Este trabajo fue apoyado por fondos del Programa de Apoyo a la Infraestructura Childrens Operativa del Gobierno de Victoria Instituto e Investigación Murdoch.

<ol>
	<li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> Lancet. 374, 893-902 (2009).</li><li>Bogaert, D., de Groot, R., Hermans, P. W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcus+pneumoniae+colonisation:+the+key+to+pneumococcal+disease.">Streptococcus pneumoniae colonisation: the key to pneumococcal disease.</a> Lancet Infect. Dis. 4 (04), 144-154 (2004).</li><li>Weinberger, D. M., Malley, R., Lipsitch, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+replacement+in+disease+after+pneumococcal+vaccination.">Serotype replacement in disease after pneumococcal vaccination.</a> Lancet. 378 (10), 1962-1973 (2011).</li><li>Jacoby, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+the+co-occurrence+of+Streptococcus+pneumoniae+with+other+bacterial+and+viral+pathogens+in+the+upper+respiratory+tract.">Modelling the co-occurrence of Streptococcus pneumoniae with other bacterial and viral pathogens in the upper respiratory tract.</a> Vaccine. 25, 2458-2464 (2007).</li><li>Kwambana, B., Barer, M., Bottomley, C., Adegbola, R., Antonio, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+acquisition+and+high+nasopharyngeal+co-colonisation+by+Streptococcus+pneumoniae+and+three+respiratory+pathogens+amongst+Gambian+new-borns+and+infants.">Early acquisition and high nasopharyngeal co-colonisation by Streptococcus pneumoniae and three respiratory pathogens amongst Gambian new-borns and infants.</a> BMC Infect. Dis. 11, (2011).</li><li>Licciardi, P. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protecting+against+pneumococcal+disease:+critical+interactions+between+probiotics+and+the+airway+microbiome.">Protecting against pneumococcal disease: critical interactions between probiotics and the airway microbiome.</a> PLoS Pathog. 8, (2012).</li><li>Popova, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beneficial+effects+of+probiotics+in+upper+respiratory+tract+infections+and+their+mechanical+actions+to+antagonize+pathogens.">Beneficial effects of probiotics in upper respiratory tract infections and their mechanical actions to antagonize pathogens.</a> J. Appl. Microbiol. 113 (6), 1305-1318 (2012).</li><li>Pracht, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PavA+of+Streptococcus+pneumoniae+modulates+adherence,+invasion,+and+meningeal+inflammation.">PavA of Streptococcus pneumoniae modulates adherence, invasion, and meningeal inflammation.</a> Infect. Immun. 73, 2680-2689 (2005).</li><li>Adamou, J. E., Wizemann, T. M., Barren, P., Langermann, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adherence+of+Streptococcus+pneumoniae+to+human+bronchial+epithelial+cells+(BEAS-2B).">Adherence of Streptococcus pneumoniae to human bronchial epithelial cells (BEAS-2B).</a> Infect. Immun. 66, 820-822 (1998).</li><li>Wong, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Streptococcus+pneumoniae+adherence+to+human+epithelial+cells+in+vitro+by+the+probiotic+Lactobacillus+rhamnosus+GG.">Inhibition of Streptococcus pneumoniae adherence to human epithelial cells in vitro by the probiotic Lactobacillus rhamnosus GG.</a> BMC Res. Notes. 6 (1), 135 (2013).</li><li>Wescombe, P. A., Heng, N. C. K., Burton, J. P., Chilcott, C. N., Tagg, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcal+bacteriocins+and+the+case+for+Streptococcus+salivarius+as+model+oral+probiotics.">Streptococcal bacteriocins and the case for Streptococcus salivarius as model oral probiotics.</a> Future Microbiol. 4, 819-835 (2009).</li><li>Di Pierro, F., Adami, T., Rapacioli, G., Giardini, N., Streitberger, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+evaluation+of+the+oral+probiotic+Streptococcus+salivarius+K12+in+the+prevention+of+recurrent+pharyngitis+and/or+tonsillitis+caused+by+Streptococcus+pyogenes+in+adults.">Clinical evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes in adults.</a> Expert. Opin. Biol. Ther. 13 (3), 339-343 (2013).</li><li>Fiedler, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+mechanisms+of+respiratory+tract+streptococci+against+Streptococcus+pyogenes+biofilm+formation+and+epithelial+cell+infection.">Protective mechanisms of respiratory tract streptococci against Streptococcus pyogenes biofilm formation and epithelial cell infection.</a> Appl. Environ. Microbiol. 79, 1265-1276 (2013).</li><li>Slotved, H. C., Satzke, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+growth+of+pneumococcal+isolates+representing+23+different+serotypes.">In vitro growth of pneumococcal isolates representing 23 different serotypes.</a> BMC Res. Notes. 6, 10-1186 (2013).</li><li>Carvalho, M. d. G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+and+improvement+of+real-time+PCR+assays+targeting+lytA,+ply,+and+psaA+genes+for+detection+of+pneumococcal+DNA.">Evaluation and improvement of real-time PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA.</a> J. Clin. Microbiol. 45, 2460-2466 (2007).</li><li>Tonnaer, E. L. G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+glycosaminoglycans+in+the+attachment+of+pneumococci+to+nasopharyngeal+epithelial+cells.">Involvement of glycosaminoglycans in the attachment of pneumococci to nasopharyngeal epithelial cells.</a> Microbes Infect. 8, 316-322 (2006).</li><li>Smith-Vaughan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+nasal+bacterial+load+and+its+association+with+otitis+media.">Measuring nasal bacterial load and its association with otitis media.</a> BMC Ear Nose Throat Disord. 6, (2006).</li><li>Letourneau, J., Levesque, C., Berthiaume, F., Jacques, M., Mourez, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+assay+of+bacterial+adhesion+onto+mammalian+epithelial+cells.">In vitro assay of bacterial adhesion onto mammalian epithelial cells.</a> J. Vis. Exp. , (2011).</li></ol>

Los autores no tienen nada que revelar.

Una parte crítica de este ensayo es la adición de las concentraciones apropiadas de S. salivarius y neumococos en las secciones 3.1.7 y 3.1.12. Las concentraciones se estimaron utilizando lecturas de DO, pero los inóculos exacta no se determinan hasta que las placas se contaron el día siguiente. Por esta razón, se recomienda la realización de curvas de crecimiento para medir OD y los recuentos de viables (UFC / ml) en el tiempo para todas las cepas bacterianas usadas en el ensayo para identificar la fase ...

Streptococcus pneumoniae (neumococo) es una bacteria Gram positiva que puede causar infecciones como la neumonía, otitis media y meningitis. Es una causa importante de enfermedad en niños en los países de bajos ingresos y responsable de un estimado de 800.000 muertes de niños menores de cinco años anualmente 1. Los neumococos se realizan con frecuencia en la nasofaringe de los niños pequeños. Aunque esta colonización se considera generalmente asintomática, que precede a la infección neumocócica y sirve como un depósito para las bacterias en las poblaciones humanas 2. La vacunación antineumocócica conjugada reduce efectivamente el transporte de los serotipos contenidos en la vacuna. Sin embargo, existen más de 90 serotipos de neumococo, y la vacunación puede conducir a la sustitución de serotipos, por lo que la eliminación de los serotipos de la vacuna es seguida por un aumento en el transporte y la enfermedad causada por los serotipos no vacunales 3. También, en algunas poblaciones de alto riesgo, el neumococola colonización menudo se produce muy temprano en la vida, antes de la administración de la primera dosis de vacuna de 4,5. Recientemente, el uso de probióticos ha sido propuesto como una estrategia adicional para inhibir la colonización 6,7 neumocócica. In vitro ensayos de adherencia se han utilizado para examinar la adherencia neumocócica 8,9. Estos ensayos han sido adaptados para investigar el impacto del probiótico Lactobacillus rhamnosus GG (LGG) en la adherencia neumocócica 10. Además de LGG y otras bacterias del ácido láctico, Streptococcus salivarius, un residente común de la cavidad oral, se ha investigado como un probiótico potencial para las vías respiratorias debido a su potencial de colonización y la capacidad para inhibir los neumococos y otros patógenos respiratorios in vitro 11 - 13. El protocolo presentado aquí describe un ensayo de adherencia utilizado para investigar los efectos de S. salivarius K12 en la adherencia neumocócicaa la línea celular epitelial humana CCL-23. Antes de su uso en el ensayo, los aislamientos de neumococos se evaluaron para las capacidades de adherencia, ya que el crecimiento y las propiedades de adherencia pueden variar sustancialmente entre los aislados 10,14. Curvas de crecimiento de neumococos y S. salivarius se realizaron para determinar la fase semilogarítmica y la concentración de estimación (unidades formadoras de colonias o CFU / ml) por la densidad óptica (OD, Figura 1). Se recomienda examinar el crecimiento por recuento de viables y la OD para cada aislamiento antes de su uso en el ensayo. Este ensayo se puede realizar en cualquier laboratorio con instalaciones de cultivo de tejidos estándar y los equipos. En este protocolo, los efectos de tres dosis de S. salivarius administrada 1 hora antes de la adición de neumococos en la adherencia de S. pneumoniae PMP843, un serotipo 19F carro aislado derivado de un exudado nasofaríngeo, se examinan. Se presentan dos formas diferentes para cuantificar los neumococos adherente: placas en agar sangre para disuadirmina de recuentos viables, y la extracción de ADN y la detección del gen lytA neumocócica por qPCR 15. El protocolo básico de ensayo de adherencia se puede modificar fácilmente para probar diferentes dosis o tiempo de administración de probióticos y también se puede utilizar con otras cepas o especies bacterianas.

<table border="0" cellpadding="0" cellspacing="0" width="1318">
	<colgroup>
		<col />
		<col />
		<col />
		<col span="2" />
	</colgroup>
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Minimum Essential Media (MEM)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">SH30244.01</td>
			<td style="width:377px;"> </td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Fetal Bovine Serum (FBS)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td>SH30084.03</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">T-75 Flask</td>
			<td style="width:155px;">Nunc</td>
			<td>156472</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">CCL-23 cells</td>
			<td style="width:155px;">ATCC</td>
			<td style="width:147px;">CCL-23</td>
			<td style="width:377px;"> </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Trypsin</td>
			<td>Life Technologies</td>
			<td>15090046</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:264px;">24-well cell culture plate</td>
			<td style="width:155px;">Nunc</td>
			<td style="width:147px;">142475</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Horse blood agar (HBA) plates</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">PP2001</td>
			<td>Sheep blood agar plates also acceptable</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Todd-Hewitt Broth</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">CM0189</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Yeast Extract</td>
			<td style="width:155px;">Beckton Dickinson</td>
			<td style="width:147px;">212750</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Digitonin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:147px;">D141-100MG</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Disposable cuvettes</td>
			<td style="width:155px;">Kartell</td>
			<td>1938</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Heparin</td>
			<td style="width:155px;">Pfizer</td>
			<td style="width:147px;">2112105</td>
			<td>comes in sterile ampules at 5,000IU/5mL </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">sterile spreader</td>
			<td style="width:155px;">Technoplas</td>
			<td style="width:147px;">S10805050</td>
			<td style="width:377px;">alternatively, a glass spreader can be dipped in 96% ethanol and flame sterilized before each use</td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">L6876</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mutanolysin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">M9901</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Proteinase K</td>
			<td>Qiagen</td>
			<td>19133</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">SDS 20% solution</td>
			<td>Ambion </td>
			<td style="width:147px;">AM9820</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">RNase A</td>
			<td>Qiagen</td>
			<td style="width:147px;">19101</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">QIAamp DNA mini-kit (250)</td>
			<td>Qiagen</td>
			<td style="width:147px;">51306</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA F primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence ACGCAATCTAGCAGATGAAGCA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA R primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence TCGTGCGTTTTAATTCCAGCT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA probe</td>
			<td>Eurogentec</td>
			<td style="width:147px;">Custom made</td>
			<td colspan="2">5&#39; -&#62; 3&#39; sequence Cy5-TGCCGAAAACGCTTGATACAGGGAG-BHQ3, alternative fluorophores can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Nuclease free water</td>
			<td>Ambion</td>
			<td style="width:147px;">AM9906</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Brilliant III Ultra Fast QPCR mastermix</td>
			<td>Agilent Technologies </td>
			<td style="width:147px;">600880</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Thermo-Fast 96 Detection plate </td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-1100</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Ultra clear qPCR cap strips</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-0866</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mx3005 QPCR System</td>
			<td style="width:155px;">Agilent Technologies </td>
			<td style="width:147px;">401449</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;"> </td>
			<td style="width:155px;"> </td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">* alternative sources are available for most/all products listed</td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

investigating the effects of probiotics on pneumococcal colonization using an in vitro adherence assay

La adherencia de Streptococcus pneumoniae (neumococo) para el revestimiento epitelial de la nasofaringe puede dar lugar a la colonización y se considera un requisito previo para las infecciones neumocócicas tales como la neumonía y la otitis media. In vitro ensayos de adherencia se pueden utilizar para estudiar la unión de los neumococos a células epiteliales monocapas y para investigar las posibles intervenciones, tales como el uso de los probióticos, para inhibir la colonización neumocócica. El protocolo descrito aquí se utiliza para investigar los efectos de la Streptococcus salivarius probiótico en la adherencia de los neumococos a la línea celular epitelial humana CCL-23 (a veces referido como células HEp-2). El ensayo implica tres pasos principales: 1) Preparación de células epiteliales y bacterianas, 2) adición de las bacterias a las monocapas de células epiteliales, y 3) detección de neumococos adherente por recuentos de viables (dilución en serie y chapado) o cuantitativa-PCR en tiempo real (qPCR ). Esta technique es relativamente sencillo y no requiere equipo especializado que no sea una configuración de cultivo de tejidos. El ensayo se puede usar para probar otras especies probióticas y / o inhibidores potenciales de la colonización neumocócica y se puede modificar fácilmente para hacer frente a otras cuestiones científicas con respecto a la adherencia neumocócica y la invasión.

Los resultados de un experimento representativo en el que los neumococos (S. pneumoniae PMP843, un aislado de colonizar 19F) se añadieron a las células CCL-23 1 h después de la adición de S. salivarius, y la adherencia neumocócica se cuantificó por tanto recuento viable y lytA qPCR se muestran en la Tabla 2. Los resultados fueron consistentes entre los dos métodos para tanto el número absoluto de bacterias (presentada como UFC / ml) y la adherencia%, normalizada para e...

Watch this Scientific Journal Video about Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay at JoVE.com

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

En ensayos in vitro de adherencia se pueden utilizar para estudiar la unión de Streptococcus pneumoniae a monocapas de células epiteliales y para investigar las posibles intervenciones, tales como el uso de los probióticos para la inhibición de la colonización neumocócica.

La investigación de los efectos de los probióticos en antineumocócica Colonización El uso de un<em&gt; In Vitro</em&gt; Ensayo de adherencia

Adherence of Streptococcus pneumoniae (the pneumococcus) to the epithelial lining of the nasopharynx can result in colonization and is considered a ...

investigating-effects-probiotics-on-pneumococcal-colonization-using

Research

JoVE Journal

Immunology and Infection

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

12.5K vistas.  Murdoch Childrens Research Institute.  En ensayos in vitro de adherencia se pueden utilizar para estudiar la unión de Streptococcus pneumoniae a monocapas de células epiteliales y para investigar las posibles intervenciones, tales como el uso de los probióticos para la inhibición de la colonización neumocócica. 