extractor de micropipetas vertical manual.</li>
			<li>Ajuste la temperatura de calor (HEAT 1) a 950 °C y realice la extracción previa para obtener un capilar de vidrio más delgado y blando.</li>
			<li>Ajuste la temperatura de calor (HEAT 2) a 790 °C y realice un tirón secundario para producir las micropipetas finales.</li>
			<li>Con una amoladora de micropipetas, afile la abertura de la punta a un diámetro exterior de ~11 μm.</li>
			<li>Para futuros experimentos, mantenga las micropipetas de vidrio en una almohadilla de sujeción de esponja dentro de un frasco de vidrio.</li>
		</ol></li>
		<li>Incubación de óvulos fecundados hasta la etapa de desarrollo 18 NOTA: Durante el desarrollo del cristalino, a ~65-68 h de desarrollo embrionario, el cristalino se separa del ectodermo y forma una vesícula sellada con una luz central; La inyección en el lumen vacío del cristalino prepara la expresión restringida a las células proliferativasdel cristalino 7,8,18.<ol><li>Incubar los huevos de gallina fertilizados durante ~65-68 h en una incubadora mecedora humidificada a 37 °C (Figura 2B).</li>
		</ol></li>
	</ol></li>
	<li>Apertura del huevo de gallina NOTA: Este paso describe la identificación y exposición del embrión para la microinyección. Para más detalles, véase 7,8.<ol><li>Limpie bien el área de trabajo con etanol al 70%.</li>
		<li>Retire los huevos de la incubadora, rocíelos abundantemente con etanol al 70% y déjelos secar al aire.</li>
		<li>Coloque el huevo, con el extremo más grande del huevo hacia arriba, en un soporte para huevos.</li>
		<li>Con un par de pinzas de dientes afilados, haga un agujero de ~ 2 cm de diámetro en el extremo más grande del huevo golpeando con cuidado la cáscara del huevo y quitando fragmentos de la cáscara del huevo (Figura 3A).</li>
		<li>Con un microscopio de disección, localice el embrión.</li>
		<li>Una vez localizados el embrión y el cristalino del pollito, utilice el microscopio de disección y unas pinzas y tijeras de disección finas para cortar la membrana amniónica que cubre inmediatamente la parte superior del embrión (Figura 3B). NOTA: No corte demasiado (solo lo suficiente para exponer el embrión ~ 0,5 cm x 0,5 cm), o de lo contrario los embriones podrían hundirse en la masa vitelita; También evite tocar los vasos sanguíneos, si es posible.</li>
		<li>Cubra la abertura del huevo con una placa de Petri de 60 mm en preparación para los siguientes pasos.</li>
	</ol></li>
	<li>Microinyección de material viral concentrado NOTA: Las partículas virales que contienen fragmentos de ADN de proteínas diana para su transducción se insertan en las células dentro de la luz del cristalino. La configuración se muestra en la Figura 2C. Para más detalles, ver 6,7,8.<ol><li>Descongele las existencias de acciones virales en hielo.</li>
		<li>Para visualizar el stock viral durante la inyección, diluya 1 μL de 10x Fast green en un vial de stock viral que contenga 10 μL.</li>
		<li>Para asegurarse de que no haya grandes trozos de material no disuelto que puedan obstruir la micropipeta de vidrio, centrifugue las soluciones durante 10 s a 10.000 × g a 4 °C para granular "trozos grandes" y transfiera los sobrenadantes a nuevos tubos, todo ello manteniendo las soluciones en hielo.</li>
		<li>En una placa de cultivo de 35 mm x 10 mm, coloque un parafilm de laboratorio estirado y agregue 1 μL de solución salina estéril (PBS) sobre la película (no esterilizada, con el lado cubierto considerado "limpio").</li>
		<li>Conecte una micropipeta de vidrio preparada a un picoinyector automático.</li>
		<li>Presione el modo de llenado para llenar la solución salina estéril (PBS) en una micropipeta de vidrio y, a continuación, use el modo de inyección para probar el 1 μL de líquido asignado.</li>
		<li>Coloque un segundo parafilm de laboratorio estirado en la superficie de una nueva placa de cultivo celular de 35 mm x 10 mm y agregue 1 μL de material viral teñido de verde rápido sobre la película.</li>
		<li>Baje la punta de la micropipeta en el material viral y presione el modelo de llenado para llenar la micropipeta de vidrio con ~1 μL de material viral. NOTA: Para evitar que se seque, coloque la punta de la micropipeta llena en solución salina estéril (PBS) cada vez que haya una pausa en el procedimiento.</li>
		<li>Baje la micropipeta de vidrio llena, conectada a un inyector automático, en la región objetivo de la luz de la lente del embrión con la ayuda de un microscopio de disección.</li>
		<li>Ajuste la fuente de luz para garantizar una visualización clara del contorno de la vesícula del cristalino. NOTA: El lumen del cristalino derecho (hacia arriba) se utiliza normalmente para la inyección y el izquierdo (hacia abajo) se mantiene intacto como control contralateral.</li>
		<li>Una vez que esté seguro de que la colocación de la micropipeta está dentro de la ubicación correcta dentro de la luz de la lente, inyecte 5-40 nL del material viral (Figura 3C). NOTA: La práctica es muy necesaria para una colocación óptima de la inyección.</li>
		<li>Espere ~45 s y luego retire suavemente la micropipeta de vidrio.</li>
		<li>Compruebe si la microinyección se ha realizado correctamente en el lumen de la lente utilizando el microscopio de disección examinando el tinte verde rápido que debe permanecer en el lumen vacío de la lente sin fugas.</li>
		<li>Después del procedimiento de inyección, selle la abertura de la cáscara de huevo con cinta adhesiva.</li>
		<li>Devolver el embrión a la incubadora humidificada a 37 °C, sin ningún movimiento de rotación, hasta que se haya alcanzado la edad embrionaria deseada para la disección del cristalino.</li>
	</ol></li>
</ol><img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65727/65727fig03.jpg"> Figura 3: Preparación y esquema de la microinyección de pollitos . (A) Apertura de un huevo de gallina. (B) Corte de la membrana amniótica. (C) Esquema de microinyección de lúmenes de lentes de pollo. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig03large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a>

Estudio de la expresión de proteínas durante el desarrollo del cristalino de los pollos

<ol>
	<li>Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+potent+embryonic+chick+lens+model+for+studying+congenital+cataracts+in+vivo.">Development of a potent embryonic chick lens model for studying congenital cataracts in vivo.</a> Communications Biology. 4 (1), 325 (2021).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#947;-Crystallins+of+the+chicken+lens:+remnants+of+an+ancient+vertebrate+gene+family+in+birds.">&#947;-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds.</a> The FEBS Journal. 283 (8), 1516-1530 (2016).</li><li>Coulombre, A. J., Coulombre, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+development.+I.+Role+of+the+lens+in+eye+growth.">Lens development. I. Role of the lens in eye growth.</a> Journal of Experimental Zoology. 156 (1), 39-47 (1964).</li><li>McKeehan, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+portions+of+the+chick+lens+without+contact+with+the+optic+cup.">Induction of portions of the chick lens without contact with the optic cup.</a> The Anatomical Record. 132 (3), 297-305 (1958).</li><li>Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+effect+of+BAFF+on+chicken+B+cell+development+revealed+by+RCAS+retroviral+gene+transfer+in+vivo.">Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo.</a> Molecular immunology. 47 (7-8), 1619-1628 (2010).</li><li>Fekete, D. M., Cepko, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication-competent+retroviral+vectors+encoding+alkaline+phosphatase+reveal+spatial+restriction+of+viral+gene+expression/transduction+in+the+chick+embryo.">Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo.</a> Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).</li><li>Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+retroviruses+to+express+connexins.">Use of retroviruses to express connexins.</a> Methods in Molecular Biology. , 159-174 (2001).</li><li>Jiang, J. X., Goodenough, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+expression+of+connexins+in+embryonic+chick+lens.">Retroviral expression of connexins in embryonic chick lens.</a> Investigative Ophthalmology &amp; Visual Science. 39 (3), 537-543 (1998).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+autofluorescent+proteins+reveals+a+novel+protein+permeable+pathway+between+cells+in+the+lens+core.">Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core.</a> Journal of Cell Science. 113 (11), 1913-1921 (2000).</li><li>Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aquaporin+0+enhances+gap+junction+coupling+via+its+cell+adhesion+function+and+interaction+with+connexin+50.">Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50.</a> Journal of Cell Science. 124 (2), 198-206 (2011).</li><li>Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+second+extracellular+domain+of+connexin+50+is+important+for+in+cell+adhesion,+lens+differentiation,+and+adhesion+molecule+expression.">The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression.</a> Journal of Biological Chemistry. 299 (3), 102965 (2023).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exogenous+gene+expression+and+protein+targeting+in+lens+fiber+cells.">Exogenous gene expression and protein targeting in lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 40 (7), 1435-1443 (1999).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+organization+of+primary+lens+fiber+cells.">Three-dimensional organization of primary lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 41 (3), 859-863 (2000).</li><li>Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptor+plasmids+simplify+the+insertion+of+foreign+DNA+into+helper-independent+retroviral+vectors.">Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors.</a> Journal of Virology. 61 (10), 3004-3012 (1987).</li><li>Yan, R. T., Wang, S. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+high-titer+RCAS+retrovirus.">Production of high-titer RCAS retrovirus.</a> Methods in Molecular Biology. 884, 193-199 (2012).</li><li>Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introduction+of+DNA+into+mammalian+cells.">Introduction of DNA into mammalian cells.</a> Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+macrophage+activation+in+immune-privileged+lens+through+CSF-1+protein+intravitreal+injection+in+mouse+model.">Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model.</a> STAR Protocols. 3 (1), 101060 (2022).</li><li>Hamburger, V., Hamilton, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+series+of+normal+stages+in+the+development+of+the+chick+embryo.">A series of normal stages in the development of the chick embryo.</a> Developmental Dynamics. 195 (4), 231-272 (1992).</li><li>Hallagan, J. B., Allen, D. C., Borzelleca, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+safety+and+regulatory+status+of+food,+drug+and+cosmetics+colour+additives+exempt+from+certification.">The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification.</a> Food and Chemical Toxicology. 33 (6), 515-528 (1995).</li><li>Okada, T. S., Eguchi, G., Takeichi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+differentiation+by+chicken+lens+epithelium+in+in+vitro+cell+culture.">The expression of differentiation by chicken lens epithelium in in vitro cell culture.</a> Development, Growth &amp; Differentiation. 13 (4), 323-336 (1971).</li><li>Menko, A. S., Klukas, K. A., Johnson, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chicken+embryo+lens+cultures+mimic+differentiation+in+the+lens.">Chicken embryo lens cultures mimic differentiation in the lens.</a> Developmental Biology. 103 (1), 129-141 (1984).</li><li>Parreno, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodologies+to+unlock+the+molecular+expression+and+cellular+structure+of+ocular+lens+epithelial+cells.">Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells.</a> Frontiers in Cell and Developmental Biology. 10, 983178 (2022).</li><li>Edwards, A., Gupta, J. D., Harley, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photomicrographic+evaluation+of+drug-induced+cataracts+in+cultured+embryonic+chick+lens.">Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens.</a> Experimental Eye Research. 15 (4), 495-498 (1973).</li><li>Musil, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+cultures+of+embryonic+chick+lens+cells+as+a+model+system+to+study+lens+gap+junctions+and+fiber+cell+differentiation.">Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation.</a> Journal of Membrane Biology. 245 (7), 357-368 (2012).</li><li>West-Mays, J. A., Pino, G., Lovicu, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+use+of+the+lens+epithelial+explant+system+to+study+lens+differentiation+and+cataractogenesis.">Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis.</a> Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).</li><li>Upreti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+epithelial+explants+treated+with+vitreous+humor+undergo+alterations+in+chromatin+landscape+with+concurrent+activation+of+genes+associated+with+fiber+cell+differentiation+and+innate+immune+response.">Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response.</a> Cells. 12 (3), 501 (2023).</li><li>Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+SRC+kinases+signals+induction+of+posterior+capsule+opacification.">Activation of SRC kinases signals induction of posterior capsule opacification.</a> Investigative Ophthalmology &amp; Visual Science. 48 (5), 2214-2223 (2007).</li><li>Briskin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heritable+retroviral+transgenes+are+highly+expressed+in+chickens.">Heritable retroviral transgenes are highly expressed in chickens.</a> Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).</li><li>Hughes, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RCAS+vector+system.">The RCAS vector system.</a> Folia Biologica. 50 (3-4), 107-119 (2004).</li></ol>

Los autores declaran que la investigación se llevó a cabo en ausencia de relaciones comerciales o financieras que pudieran interpretarse como un posible conflicto de intereses.

Este modelo experimental ofrece la oportunidad de expresar la(s) proteína(s) de interés en el cristalino intacto, lo que lleva al estudio de la relevancia funcional de estas proteínas en la estructura y función del cristalino. El modelo de microinyección de pollitos embrionarios se basa parcialmente en el trabajo de Fekete et. al.6 y fue desarrollado por Jiang et. al.8 y se ha utilizado como medio para insertar plásmidos virales y agentes como agonistas, ARN interfere...

El objetivo de este protocolo es describir la metodología de microinyección embrionaria de lente de pollo de un RCAS(A) (retrovirus A de sarcoma aviar / leucosis con replicación competente). Se ha demostrado que la administración retroviral efectiva en una lente de pollo embrionaria es una herramienta prometedora para el estudio in vivo del mecanismo molecular y la estructura-función de las proteínas del cristalino en la fisiología, las condiciones patológicas y el desarrollo normales del cristalino. Además, este modelo experimental podría utilizarse para la identificación de dianas terapéuticas y el cribado de fármacos para enfermedades como las cataratas congénitas humanas. En definitiva, este protocolo pretende establecer los pasos necesarios para el desarrollo de una plataforma personalizable para el estudio de las proteínas del cristalino.
Los polluelos embrionarios (Gallus domesticus), debido a su similitud en la estructura y función del cristalino con el cristalino humano, son un modelo animal bien establecido para el estudio del desarrollo y la fisiología del cristalino 1,2,3,4. El uso de un retrovirus aviar competente para la replicación de RCAS(A) se ha considerado un sistema altamente efectivo, rápido y personalizable para expresar proteínas exógenas en embriones de pollo. En particular, tiene una capacidad única para confinar la transferencia de genes diana a las células proliferativas de la fibra del cristalino sin necesidad de promotores específicos del tejido, utilizando el marco de tiempo de desarrollo embrionario único en el que la presencia de la luz vacía del cristalino permite la microinyección in situ de RCAS(A) en el sitio restringido para la expresión de proteínas exógenas dentro de las células proliferativas de la fibra del cristalino5, 6,7,8.
El procedimiento de microinyección de embriones de pollo, descrito en profundidad aquí, se basa originalmente parcialmente en el trabajo de Fekete et. al.6 y desarrollado por Jiang et. al.8 y se ha utilizado como medio para introducir plásmidos virales y no virales en el cristalino de pollitos embrionarios 1,9,10,11,12,13. En general, el trabajo anterior demuestra el potencial de utilizar esta metodología para estudiar el desarrollo, la diferenciación, la comunicación celular y la progresión de la enfermedad en el cristalino, y para el descubrimiento y prueba de dianas terapéuticas para afecciones patológicas del cristalino, como las cataratas.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.22 &#181;m Filter</td>
			<td>Corning</td>
			<td>431118</td>
			<td>For removing cellular debris from media</td>
		</tr>
		<tr>
			<td>35 mm x 10 mm Culture Dish</td>
			<td>FisherScientific</td>
			<td>50-202-030</td>
			<td>For using during microinjection</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Fisherbrand</td>
			<td>13-100-676</td>
			<td>Spinning down solution</td>
		</tr>
		<tr>
			<td>Constructs</td>
			<td>GENEWIZ</td>
			<td>-</td>
			<td>For generation of constructs</td>
		</tr>
		<tr>
			<td>Dissecting microscope</td>
			<td>AmScope</td>
			<td>SM-4TZ-144A</td>
			<td>Visualization of lens for microinjection</td>
		</tr>
		<tr>
			<td>DNA PCR primers</td>
			<td>Integrated DNA Technologies</td>
			<td>-</td>
			<td>Generation of primers: 
			 
			Intracellular loop (IL)-deleted Cx50 (residues 1&#8211;97 and 149&#8211;400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC 
			 
			ILs of Cx43 (residues 98&#8211;150) and Cx46 (residues 98&#8211;166) were&#160; obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively 
			 
			Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC 
			 
			ILs of Cx50 (residues 98&#8211;148) or Cx46 (residues 98&#8211;166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively</td>
		</tr>
		<tr>
			<td>Drummond Nanoject II Automatic Nanoliter Injector</td>
			<td>Drummond Scientific</td>
			<td>3-000-204</td>
			<td>Microinjection Pipet</td>
		</tr>
		<tr>
			<td>Dual Gooseneck Lights Microscope Illuminator</td>
			<td>AmScope</td>
			<td>LED-50WY</td>
			<td>Lighting for visualization</td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Modified Eagle Medium (DMEM)</td>
			<td>Invitrogen</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Egg Holder</td>
			<td>-</td>
			<td>-</td>
			<td>Homemade styrofoam rings with 2-inch diameter and one-half inch height</td>
		</tr>
		<tr>
			<td>Egg Incubator</td>
			<td>GQF Manufacturing Company Inc.</td>
			<td>1502</td>
			<td>For incubation of fertilized eggs</td>
		</tr>
		<tr>
			<td>Fast Green</td>
			<td>Fisher scientific</td>
			<td>F99-10</td>
			<td>For visualization of viral stock injection</td>
		</tr>
		<tr>
			<td>Fertilized white leghorn chicken eggs</td>
			<td>Texas A&#38;M University</td>
			<td>N/A</td>
			<td>Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/)</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Hyclone Laboratories</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Fluorescein-conjugated anti-mouse IgG</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-095-003</td>
			<td>For anti-FLAG&#160; 1:500</td>
		</tr>
		<tr>
			<td>Forceps</td>
			<td>FisherScientific</td>
			<td>22-327379</td>
			<td>For moving things around and isolation</td>
		</tr>
		<tr>
			<td>Glass capillaries</td>
			<td>Sutter Instruments</td>
			<td>B100-75-10</td>
			<td>Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length)</td>
		</tr>
		<tr>
			<td>Lipofectamine</td>
			<td>Invitrogen</td>
			<td>L3000001</td>
			<td>For transfection</td>
		</tr>
		<tr>
			<td>Manual vertical micropipette puller</td>
			<td>Sutter Instruments</td>
			<td>P-30</td>
			<td>To obtain glass micropipette of the correct size</td>
		</tr>
		<tr>
			<td>Microcentrifuge Tubes</td>
			<td>FisherScientific</td>
			<td>02-682-004</td>
			<td>Dissolving solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Keyence</td>
			<td>BZ-X710</td>
			<td>For imaging staining</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>FisherScientific</td>
			<td>03-448-254</td>
			<td>Placing solution</td>
		</tr>
		<tr>
			<td>Penicillin/Streptomycin</td>
			<td>Invitrogen</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Pico-Injector</td>
			<td>Harvard Apparatus</td>
			<td>PLI-100</td>
			<td>For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time</td>
		</tr>
		<tr>
			<td>rabbit anti-chick AQP0</td>
			<td>Self generated</td>
			<td>-</td>
			<td>Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363.</td>
		</tr>
		<tr>
			<td>rabbit anti-FLAG antibody</td>
			<td>Rockland Immunichemicals</td>
			<td>600-401-383</td>
			<td>For staining FLAG</td>
		</tr>
		<tr>
			<td>Rhodamine-conjugated anti-rabbit IgG&#160;</td>
			<td>Jackson ImmunoResearch</td>
			<td>111-295-003</td>
			<td>For anti-AQP0&#160; 1:500</td>
		</tr>
		<tr>
			<td>Sponge clamping pad</td>
			<td>Sutter Instruments</td>
			<td>BX10</td>
			<td>For storage of glass micropipette</td>
		</tr>
	</tbody>
</table>

microinjection of recombinant rcas(a) retrovirus into embryonic chicken lens

El pollo embrionario (Gallus domesticus) es un modelo animal bien establecido para el estudio del desarrollo y la fisiología del cristalino, dado su alto grado de similitud con el cristalino humano. RCAS(A) es un retrovirus de pollo competente para la replicación que infecta las células en división, que sirve como una poderosa herramienta para estudiar la expresión y función in situ de proteínas mutantes y de tipo salvaje durante el desarrollo del cristalino mediante microinyección en la luz vacía de la vesícula del cristalino en las primeras etapas de desarrollo, restringiendo su acción a las células proliferativas del cristalino circundantes. En comparación con otros enfoques, como los modelos transgénicos y los cultivos ex vivo , el uso de un retrovirus aviar competente para la replicación de RCAS(A) proporciona un sistema altamente efectivo, rápido y personalizable para expresar proteínas exógenas en embriones de pollo. Específicamente, la transferencia génica dirigida puede limitarse a las células proliferativas de la fibra del cristalino sin necesidad de promotores específicos de tejido. En este artículo, haremos un breve resumen de los pasos necesarios para la preparación de RCAS(A) de retrovirus recombinantes, proporcionaremos una descripción detallada y completa del procedimiento de microinyección y proporcionaremos resultados de muestra de la técnica.

Tras la determinación de una o varias proteínas diana específicas y la identificación de las secuencias genéticas asociadas, el enfoque experimental general consiste en la clonación de las secuencias génicas en un vector RCAS(A) retroviral mediante la clonación inicial en un vector adaptador, seguido de un vector viral. En segundo lugar, las partículas virales de alto título se preparan utilizando células de envasado para cosechar y concentrar los viriones. Estos dos primeros pasos principales han sido ampliam...

Watch this Scientific Journal Video about Investigating Lens Development and Function Through Microinjection of RCASA Retrovirus in Embryonic Chicken Lens at JoVE.com

Autor destacado: Investigación del desarrollo y la función del cristalino mediante la microinyección de retrovirus RCAS(A) en el cristalino de pollo embrionario 

Este documento de protocolo describe la metodología de microinyección de un retrovirus RCAS(A) en el cristalino de pollo embrionario como herramienta para estudiar in situ la función y la expresión de proteínas durante el desarrollo del cristalino.

Microinyección de retrovirus RCAS(A) recombinante en lentes embrionarias de pollo

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of ...

La metodología presentada de microinyección embrionaria de un retrovirus RCAS en el cristalino de pollo pretende ser una herramienta para estudiar in situ la función y la expresión de proteínas durante el desarrollo del cristalino. En comparación con otros enfoques, como los modelos transgénicos y los cultivos ex vivo, el retrovirus aviar competente para la replicación de RCAS proporciona un sistema altamente efectivo, rápido y personalizable para expresar proteínas exógenas en embriones de pollo. La transferencia génica dirigida puede limitarse a las células proliferativas de la fibra del cristalino sin necesidad de promotores.Existe un gran potencial para utilizar esta metodología para estudiar el desarrollo, la diferenciación, la comunicación celular y la progresión de la enfermedad del cristalino, y para el descubrimiento y la prueba de dianas terapéuticas para afecciones patológicas del cristalino, como las cataratas.

microinjection-recombinant-rcas-retrovirus-into-embryonic-chicken

Research

JoVE Journal

Biology

Microinjection of Recombinant RCAS(A) Retrovirus into Embryonic Chicken Lens

744 vistas.  University of Texas Health Science Center, San Antonio. La metodología presentada de microinyección embrionaria de un retrovirus RCAS en el cristalino de pollo pretende ser una herramienta para estudiar in situ la función y la expresión de proteínas durante el desarrollo del cristalino. En comparación con otros enfoques, como los modelos transgénicos y los cultivos ex vivo, el retrovirus aviar competente para la replicación de RCAS proporciona un sistema altamente efectivo, rápido y personalizable para expresar proteínas exógenas en emb...

Video: Autor destacado: Investigación del desarrollo y la función del cristalino mediante la microinyección de retrovirus RCAS(A) en el cristalino de pollo embrionario 

Windowing Chicken Eggs for Developmental Studies

The study of development has been greatly aided by the use of the chick embryo as an experimental model.  The ease of accessibility of the embryo has allowed for experiments to map cell fates using several approaches, including chick quail chimeras and focal dye labeling.  In addition, it allows for molecular perturbations of several types, including placement of protein-coated beads and introduction of plasmid DNA using in ovo electroporation.  These experiments have yielded important data on the development of the central and peripheral nervous systems.  For many of these studies, it is necessary to open the eggshell and reclose it without perturbing the embryo's growth.  The embryo can be examined at successive developmental stages by re-opening the eggshell.  While there are several excellent methods for opening chicken eggs, in this article we demonstrate one method that has been optimized for long survival times.  In this method, the egg rests on its side and a small window is cut in the shell.  After the experimental procedure, the shell is used to cover the egg for the duration of its development.  Clear plastic tape overlying the eggshell protects the embryo and helps retain hydration during the remainder of the incubation period.  This method has been used beginning at two days of incubation and has allowed survival through mature embryonic ages.

The ease of accessibility of the embryo has allowed for experiments to map cell fates using several approaches, including chick quail chimeras and focal dye labeling. In this article we demonstrate one egg preparation method that has been optimized for long survival times.

Los huevos de ventanas de pollo para Estudios del Desarrollo

The study of development has been greatly aided by the use of the chick embryo as an experimental model.  The ease of accessibility of the embryo has ...

Investigación

Biología

Production of Replication-Defective Retrovirus by Transient Transfection of 293T cells

Our lab studies human myeloproliferative diseases induced by such oncogenes as Bcr-Abl or growth factor receptor-derived oncogenes (ZNF198-FGFR1, Bcr-PDGFR&#945;, etc.). We are able to model and study a human-like disease in our mouse model, by transplanting bone marrow cells previously infected with a retrovirus expressing the oncogene of interest. Replication-defective retrovirus encoding a human oncogene and a marker (GFP, RFP, antibiotic resistance gene, etc.) is produced by a transient transfection protocol using 293T cells, a human renal epithelial cell line transformed by the adenovirus E1A gene product. 293 cells have the unusual property of being highly transfectable by calcium phosphate (CaPO4), with up to 50-80% transfection efficiency readily attainable. Here, we co-transfect 293 cells with a retroviral vector expressing the oncogene of interest and a plasmid that expresses the gag-pol-env packaging functions, such as the single-genome packaging constructs kat or pCL, in this case the EcoPak plasmid. The initial transfection is further improved by use of chloroquine. Stocks of ecotropic virus, collected as culture supernatant 48 hrs. post-transfection, can be stored at -80&deg;C and used for infection of cell-lines in view of transformation and in vitro studies, or primary cells such as mouse bone marrow cells, that can then be used for transplant in our mouse model.

This technique demonstrates an efficient way to prepare replication-defective retroviral stocks encoding a human oncogene, and subsequently used for induction of myeloproliferative disease in the mouse model.

La producción de replicación defectuosa Retrovirus por transfección transitoria de células 293T

Our lab studies human myeloproliferative diseases induced by such oncogenes as Bcr-Abl or growth factor receptor-derived oncogenes (ZNF198-FGFR1, ...

Intranuclear Microinjection of DNA into Dissociated Adult Mammalian Neurons

Primary neuronal cell cultures are valuable tools to study protein function since they represent a more biologically relevant system compared to immortalized cell lines. However, the post-mitotic nature of primary neurons prevents effective heterologous protein expression using common procedures such as electroporation or chemically-mediated transfection. Thus, other techniques must be employed in order to effectively express proteins in these non-dividing cells.
In this article, we describe the steps required to perform intranuclear injections of cDNA constructs into dissociated adult sympathetic neurons. This technique, which has been applied to different types of neurons, can successfully induce heterologous protein expression. The equipment essential for the microinjection procedure includes an inverted microscope to visualize cells, a glass injection pipet filled with cDNA solution that is connected to a N2(g) pressure delivery system, and a micromanipulator. The micromanipulator coordinates the injection motion of microinjection pipet with a brief pulse of pressurized N2 to eject cDNA solution from the pipet tip. 
This technique does not have the toxicity associated with many other transfection methods and enables multiple DNA constructs to be expressed at a consistent ratio. The low number of injected cells makes the microinjection procedure well suited for single cell studies such as electrophysiological recordings and optical imaging, but may not be ideal for biochemical assays that require a larger number of cells and higher transfection efficiencies. Although intranuclear microinjections require an investment of equipment and time, the ability to achieve high levels of heterologous protein expression in a physiologically relevant environment makes this technique a very useful tool to investigate protein function.

Direct intranuclear injection of cDNA is an effective transfection technique for post-mitotic cells. This method provides high levels of heterologous protein expression from single or multiple cDNA constructs and enables protein function to be studied in a physiologically relevant environment with a variety of single cell assays.

La microinyección de ADN en intranucleares disociada neuronas de mamíferos adultos

Primary neuronal cell cultures are valuable tools to study protein function since they represent a more biologically relevant system compared to ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

La diferenciación de células madre embrionarias en los precursores de oligodendrocitos

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Xenotransplantation of Human Stem Cells into the Chicken Embryo

The chicken embryo is a classical animal model for studying normal embryonic and fetal development and for xenotransplantation experiments to study the behavior of cells in a standardized in vivo environment. The main advantages of the chicken embryo include low cost, high accessibility, ease of surgical manipulation and lack of a fully developed immune system. Xenotransplantation into chicken embryos can provide valuable information about cell proliferation, differentiation and behavior, the responses of cells to signals in defined embryonic tissue niches, and tumorigenic potential. Transplanting cells into chicken embryos can also be a step towards transplantation experiments in other animal models. Recently the chicken embryo has been used to evaluate the neurogenic potential of human stem and progenitor cells following implantation into neural anlage1-6. In this video we document the entire procedure for transplanting human stem cells into the developing central nervous system of the chicken embryo. The procedure starts with incubation of fertilized eggs until embryos of the desired age have developed. The eggshell is then opened, and the embryo contrasted by injecting dye between the embryo and the yolk. Small lesions are made in the neural tube using microsurgery, creating a regenerative site for cell deposition that promotes subsequent integration into the host tissue. We demonstrate injections of human stem cells into such lesions made in the part of the neural tube that forms the hindbrain and the spinal cord, and into the lumen of the part of the neural tube that forms the brain. Systemic injections into extraembryonic veins and arteries are also demonstrated as an alternative way to deliver cells to vascularized tissues including the central nervous system. Finally we show how to remove the embryo from the egg after several days of further development and how to dissect the spinal cord free for subsequent physiological, histological or biochemical analyses.

In this paper we present a method for transplanting human stem cells into various regions of the central nervous system of the chicken embryo. This provides an in vivo model for assessing the proliferation and differentiation of various types of human stem cells in embryonic tissue environments.

Xenotrasplante de células madre humanas en el embrión de pollo

The chicken embryo is a classical animal model for studying normal embryonic and fetal development and for xenotransplantation experiments to study the ...

Analyzing the Function of Small GTPases by Microinjection of Plasmids into Polarized Epithelial Cells

Epithelial cells polarize their plasma membrane into biochemically and functionally distinct apical and basolateral domains where the apical domain faces the 'free' surfaces and the basolateral membrane is in contact with the substrate and neighboring cells. Both membrane domains are separated by tight junctions, which form a diffusion barrier. Apical-basolateral polarization can be recapitulated successfully in culture when epithelial cells such as Madin-Darby Canine Kidney (MDCK) cells are seeded at high density on polycarbonate filters and cultured for several days 1 2. Establishment and maintenance of cell polarity is regulated by an array of small GTPases of the Ras superfamily such as RalA, Cdc42, Rab8, Rab10 and Rab13 3 4 5 6 7. Like all GTPases these proteins cycle between an inactive GDP-bound state and an active GTP-bound state. Specific mutations in the nucleotide binding regions interfere with this cycling 8. For example, Rab13T22N is permanently locked in the GDP-form and thus dubbed 'dominant negative', whereas Rab13Q67L can no longer hydrolyze GTP and is thus locked in a 'dominant active' state 7. To analyze their function in cells both dominant negative and dominant active alleles of GTPases are typically expressed at high levels to interfere with the function of the endogenous proteins 9. An elegant way to achieve high levels of overexpression in a short amount of time is to introduce the plasmids encoding the relevant proteins directly into the nuclei of polarized cells grown on filter supports using microinjection technique. This is often combined with the co-injection of reporter plasmids that encode plasma membrane receptors that are specifically sorted to the apical or basolateral domain. A cargo frequently used to analyze cargo sorting to the basolateral domain is a temperature sensitive allele of the vesicular stomatitis virus glycoprotein (VSVGts045) 10. This protein cannot fold properly at 39&deg;C and will thus be retained in the endoplasmic reticulum (ER) while the regulatory protein of interest is assembled in the cytosol. A shift to 31&deg;C will then allow VSVGts045 to fold properly, leave the ER and travel to the plasma membrane 11. This chase is typically performed in the presence of cycloheximide to prevent further protein synthesis leading to cleaner results. Here we describe in detail the procedure of microinjecting plasmids into polarized cells and subsequent incubations including temperature shifts that allow a comprehensive analysis of regulatory proteins involved in basolateral sorting.

This article details the procedures involved in overexpression and analysis of small GTPases in polarized epithelial cells using microinjection technique.

El análisis de la función de las pequeñas GTPasas de la microinyección de plásmidos en células epiteliales polarizadas

Epithelial cells polarize their plasma membrane into biochemically and functionally distinct apical and basolateral domains where the apical domain faces ...

Efficient Differentiation of Mouse Embryonic Stem Cells into Motor Neurons

Direct differentiation of embryonic stem (ES) cells into functional motor neurons represents a promising resource to study disease mechanisms, to screen new drug compounds, and to develop new therapies for motor neuron diseases such as spinal muscular atrophy (SMA) and amyotrophic lateral sclerosis (ALS). Many current protocols use a combination of retinoic acid (RA) and sonic hedgehog (Shh) to differentiate mouse embryonic stem (mES) cells into motor neurons1-4. However, the differentiation efficiency of mES cells into motor neurons has only met with moderate success. We have developed a two-step differentiation protocol5 that significantly improves the differentiation efficiency compared with currently established protocols. The first step is to enhance the neuralization process by adding Noggin and fibroblast growth factors (FGFs). Noggin is a bone morphogenetic protein (BMP) antagonist and is implicated in neural induction according to the default model of neurogenesis and results in the formation of anterior neural patterning6. FGF signaling acts synergistically with Noggin in inducing neural tissue formation by promoting a posterior neural identity7-9. In this step, mES cells were primed with Noggin, bFGF, and FGF-8 for two days to promote differentiation towards neural lineages. The second step is to induce motor neuron specification. Noggin/FGFs exposed mES cells were incubated with RA and a Shh agonist, Smoothened agonist (SAG), for another 5 days to facilitate motor neuron generation. To monitor the differentiation of mESs into motor neurons, we used an ES cell line derived from a transgenic mouse expressing eGFP under the control of the motor neuron specific promoter Hb91. Using this robust protocol, we achieved 51&plusmn;0.8% of differentiation efficiency (n = 3; p &lt; 0.01, Student's t-test)5. Results from immunofluorescent staining showed that GFP+ cells express the motor neuron specific markers, Islet-1 and choline acetyltransferase (ChAT). Our two-step differentiation protocol provides an efficient way to differentiate mES cells into spinal motor neurons.

We developed a new protocol to improve efficiency of in vitro differentiation of mouse embryonic stem cells into motor neurons. The differentiated ES cells acquired motor neurons features as evidenced by expression of neuronal and motor neuron markers using immunohistochemical techniques.

La diferenciación eficiente de las células madre embrionarias de ratón en neuronas motoras

Direct differentiation of embryonic stem (ES) cells into functional  motor neurons represents a promising resource to study disease mechanisms, to  screen ...

A System for ex vivo Culturing of Embryonic Pancreas

The pancreas controls vital functions of our body, including the production of digestive enzymes and regulation of blood sugar levels1. Although in the past decade many studies have contributed to a solid foundation for understanding pancreatic organogenesis, important gaps persist in our knowledge of early pancreas formation2. A complete understanding of these early events will provide insight into the development of this organ, but also into incurable diseases that target the pancreas, such as diabetes or pancreatic cancer. Finally, this information will generate a blueprint for developing cell-replacement therapies in the context of diabetes.
 During embryogenesis, the pancreas originates from distinct embryonic outgrowths of the dorsal and ventral foregut endoderm at embryonic day (E) 9.5 in the mouse embryo3,4. Both outgrowths evaginate into the surrounding mesenchyme as solid epithelial buds, which undergo proliferation, branching and differentiation to generate a fully mature organ2,5,6. Recent evidences have suggested that growth and differentiation of pancreatic cell lineages, including the insulin-producing &beta;-cells, depends on proper tissue-architecture, epithelial remodeling and cell positioning within the branching pancreatic epithelium7,8. However, how branching morphogenesis occurs and is coordinated with proliferation and differentiation in the pancreas is largely unknown. This is in part due to the fact that current knowledge about these developmental processes has relied almost exclusively on analysis of fixed specimens, while morphogenetic events are highly dynamic.
 Here, we report a method for dissecting and culturing mouse embryonic pancreatic buds ex vivo on glass bottom dishes, which allow direct visualization of the developing pancreas (Figure 1). This culture system is ideally devised for confocal laser scanning microscopy and, in particular, live-cell imaging. Pancreatic explants can be prepared not only from wild-type mouse embryos, but also from genetically engineered mouse strains (e.g. transgenic or knockout), allowing real-time studies of mutant phenotypes. Moreover, this ex vivo culture system is valuable to study the effects of chemical compounds on pancreatic development, enabling to obtain quantitative data about proliferation and growth, elongation, branching, tubulogenesis and differentiation. In conclusion, the development of an ex vivo pancreatic explant culture method combined with high-resolution imaging provides a strong platform for observing morphogenetic and differentiation events as they occur within the developing mouse embryo.

A System for ex vivo Culturing of Embryonic Pancreas

Here, we describe a method for isolation, culture and manipulation of mouse embryonic pancreas. This represents an excellent ex vivo system for studying various aspects of pancreatic development, including morphogenesis, differentiation and growth. Pancreatic bud explants can be cultured for several days and used in a range of different applications, including whole-mount immunofluorescence and live imaging.

Un sistema para la<em&gt; Ex vivo</em&gt; Cultivo de páncreas embrionario

The pancreas controls vital functions of our body,  including the production of digestive enzymes and regulation of blood sugar  levels1. Although in the ...

Gene Transfer into Older Chicken Embryos by ex ovo Electroporation

The chicken embryo provides an excellent model system for studying gene function and regulation during embryonic development. In ovo electroporation is a powerful method to over-express exogenous genes or down-regulate endogenous genes in vivo in chicken embryos1. Different structures such as DNA plasmids encoding genes2-4, small interfering RNA (siRNA) plasmids5, small synthetic RNA oligos6, and morpholino antisense oligonucleotides7 can be easily transfected into chicken embryos by electroporation. However, the application of in ovo electroporation is limited to embryos at early incubation stages (younger than stage HH20 - according to Hamburg and Hamilton)8 and there are some disadvantages for its application in embryos at later stages (older than stage HH22 - approximately 3.5 days of development). For example, the vitelline membrane at later stages is usually stuck to the shall membrane and opening a window in the shell causes rupture of the vessels, resulting in death of the embryos; older embryos are covered by vitelline and allantoic vessels, where it is difficult to access and manipulate the embryos; older embryos move vigorously and is difficult to control the orientation through a relatively small window in the shell.
In this protocol we demonstrate an ex ovo electroporation method for gene transfer into chicken embryos at late stages (older than stage HH22). For ex ovo electroporation, embryos are cultured in Petri dishes9 and the vitelline and allantoic vessels are widely spread. Under these conditions, the older chicken embryos are easily accessed and manipulated. Therefore, this method overcomes the disadvantages of in ovo electroporation applied to the older chicken embryos. Using this method, plasmids can be easily transfected into different parts of the older chicken embryos10-12.

Gene Transfer into Older Chicken Embryos by ex ovo Electroporation

A method of gene transfer into chicken embryos at later incubation stages (older than Hamburger and Hamilton stage (HH) 22) is described. This method overcomes disadvantages of in ovo electroporation applied to older chicken embryos and is a useful technique to study gene function and regulation at older developmental stages.

Transferencia de genes en embriones de pollo por los mayores<em&gt; Ex ovo</em&gt; La electroporación

The chicken embryo provides an  excellent model system for studying gene function and regulation during  embryonic development. In ovo electroporation is ...

Dissecting Mechanoenzymatic Properties of Processive Myosins with Ultrafast Force-Clamp Spectroscopy

Ultrafast force-clamp spectroscopy (UFFCS) is a single molecule technique based on laser tweezers that allows the investigation of the chemomechanics of both conventional and unconventional myosins under load with unprecedented time resolution. In particular, the possibility to probe myosin motors under constant force right after the actin-myosin bond formation, together with the high rate of the force feedback (200 kHz), has shown UFFCS to be a valuable tool to study the load dependence of fast dynamics such as the myosin working stroke. Moreover, UFFCS enables the study of how processive and non-processive myosin-actin interactions are influenced by the intensity and direction of the applied force.
By following this protocol, it will be possible to perform ultrafast force-clamp experiments on processive myosin-5 motors and on a variety of unconventional myosins. By some adjustments, the protocol could also be easily extended to the study of other classes of processive motors such as kinesins and dyneins. The protocol includes all the necessary steps, from the setup of the experimental apparatus to sample preparation, calibration procedures, data acquisition and analysis.

Presented here is a comprehensive protocol to perform ultrafast force-clamp experiments on processive myosin-5 motors, which could be easily extended to the study of other classes of processive motors. The protocol details all the necessary steps, from the setup of the experimental apparatus to sample preparation, data acquisition and analysis.

Disección de las propiedades mecanoenzimáticas de miosinas procesivas con espectroscopia ultrarrápida de pinza de fuerza

Ultrafast force-clamp spectroscopy (UFFCS) is a single molecule technique based on laser tweezers that allows the investigation of the chemomechanics of ...