Los autores se financian con el Corus, Inscripción MedSys celular, cadena y proyectos de Resina.

El protocolo se resume en la figura. 4. 1. Colección de muestras de sangre <ol><li> Recoge al menos 3 ml de sangre en tubos con EDTA en el centro clínico. </li><li> Las muestras se pueden almacenar hasta por una semana a 4 ° C. </li><li> Envíe las muestras de sangre con EDTA, lo antes posible al laboratorio por correo ordinario. </li></ol> 2. Aislamiento de ARN de VIH y / o ADN <ol><li> Obtener ARN viral y / o de ADN de 1000 l de sangre entera, suero o plasma, utilizando el MagNA Pure Aislamiento compacto Nucleic Acid I kit I y el MagNA Pure sistema compacto. </li><li> Eluir el ganado ARN o ADN en 50 l de tampón TE. Alternativamente, otros procedimientos de purificación de ácidos nucleicos pueden ser utilizados. </li></ol> 3. La amplificación de la región env Amplificar la región env (Figs. 2 y 4) o bien a partir de plasma de ARN o ADN proviral. A 1245 bp de largo producto, que comprende la mayoría de la proteína Env (nt 6556-7811 according a HXB2) se genera. <ol><li> RNA de muestras: RT-PCR <ol><li> Viral ARN presenta una estructura secundaria muy complejo (Fig. 4) que puede dificultar la reacción de RT. Para evitar este problema, incubar 10 ARN mu l a 65 ° C durante 10 minutos (ya en el tubo de PCR y PCR en la máquina) y luego reducir la temperatura a 50 ° C. </li><li> Añadir 40 l de la mezcla maestra de PCR incluyendo los cebadores Env-F y R-Env. Master Mix para la RT-PCR In-House-System: <table border="1"><tbody><tr><td></td><td> volumen / reacción (l) </td><td> concentración final </td></tr><tr><td> RNasa libre de H 2 O </td><td> 14,4 </td><td></td></tr><tr><td> Tampón 5x (Qiagen OneStep RT-PCR Kit) </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Solution </td><td> 10 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM cada uno) </td> &lt;td&gt; 2 </td><td> 400 mM de cada dNTP </td></tr><tr><td> Enzym-Mix (Qiagen OneStep RT-PCR Kit) </td><td> 2 </td><td></td></tr><tr><td> Primer Env-F (100 mM) </td><td> 0,3 </td><td> 0,6 mM </td></tr><tr><td> Primer Env-R (100 M) </td><td> 0,3 </td><td> 0,6 mM </td></tr><tr><td> Inhibidor de RNasa (RNasin) </td><td> 1 </td><td> 5 unidades / reacción </td></tr></tbody></table> Env-F: 5&#39;-3 &#39;(CAAAGCCTAAAGCCATGTGTAAA nt 6556 → 6586 de acuerdo con HXB2) Env-R: 5&#39;-3 &#39;(AGTGCTTCCTGCTGCTCCTAAGAACCC nt 7785 ← 7811) </li><li> Ejecutar la reacción RT a 50 º C durante 30 minutos. </li><li> Ejecutar la primera PCR de la siguiente manera: <table border="1"><tbody><tr><td> 95 ° C, 15min </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 seg 50 ° C, 30 seg 72 ° C, 2 min </td&gt; <td> 1 x </td></tr><tr><td> 95 ° C, 30 seg 56 ° C, 30 seg 72 ° C, 2 min </td><td> 38 x </td></tr><tr><td> 72 ° C, 10 min 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol></li><li> Las muestras de ADN PCR: reacción Para muestras de ADN proviral, no inicial de reacción de RT se necesita, y la reacción de PCR puede iniciar directamente. <ol><li> Añadir 40 l de PCR Master Mix a 10 l de ADN Provial. Master Mix para PCR In-House-System: <table border="1"><tbody><tr><td></td><td> volumen / reacción (l) </td><td> concentración final </td></tr><tr><td> RNasa libre de H 2 O </td><td> 15,4 </td><td></td></tr><tr><td> Tampón 5x (Polimerasa HotStarTaq ADN) </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Solution </td><td> 10 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM cada uno) </td><td> 2 </td><td> 400 mM de cada dNTP </td></tr><tr><td> Enzym-Mix (Polymerase HotStarTaq ADN) </td><td> 2 </td><td></td></tr><tr><td> Primer Env-F (100 mM) </td><td> 0,3 </td><td> 0,6 mM </td></tr><tr><td> Primer Env-R (100 M) </td><td> 0,3 </td><td> 0,6 mM </td></tr></tbody></table> Env-F: 5&#39;-3 &#39;(CAAAGCCTAAAGCCATGTGTAAA nt 6556 → 6586) Env-R: 5&#39;-3 &#39;(AGTGCTTCCTGCTGCTCCTAAGAACCC nt 7785 ← 7811) </li><li> Ejecutar las condiciones de PCR descritas anteriormente para las muestras de ARN (Paso 3.1.4). </li></ol></li></ol> 4. La amplificación de la región V3: PCR anidada <ol><li> Para la PCR anidada, utilizar 5 l de la primera reacción de PCR (sin análisis previo en gel de agarosa) como plantilla y añadir 95 l de PCR MasMezclar ter. Master Mix para Nested-PCR In-House <table border="1"><tbody><tr><td></td><td> volumen / reacción (l) </td><td> concentración final </td></tr><tr><td> H 2 O </td><td> 61,9 </td><td></td></tr><tr><td> 10x tampón PCR </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Solution </td><td> 20 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM cada uno) </td><td> 2 </td><td> 200 mM de cada dNTP </td></tr><tr><td> Primer Env-2F (100 mM) </td><td> 0,3 </td><td> 0,6 mM </td></tr><tr><td> Primer Env-2R (100 M) </td><td> 0,3 </td><td> 0,6 mM </td></tr><tr><td> ADN Polimerasa HotStarTaq </td><td> 0,5 </td><td> 2,5 unidades / reacción </td></tr></tbody></table> Env-2F: 5&#39;-3 &#39;(GTCCAAAGGTATCCTTTGAGCCAATTC nt 6838 → 6864) <strong&gt; Env-2R: 5&#39;-3 &#39;(CACCACTCTTCTCTTTGCCTTGGTGGGTGC nt 7712 ← 7742) </li><li> Ejecutar la PCR de la siguiente manera: <table border="0"><tbody><tr><td> 93 ° C, 15min </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 seg 50 ° C, 30 seg 72 ° C, 90 seg </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 seg 56 ° C, 30 seg 72 ° C, 90 seg </td><td> 43 x </td></tr><tr><td> 72 ° C, 10 min 4 ° C ∞ </td><td></td></tr></tbody></table></li><li> Analizar el producto de PCR en un gel de agarosa al 1% (Fig. 4). El producto esperado es 902 bp de largo. </li><li> La purificación de las muestras de secuenciación. <ol><li> Se purifica el producto de PCR con el Qiagen PCR kit de purificación, utilizando el protocolo, soluciones y columnas micro-suministrado por el proveedor. Eluir en 30-100 l tampón PE, en función de la intensidad de la banda. </li><li> Alternativamente, las muestras pueden purificarse usando ExonucleasaI y Fast AP (Thermo fosfatasa alcalina). Para este propósito, añadir 6 l Exo-AP Mix a 15 l de producto de PCR y se incuba 15 minutos a 37 ° C. <table border="1"><tbody><tr><td> 580 l H 2 O </td></tr><tr><td> 66 l rápido AP </td></tr><tr><td> 13,4 l I Exo </td></tr></tbody></table></li></ol></li></ol> 5. Secuencia de reacción de la amplificación V3 <ol><li> La secuencia de reacción consiste en una reacción de PCR usando sólo uno de los cebadores siguientes: Env-2: 5&#39;-GTACAATGYACACATGGAATTAGGC -3 (nt 6959 → 6980) Env-5: 5&#39;-AAAATTCCCCTCCACAATTA - 3 &#39;(nt 7352 ← 7371) Env-6: 5&#39;-GGCCAGTAGTATCAACTCAAC - 3 &#39;(nt 6979 → 7000) Env-7: 5&#39;-TGTCCACTGATGGGAGGGGC - 3 &#39;(nt 7530 ← 7549) Env-10: 5 &#39;- GCAGAATAAAACAAATTATAAACATGTGGC - 3&#39; (nt 7478 ← 7507) Env-11: 5 &#39;- TACATTGCTTTTCCTACTTTCTGCCAC - 3&#39; (nt 7638 ← 7664) Cebadores de primera elección son: Env-2, Env-6 o 7-Env, Env-11 </li><li> Usar 1 l del amplicón V3 purificado como molde y añadir 9 l de mezcla maestra de PCR. Secuenciación Mix Master: <table border="1"><tbody><tr><td> 4 mix secuencia l (VIH-Genotipado Kit) </td></tr><tr><td> 4 l H 2 O </td></tr><tr><td> 1 Primer l (100 pmol / l) </td></tr></tbody></table></li><li> Ejecutar la secuencia de reacción como sigue: <table border="0"><tbody><tr><td> 96 ° C, 10 seg </td><td></td></tr><tr><td> 50 ° C, 10 seg </td><td> 36 x </td></tr><tr><td> 60 ° C, 45 seg </td><td></td></tr><tr><td> 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol> 6. La purificación de las muestras de secuenciación Purificar secuencias using Sephadex G-50 superfino. <ol><li> Rellene el número adecuado de pozos en el &quot;cargador columna&quot; con Sephadex G-50 superfino. Transferir el Sephadex al MAHVN4510 placa de filtro, girando de nuevo. </li><li> Añadir 300 l Milli-Q H 2 O a cada pocillo de la placa de filtro, y se incuba durante al menos 3 horas a 2-8 º C. </li><li> Centrifugar las placas durante 5 min a 910Xg y 4-15 ° C. Desechar el flujo a través. </li><li> Añadir 10 l de H 2 O para el producto secuencia y luego pipeta de la secuencia de la placa se hinchó Sephadex. </li><li> Para obtener el producto purificado, se centrifuga la placa durante 5 min. a 910Xg y 4-15 ° C y se recoge el flujo a través. </li></ol> 7. La secuenciación de las muestras purificadas en el secuenciador ABI Prism 3130 XL <ol><li> Antes de cada ejecución, cambiar el tampón y comprobar el volumen del polímero (POP7). Si es necesario, reemplazar el matraz polímero viejo por uno nuevo. </li><li> Utilice las condiciones de ejecución guardados, incluyendo un tiempo de inyección de 18 segundos. </li><li> En esta máquina, la recopilación de los datos de la señal de un ensayo con 16 muestras de la secuencia tarda aproximadamente 60 min (36 cm capilar) o 150 min (50 cm capilar). </li></ol> 8. Secuencia de edición <ol><li> Utilice el programa Lasergene (ADN-Star) para alinear y editar las secuencias (Fig. 5). Otros programas de edición de secuencias puede ser utilizado. Use un &quot;Consenso V3-B&quot; y la secuencia de consenso env como referencias. </li><li> Lasergene crea una secuencia de consenso de la muestra analizada utilizando todos los datos disponibles primas y almacenarlo como archivo FASTA. El archivo FASTA es un archivo de texto que incluye un encabezado con el nombre de la muestra y la secuencia de nucleótidos. </li></ol> 9. Secuenciación interpretación de los datos y la predicción tropismo <ol><li> Secuenciación interpretación de los datos se realiza por el sistema de interpretación basado en la web geno2pheno [correceptor] ( <a href="http://coreceptor.bioinf.mpi-inf.mpg.de/index.php">http://coreceptor.bioinf.mpi-inf.mpg.de/</a>index.php). Para la predicción de tropismo, diferentes ajustes de IPA pueden ser seleccionados. La configuración por defecto es de acuerdo a las directrices de terapia alemana-austriaca. Para FPR ≥ 20%, el virus se clasifica como R5 cuando FPR ≥ 20% y X4 para FPR &lt;12,5%. </li><li> Cargue el archivo FASTA en el servidor. Este servidor traduce la secuencia de nucleótidos en aminoácidos, lo alinea con la secuencia consenso de V3-B y produce una clasificación subtipo. Además, se genera una predicción del uso del correceptor (Fig. 4) expresado como tasa de falsos positivos (FPR). </li></ol> 10. Los resultados representativos El geno2pheno [correceptor] salida muestra una interpretación nivelada de la tropismo. En función de la probabilidad de que el uso del correceptor, el texto de la interpretación y el color de fondo varía de verde (FPR &lt;20%), lo que sugiere una administración segura para MVC, al amarillo, lo que sugiere un posible riesgo, bajo y finalmente a rojo. El rojo es el color sugierenING no prescribir MVC. Además, el servidor genera un informe pdf que se puede imprimir, se rellenó con paciente y datos de la muestra, y se envía al médico. Ejemplos de geno2pheno salida [correceptor] se representan en la figura. 6. <img alt="Figura 1" src="/files/ftp_upload/3264/3264fig1.jpg" /> Figura. 1. Esquema de la replicación del VIH. El virión debe de unirse a las células CD4 celulares como receptor, y bien en el CCR5 o CXCR4 como correceptor. El correceptor CCR5 puede bloquearse con antagonistas del CCR5 maraviroc (MVC como, Celsentri, Selzentry). Después de la fusión de las membranas viral y celular, la nucleocápside viral se libera en el citoplasma. La nucleocápside desmonta y el complejo ARN viral se libera en el citoplasma. La transcriptasa inversa viral (RT) transcribe el ARN genómico en ADN proviral, que después se transporta al núcleo y se integra en el genoma del huésped por la integrasa del VIH. RNA polimerasas celulares transcribe genómico viral y ARN mensajeros a partir del genoma proviral. Las proteínas virales se produce en el citoplasma y se transportan a la superficie celular. Las partículas de virus brote como inmaduras, no infecciosas viriones de las células. La proteasa del VIH escinde las proteínas productoras de partículas infecciosas. La inhibición de uno de los pasos conduce a una interrupción del ciclo de replicación. Los medicamentos antirretrovirales y el paso que inhiben la replicación están marcados en rojo. El ARN viral y el ADN proviral (material utilizado para el análisis de tropismo o resistencia) están marcadas en verde. <img alt="Figura 2" src="/files/ftp_upload/3264/3264fig2.jpg" /> Figura 2. Genoma proviral del VIH. La partícula de VIH está construido con diferentes proteínas estructurales y casas de varias enzimas y de proteínas, tanto de origen viral y celular. El programa figuras la localización de los genes en el genoma viral. La superficie de las proteínas gp120 y gp41 constituyen los puntos en la superficie del virión y en contacto con la célula humana para llevar a cabo la fusión de la membrana. En la parte inferior de la figura, los productos de amplificación de PCR y los cebadores utilizados en el protocolo se muestran. <img alt="Figura 3" src="/files/ftp_upload/3264/3264fig3.jpg" /> Figura 3. Proporción de pacientes con baja carga viral (CV) mediciones analizadas para resistencia a las drogas o la determinación de tropismo en el Instituto de Virología de la Universidad de Colonia (Alemania). <img alt="Figura 4" src="/files/ftp_upload/3264/3264fig4.jpg" /> Figura 4. Esquema general del experimento .. Por favor <a href="http://www.jove.com/files/ftp_upload/3264/3264fig4_lg.jpg">haga clic aquí</a> para ver una versión más grande de esta cifra. <img alt="Figura 5" src="/files/ftp_upload/3264/3264fig5.jpg" /> Figura 5. Secuencia de edición con Lasergene. El amplicón V3 se secuencia con al menos un avance y un cebador inverso. Lasergene alignés los &quot;abi&quot;. Archivos obtenidos desde el secuenciador con la referencia de secuencias &quot;Consenso V3-B&quot; y env. Lasergene crea una secuencia de consenso con todos los datos de fila disponibles. Las secuencias de referencia puede ser marcado (y luego se muestran en gris) a fin de que no contribuyen a la secuencia de consenso de la muestra. <img alt="La figura 6" src="/files/ftp_upload/3264/3264fig6.jpg" /> Figura 6. Informes tropismo de predicción generados por el geno2pheno [correceptor] tool.The informes se generan en formato pdf que se pueden guardar y terminado en el ordenador. Datos adicionales de nombres tales paciente nos, la fecha de extracción de sangre, etc, pueden ser incluidos de forma manual utilizando un programa de grabación de pdf. Observaciones específicas pueden ser también añadido. These Los datos se encuentran exclusivamente en el ordenador del usuario y no en el servidor geno2pheno [correceptor]. Por favor <a href="http://www.jove.com/files/ftp_upload/3264/3264fig6_lg.jpg">haga clic aquí</a> para ver una versión más grande de esta cifra.

<ol>
	<li>Heger, E., Schuelter, E., Klimkait, T., Lengauer, T., Kaiser, R., Walter, H., Sierra, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+coreceptor+proficiency+panel+test.">European coreceptor proficiency panel test.</a> , (2011).</li><li>Lengauer, T., Sander, O., Sierra, S., Thielen, T., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatic+prediction+of+HIV+coreceptor+usage.">Bioinformatic prediction of HIV coreceptor usage.</a> Nature Biotech. 25 (12), 1407-1410 (2007).</li><li>McGovern, R., Dong, W., Zhong, X., Knapp, D., Thielen, A., Chapman, D., Lewis, M., James, I., Valdez, H., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Population-based+Sequencing+of+the+V3-loop+Is+Comparable+to+the+Enhanced+Sensitivity+Trofile+Assay+in+Predicting+Virologic+Response+to+Maraviroc+of+Treatment-na+ve+Patients+in+the+MERIT+Trial.">Population-based Sequencing of the V3-loop Is Comparable to the Enhanced Sensitivity Trofile Assay in Predicting Virologic Response to Maraviroc of Treatment-na ve Patients in the MERIT Trial.</a> , (2010).</li><li>Reuter, S., Braken, P., Jensen, B., Sierra-Aragon, S., Oette, M., Balduin, M., Kaiser, R., Haussinger, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maraviroc+in+treatment-experienced+patients+with+HIV-1+infection+-+experience+from+routine+clinical+practice.">Maraviroc in treatment-experienced patients with HIV-1 infection - experience from routine clinical practice.</a> Eur. J. Med. Res. 15 (6), 231-237 (2010).</li><li>Recordon-Pinson, P., Soulie, C., Flandre, P., Descamps, D., Lazrek, M., Charpentier, C., Montes, B., Trabaud, M. A., Cottalorda, J., Schneider, V., Morand-Joubert, L., Tamalet, C., Desbois, D., Mace, M., Ferre, V., Vabret, A., Ruffault, A., Pallier, C., Raymond, S., Izopet, J., Reynes, J., Marcelin, A. G., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+genotypic+prediction+of+HIV-1+coreceptor+use+versus+a+phenotypic+assay+and+correlation+with+the+virological+response+to+maraviroc:+the+ANRS+GenoTropism+study.">Evaluation of the genotypic prediction of HIV-1 coreceptor use versus a phenotypic assay and correlation with the virological response to maraviroc: the ANRS GenoTropism study.</a> Antimicrob. Agents. Chemother. 54 (8), 3335-3340 (2010).</li><li>Swenson, L. C., Knapp, D., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+and+accuracy+of+the+geno2pheno+co-receptor+algorithm+for+predicting+HIV+tropism+for+single+and+triplicate+measurements+of+V3+genotype.">Calibration and accuracy of the geno2pheno co-receptor algorithm for predicting HIV tropism for single and triplicate measurements of V3 genotype.</a> , (2010).</li><li>Macartney, M. J., Cameron, J., Strang, A., Garc&#237;a, A., Booth, C., Marshall, N., Johnson, M., Geretti, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+a+genotypic+assay+for+the+prediction+of+HIV-1+coreceptor+tropism+and+guiding+the+use+of+CCR5+antagonists+in+clinical+practice.">Use of a genotypic assay for the prediction of HIV-1 coreceptor tropism and guiding the use of CCR5 antagonists in clinical practice.</a> , (2010).</li><li>Sierra, S., Thielen, A., Reuter, S., Jensen, B., Esser, S., F&#228;tkenheuer, G., Lengauer, T., Pfister, H., Sichtig, N., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+determination+and+clinical+outcome+of+61+patients+under+MVC+treatment.">Tropism determination and clinical outcome of 61 patients under MVC treatment.</a> , (2010).</li><li>Obermeier, M., Carganico, A., Bieniek, B., Schleehauf, D., Dupke, S., Fischer, K., Freiwald, M., Neifer, S., Schuler, C., Mayr, C., Klausen, G., K&#246;ppe, S., &#252;&#252;nsche, T., Berg, T., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+testing+from+proviral+DNA+-+analysis+of+a+subgroup+from+the+Berlin+Maraviroc+cohort.">Tropism testing from proviral DNA - analysis of a subgroup from the Berlin Maraviroc cohort.</a> , (2010).</li><li>Vandekerckhove, L. P., Wensing, A. M., Kaiser, R., Brun-Vezinet, F., Clotet, B., De Luca, A., Dressler, S., Garcia, F., Geretti, A. M., Klimkait, T., Korn, K., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+guidelines+on+the+clinical+management+of+HIV-1+tropism+testing.">European guidelines on the clinical management of HIV-1 tropism testing.</a> Lancet Infect Dis. 11 (5), 394-407 (2011).</li><li>Walter, H., Eberle, J., M&#246;ller, H., Noah, C., Wolf, E., St rmer, M., Braun, P., Krn, K., D umer, M., Berg, T., Obermeier, M., Thielen, A., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empfehlung+zur+Bestimmung+des+HIV-1-Korezeptor-Gebrauchs+(DAIG+Recommendations+for+the+HIV-1+tropism+testing).">Empfehlung zur Bestimmung des HIV-1-Korezeptor-Gebrauchs (DAIG Recommendations for the HIV-1 tropism testing).</a> , (2011).</li><li>Obermeier, M. J., Carganico, A., Dupke, S., Schranz, D., Cordes, C., Freiwald, M., Klausen, G., K&#246;ppe, S., Schuler, C., Mayr, C., Schleehauf, D., Berg, T., Krznaric, I., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+application+of+genotypic+co-receptor+tropism+testing+from+viral+RNA+and+proviral+DNA:+week+24+analysis+of+the+Berlin+maraviroc+cohort.">Clinical application of genotypic co-receptor tropism testing from viral RNA and proviral DNA: week 24 analysis of the Berlin maraviroc cohort.</a> Journal of the International AIDS Society. 13, 129-129 (2010).</li><li>Toma, J., Frantzell, A., Hoh, R., Martin, J., Deeks, S., Petropoulos, C., Huang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+HIV-1+Co-receptor+Tropism+Using+PBMC+Proviral+DNA+Derived+from+Aviremic+Blood+Samples.">Determining HIV-1 Co-receptor Tropism Using PBMC Proviral DNA Derived from Aviremic Blood Samples.</a> , (2010).</li></ol>

Este artículo es patrocinado por vídeo ViiV Healthcare y GlaxoSmithKline.

La secuencia V3 permite una predicción fiable tropismo viral, tal como se muestra en los estudios clínicos 3-9. De hecho, la determinación genotípica se contempla en las directrices actuales Europeas y el alemán austriaco-10. En comparación con la prueba fenotípica, no sólo es el tiempo de rotación más corta (equivalente a la prueba de resistencia), pero también son los costes. Además, una ventaja importante de la prueba genotípica es que los resultados se clasifican como FPR y por lo tanto se puede adaptar a las necesidades de los pacientes. Resultados Trofile, por otro lado, son simplemente informes R5 o X4, y el acceso a los datos en bruto no se da. En la actualidad, las directrices europeas sugieren un FPR de corte del 20 al 10%, mientras que las directrices austriaco-alemanas permiten la adaptación del FPR de corte específicamente a las necesidades de cada paciente 11. En esta línea, en pacientes con una amplia gama de opciones de medicamentos antirretrovirales, mayor FPR puntos de corte (&gt; 20%) son recomterminado. A la inversa, para la reducción de pacientes tratados previamente con opciones terapéuticas limitadas, inferior FPR cut-off (&gt; 5%) puede ser utilizado. Este tipo de orientación es la terapia actualmente en curso por el análisis de resistencia a los NRTI, NNRTI, IP, y INIS, donde los fármacos parcialmente activos pueden ser incluidos en el tratamiento de pacientes con reducción de las opciones terapéuticas. Además, con el creciente número de cambios de terapia genotípicamente guiadas, la clínica relevante FPR cortes son constantemente ajustados por un grupo de bioinformáticos, virólogos y médicos. Otra ventaja importante de la prueba de tropismo genotípico es la posibilidad de analizar muestras clínicas con carga viral muy baja o incluso indetectable (VL). En estos casos, cuando el plasma de ARN no es amplificable, el ADN proviral puede ser secuenciado y utilizado para predicciones fiables 9,12. Es de destacar que el número de pacientes con carga viral baja o indetectable ha aumentado considerablemente en los últimos años. Hasta la fecha, el Terfil ensayo sólo permite el análisis de muestras de pacientes con CV &lt;1000 copias / ml. Sin embargo, estudios preliminares han demostrado que el ADN proviral se puede también Adecuar a ser probado por Trofile 13.

<table border="1"><tbody><tr><td> Nombre del reactivo </td><td> Empresa </td><td> Número de catálogo </td><td> Comentarios </td></tr><tr><td> MagNA Pure compacto Nucleic Acid Isolation Kit I </td><td> Roche Diagnostics </td><td> 04 802 993 001 </td><td></td></tr><tr><td> MagNA sistema compacto Pure </td><td> Roche Diagnostics </td><td> 03731146001 </td><td></td></tr><tr><td> T3000 termociclador </td><td> Biometra </td><td> 050-723 </td><td></td></tr><tr><td> One Step RT-PCR Kit </td><td> Qiagen </td><td> 210215 </td><td></td></tr><tr><td> HotStarTaq Master Mix Kit </td><td> Qiagen </td><td> 203445 </td><td></td></tr><tr><td> QIAquick PCR Purification Kit </td><td> Qiagen </td><td> 28106 </td><td></td></tr><tr><td> Exonucleasa I (Exo I) </td><td> Fermentas </td><td> EN0582 </td><td></td></tr><tr><td> Fastap fosfatasa alcalina termosensible </td><td> Fermentas </td><td> EF0651 </td> &lt;td&gt; </td></tr><tr><td> BigDye Terminator v3.1 Cycle Sequencing Kit </td><td> Applied Biosystems </td><td> 4337457 </td><td></td></tr><tr><td> Sephadex G-50 Superfine </td><td> GE Healthcare </td><td> 17-0041-01 </td><td></td></tr><tr><td> ABI Prism 3130 secuenciador capilar XL </td><td> Applied Biosystems </td><td> 3130XL </td><td></td></tr></tbody></table>

prediction of hiv-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach

Maraviroc (MVC) es el primer fármaco antirretroviral con licencia de la clase de los antagonistas de correceptores. Se une a la acogida del correceptor CCR5, que es utilizado por la mayoría de las cepas de VIH con el fin de infectar a las células inmunes humanas (Fig. 1). Otros aislados de VIH utilizar un co-receptor diferente, el CXCR4. Receptor que se utiliza, se determina en el virus por la proteína Env (Fig. 2). Dependiendo del correceptor utilizado, los virus se clasifican como R5 o X4, respectivamente. MVC se une al receptor CCR5 inhibiendo la entrada de virus R5 en la célula diana. Durante el curso de la enfermedad, los virus X4 pueden surgir y superar los virus R5. Determinación del uso del correceptor (también llamado tropismo) es por tanto obligatoria antes de la administración de MVC, según lo exigido por EMA y FDA. Los estudios de eficacia MVC MOTIVAR, MERIT y 1029 se han realizado con el ensayo Trofile de Monogram, San Francisco, EE.UU. Se trata de un ensayo de alta calidad basado en sophisticated pruebas recombinantes. La aceptación de esta prueba para la rutina diaria es bastante baja fuera de los EE.UU., ya que los médicos europeos que tienden a trabajar con laboratorios especializados descentralizados, que también proporcionan pruebas de resistencia concomitante. Estos laboratorios han sido objeto de varias evaluaciones de control de calidad, la última que se presenta en 2011 1. Desde hace varios años, se han realizado determinaciones de tropismo sobre la base de análisis de secuencias del VIH env-V3 región del gen (V3) 2. Esta región lleva la información suficiente para realizar una predicción fiable. La determinación genotípica del uso del correceptor presenta ventajas tales como: tiempo de rotación corta (equivalente a las pruebas de resistencia), reducir los costos, la posibilidad de adaptar los resultados a las necesidades de los pacientes y la posibilidad de analizar muestras clínicas con carga viral muy baja o incluso indetectable (VL ), sobre todo porque el número de muestras analizadas con CV &lt;1000 copias / laproximadamente aumentado en los últimos años (Fig. 3). Los pasos principales para las pruebas de tropismo (Fig. 4) demuestra en este vídeo: 1. Recolección de una muestra de sangre 2. El aislamiento del ARN de VIH a partir del plasma y / o ADN proviral del VIH a partir de células mononucleares de sangre 3. La amplificación de la región env 4. La amplificación de la región V3 5. Secuencia de reacción de la amplificación V3 6. La purificación de las muestras de secuenciación 7. La secuenciación de las muestras purificadas 8. Secuencia de edición 9. Secuenciación interpretación de los datos y la predicción tropismo

Watch this Scientific Journal Video about Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach at JoVE.com

Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

La predicción del uso del correceptor del VIH-1 es necesaria para la administración de una nueva clase de fármacos antirretrovirales, es decir, antagonistas de correceptores. Se puede realizar por análisis de la secuencia de la<em&gt; Env</em&gt; Génica y la posterior interpretación a través de un sistema basado en internet interpretación (geno2pheno<sub&gt; [Correceptor]</sub&gt;).

Predicción del VIH-1 usos correceptor (tropismo) por análisis de secuencia utilizando un enfoque genotípica

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by ...

<a class="grey_button" href="http://www.jove.com/video/4153"> Espa&ntilde;ol </a>

prediction-hiv-1-coreceptor-usage-tropism-sequence-analysis-using

Research

JoVE Journal

Immunology and Infection

Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach

13.1K vistas.  University of Cologne.  Español 

Video: Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' surface envelope glycoprotein. We previously proposed that the crown of the V3 loop, although dynamic and sequence variable, is constrained throughout the population of HIV-1 viruses to an immunologically relevant &beta;-hairpin tertiary structure. Importantly, there are thousands of different V3 loop crown sequences in circulating HIV-1 viruses, making 3D structural characterization of trends across the diversity of viruses difficult or impossible by crystallography or NMR. Our previous successful studies with folding of the V3 crown1, 2 used the ab initio algorithm 3 accessible in the ICM-Pro molecular modeling software package (Molsoft LLC, La Jolla, CA) and suggested that the crown of the V3 loop, specifically from positions 10 to 22, benefits sufficiently from the flexibility and length of its flanking stems to behave to a large degree as if it were an unconstrained peptide freely folding in solution. As such, rapid ab initio folding of just this portion of the V3 loop of any individual strain of the 60,000+ circulating HIV-1 strains can be informative. Here, we folded the V3 loop of the R2 strain to gain insight into the structural basis of its unique properties. R2 bears a rare V3 loop sequence thought to be responsible for the exquisite sensitivity of this strain to neutralization by patient sera and monoclonal antibodies4, 5. The strain mediates CD4-independent infection and appears to elicit broadly neutralizing antibodies. We demonstrate how evaluation of the results of the folding can be informative for associating observed structures in the folding with the immunological activities observed for R2.

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The crown region of different V3 loop sequences of the surface envelope glycoprotein (gp120) of HIV-1 can be structurally characterized in many cases by in silico folding of positions 10 to 22 of the loop using a state-of-the-art ab initio folding algorithm. Here we demonstrate the folding and evaluation of this region of the V3 loop from the R2 strain of HIV-1, a uniquely neutralization sensitive strain with puzzling functional properties.

Evaluación de la inmunológicamente relevantes características dinámicas estructurales Terciario de la pandemia del VIH-1 secuencia de bucle V3 R2 Corona Ab initio Plegable

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' ...

Investigación

Inmunología e Infección

Specific Marking of HIV-1 Positive Cells using a Rev-dependent Lentiviral Vector Expressing the Green Fluorescent Protein

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, the LTR is also responsive to cellular activation states and to the local chromatin activity where the integration has occurred. This can result in high HIV-independent activity, and has restricted the usefulness of LTR-based reporter to mark HIV positive cells 1,2,3. Here, we constructed an expression lentiviral vector that possesses, in addition to the Tat-responsive LTR, numerous HIV DNA sequences that include the Rev-response element and HIV splicing sites 4,5,6. The vector was incorporated into a lentiviral reporter virus, permitting highly specific detection of replicating HIV in living cell populations. The activity of the vector was measured by expression of the green fluorescence protein (GFP). The application of this vector as reported here offers a novel alternative approach to existing methods, such as in situ PCR or HIV antigen staining, to identify HIV-positive cells. The vector can also express therapeutic genes for basic or clinical experimentation to target HIV-positive cells.

We have developed a lentiviral vector that possesses, in addition to the Tat-responsive LTR, the Rev-response element (RRE) that can regulate reporter gene expression in an HIV-1 Tat- and Rev-dependent fashion. The vector permits the specific detection of replicating HIV in living cells via the expression of GFP.

Marcado específico del VIH-1 células positivas utilizando un vector lentiviral Ap-dependientes que expresan la proteína verde fluorescente

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Inferencia genotípica del VIH-1 tropismo utilizando la población basada en la secuencia de V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein complexes and assemblies. In fact, single particle electron microscopy1 and two-dimensional (2D) electron crystallography2 have become relatively routine methodologies and a large number of structures have been solved using these methods. At the same time, image processing and three-dimensional (3D) reconstruction of helical objects has rapidly developed, especially, the iterative helical real-space reconstruction (IHRSR) method3, which uses single particle analysis tools in conjunction with helical symmetry. Many biological entities function in filamentous or helical forms, including actin filaments4, microtubules5, amyloid fibers6, tobacco mosaic viruses7, and bacteria flagella8, and, because a 3D density map of a helical entity can be attained from a single projection image, compared to the many images required for 3D reconstruction of a non-helical object, with the IHRSR method, structural analysis of such flexible and disordered helical assemblies is now attainable.
In this video article, we provide detailed protocols for obtaining a 3D density map of a helical protein assembly (HIV-1 capsid9 is our example), including protocols for cryo-EM specimen preparation, low dose data collection by cryo-EM, indexing of helical diffraction patterns, and image processing and 3D reconstruction using IHRSR. Compared to other techniques, cryo-EM offers optimal specimen preservation under near native conditions. Samples are embedded in a thin layer of vitreous ice, by rapid freezing, and imaged in electron microscopes at liquid nitrogen temperature, under low dose conditions to minimize the radiation damage. Sample images are obtained under near native conditions at the expense of low signal and low contrast in the recorded micrographs. Fortunately, the process of helical reconstruction has largely been automated, with the exception of indexing the helical diffraction pattern. Here, we describe an approach to index helical structure and determine helical symmetries (helical parameters) from digitized micrographs, an essential step for 3D helical reconstruction. Briefly, we obtain an initial 3D density map by applying the IHRSR method. This initial map is then iteratively refined by introducing constraints for the alignment parameters of each segment, thus controlling their degrees of freedom. Further improvement is achieved by correcting for the contrast transfer function (CTF) of the electron microscope (amplitude and phase correction) and by optimizing the helical symmetry of the assembly.

This article describes a method to obtain a three-dimensional (3D) structure of helically assembled molecules using cryo-electron microscopy. In this protocol, we use HIV-1 capsid assemblies to illustrate the detailed 3D reconstruction procedure for achieving a density map by the iterative helical real-space reconstruction method.

Estructura del VIH-1 Asambleas cápside por crio-microscopía electrónica y reconstrucción iterativa helicoidal del espacio real

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

En uncoating in vitro del VIH-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the protocols described here use freshly isolated human peripheral blood mononuclear cells (PBMCs) or plasmacytoid dendritic cells (pDCs) to sense infections in either T cell line (MT4) or heterologous primary CD4+ T cells. In order to ensure proper sensing, it is essential that PBMC are isolated immediately after blood collection and that optimal percentage of infected T cells are used. Furthermore, multi-parametric flow cytometric staining can be used to confirm that PBMC samples contain the different cell lineages at physiological ratios. A number of controls can also be included to evaluate viability and functionality of pDCs. These include, the presence of specific surface markers, assessing cellular responses to known agonist of Toll-Like Receptors (TLR) pathways, and confirming a lack of spontaneous type-I interferon (IFN) production. In this system, freshly isolated PBMCs or pDCs are co-cultured with HIV-1 infected cells in 96 well plates for 18-22 hr. Supernatants from these co-cultures are then used to determine the levels of bioactive type-I IFNs by monitoring the activation of the ISGF3 pathway in HEK-Blue IFN-&#945;/&#946; cells. Prior and during co-culture conditions, target cells can be subjected to flow cytometric analysis to determine a number of parameters, including the percentage of infected cells, levels of specific surface markers, and differential killing of infected cells. Although, these protocols were initially developed to follow type-I IFN production, they could potentially be used to study other imuno-modulatory molecules released from pDCs and to gain further insight into the molecular mechanisms governing HIV-1 innate sensing.

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

Unlike cell-free HIV-1 particles, infected CD4+ T cells are effectively sensed by plasmacytoid dendritic cells (pDCs). This manuscript describes a method where peripheral blood mononuclear cells (PBMCs) or isolated pDCs are co-cultured with HIV-1 infected T cells to evaluate innate sensing by pDCs as assessed by release of type-I IFN.

La evaluación de la innata de detección de VIH-1 CD4 infectados<sup&gt; +</sup&gt; Células T por las células dendríticas plasmocitoides Usando un<em&gt; Ex vivo</em&gt; Co-cultura del sistema.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

Evaluación conformacional del VIH-1 glicoproteínas de la envoltura trimérica El uso de un ELISA ensayo basado en células

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

Aislamiento de exosomas del plasma de VIH-1 en individuos positivos

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3&#39; ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

Medida de<em&gt; In Vitro</em&gt; Integración Actividad del VIH-1 preintegration Complejos

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.