وأيد هذا العمل من خلال تمويل من معهد أبحاث الطفولة مردوخ وبرنامج دعم البنية التحتية التشغيلية للحكومة فيكتوريا.

<ol>
	<li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> Lancet. 374, 893-902 (2009).</li><li>Bogaert, D., de Groot, R., Hermans, P. W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcus+pneumoniae+colonisation:+the+key+to+pneumococcal+disease.">Streptococcus pneumoniae colonisation: the key to pneumococcal disease.</a> Lancet Infect. Dis. 4 (04), 144-154 (2004).</li><li>Weinberger, D. M., Malley, R., Lipsitch, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+replacement+in+disease+after+pneumococcal+vaccination.">Serotype replacement in disease after pneumococcal vaccination.</a> Lancet. 378 (10), 1962-1973 (2011).</li><li>Jacoby, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+the+co-occurrence+of+Streptococcus+pneumoniae+with+other+bacterial+and+viral+pathogens+in+the+upper+respiratory+tract.">Modelling the co-occurrence of Streptococcus pneumoniae with other bacterial and viral pathogens in the upper respiratory tract.</a> Vaccine. 25, 2458-2464 (2007).</li><li>Kwambana, B., Barer, M., Bottomley, C., Adegbola, R., Antonio, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+acquisition+and+high+nasopharyngeal+co-colonisation+by+Streptococcus+pneumoniae+and+three+respiratory+pathogens+amongst+Gambian+new-borns+and+infants.">Early acquisition and high nasopharyngeal co-colonisation by Streptococcus pneumoniae and three respiratory pathogens amongst Gambian new-borns and infants.</a> BMC Infect. Dis. 11, (2011).</li><li>Licciardi, P. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protecting+against+pneumococcal+disease:+critical+interactions+between+probiotics+and+the+airway+microbiome.">Protecting against pneumococcal disease: critical interactions between probiotics and the airway microbiome.</a> PLoS Pathog. 8, (2012).</li><li>Popova, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beneficial+effects+of+probiotics+in+upper+respiratory+tract+infections+and+their+mechanical+actions+to+antagonize+pathogens.">Beneficial effects of probiotics in upper respiratory tract infections and their mechanical actions to antagonize pathogens.</a> J. Appl. Microbiol. 113 (6), 1305-1318 (2012).</li><li>Pracht, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PavA+of+Streptococcus+pneumoniae+modulates+adherence,+invasion,+and+meningeal+inflammation.">PavA of Streptococcus pneumoniae modulates adherence, invasion, and meningeal inflammation.</a> Infect. Immun. 73, 2680-2689 (2005).</li><li>Adamou, J. E., Wizemann, T. M., Barren, P., Langermann, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adherence+of+Streptococcus+pneumoniae+to+human+bronchial+epithelial+cells+(BEAS-2B).">Adherence of Streptococcus pneumoniae to human bronchial epithelial cells (BEAS-2B).</a> Infect. Immun. 66, 820-822 (1998).</li><li>Wong, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Streptococcus+pneumoniae+adherence+to+human+epithelial+cells+in+vitro+by+the+probiotic+Lactobacillus+rhamnosus+GG.">Inhibition of Streptococcus pneumoniae adherence to human epithelial cells in vitro by the probiotic Lactobacillus rhamnosus GG.</a> BMC Res. Notes. 6 (1), 135 (2013).</li><li>Wescombe, P. A., Heng, N. C. K., Burton, J. P., Chilcott, C. N., Tagg, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcal+bacteriocins+and+the+case+for+Streptococcus+salivarius+as+model+oral+probiotics.">Streptococcal bacteriocins and the case for Streptococcus salivarius as model oral probiotics.</a> Future Microbiol. 4, 819-835 (2009).</li><li>Di Pierro, F., Adami, T., Rapacioli, G., Giardini, N., Streitberger, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+evaluation+of+the+oral+probiotic+Streptococcus+salivarius+K12+in+the+prevention+of+recurrent+pharyngitis+and/or+tonsillitis+caused+by+Streptococcus+pyogenes+in+adults.">Clinical evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes in adults.</a> Expert. Opin. Biol. Ther. 13 (3), 339-343 (2013).</li><li>Fiedler, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+mechanisms+of+respiratory+tract+streptococci+against+Streptococcus+pyogenes+biofilm+formation+and+epithelial+cell+infection.">Protective mechanisms of respiratory tract streptococci against Streptococcus pyogenes biofilm formation and epithelial cell infection.</a> Appl. Environ. Microbiol. 79, 1265-1276 (2013).</li><li>Slotved, H. C., Satzke, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+growth+of+pneumococcal+isolates+representing+23+different+serotypes.">In vitro growth of pneumococcal isolates representing 23 different serotypes.</a> BMC Res. Notes. 6, 10-1186 (2013).</li><li>Carvalho, M. d. G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+and+improvement+of+real-time+PCR+assays+targeting+lytA,+ply,+and+psaA+genes+for+detection+of+pneumococcal+DNA.">Evaluation and improvement of real-time PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA.</a> J. Clin. Microbiol. 45, 2460-2466 (2007).</li><li>Tonnaer, E. L. G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+glycosaminoglycans+in+the+attachment+of+pneumococci+to+nasopharyngeal+epithelial+cells.">Involvement of glycosaminoglycans in the attachment of pneumococci to nasopharyngeal epithelial cells.</a> Microbes Infect. 8, 316-322 (2006).</li><li>Smith-Vaughan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+nasal+bacterial+load+and+its+association+with+otitis+media.">Measuring nasal bacterial load and its association with otitis media.</a> BMC Ear Nose Throat Disord. 6, (2006).</li><li>Letourneau, J., Levesque, C., Berthiaume, F., Jacques, M., Mourez, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+assay+of+bacterial+adhesion+onto+mammalian+epithelial+cells.">In vitro assay of bacterial adhesion onto mammalian epithelial cells.</a> J. Vis. Exp. , (2011).</li></ol>

والكتاب ليس لديهم ما يكشف.

جزء حاسم من هذا الاختبار هو إضافة تركيزات مناسبة من S. اللعابية والمكورات الرئوية في الأقسام 3.1.7 و3.1.12. وتقدر تركيزات باستخدام قراءات OD ولكن لم يتم تحديد قائح بالضبط حتى تحسب لوحات في اليوم التالي. لهذا السبب، فإننا ننصح أداء منحنيات النمو لقياس OD وتعول قابلة للحي?...

العقدية الرئوية (المكورة الرئوية و) هي نوع من البكتيريا موجبة الجرام التي يمكن أن تسبب العدوى بما في ذلك الالتهاب الرئوي والتهاب الأذن الوسطى، والتهاب السحايا. بل هو سبب رئيسي للمرض في الأطفال في البلدان المنخفضة الدخل ومسؤولة عن ما يقدر ب 800،000 حالة وفاة للأطفال دون سن الخامسة سنويا 1. وكثيرا ما تتم المكورات الرئوية في البلعوم الأنفي للأطفال الصغار. على الرغم من أن هذا الاستعمار يعتبر عموما أعراض، فإنه يسبق عدوى المكورات الرئوية وبمثابة خزان للبكتيريا في التجمعات البشرية 2. تطعيم المكورات الرئوية بشكل فعال يقلل من نقل الأنماط المصلية الواردة في اللقاح. ومع ذلك، هناك أكثر من 90 الأنماط المصلية للمكورات الرئوية، والتطعيم يمكن أن يؤدي إلى استبدال النمط المصلي، حيث يتبع القضاء على الأنماط المصلية لقاح ارتفاع في النقل والأمراض الناجمة عن الأنماط المصلية nonvaccine 3. أيضا، في بعض المجموعات السكانية المعرضة للخطر، المكورات الرئويةالاستعمار غالبا ما يحدث في الحياة في وقت مبكر جدا، قبل إعطاء الجرعة الأولى لقاح 4،5. في الآونة الأخيرة، وقد اقترح استخدام البروبيوتيك باعتباره استراتيجية إضافية لمنع الالتهاب الرئوي الاستعمار 6،7. وقد استخدمت في المختبر فحوصات التمسك دراسة التقيد المكورات الرئوية 8،9. وقد تم تكييف هذه المقايسات للتحقيق في تأثير بروبيوتيك rhamnosus اكتوباكيللوس GG (LGG) على الالتزام المكورات الرئوية 10. بالإضافة إلى LGG وغيرها من بكتيريا حمض اللاكتيك، المكورات العقدية اللعابية، وهو من سكان شيوعا من تجويف الفم، وقد تم التحقيق باعتباره بروبيوتيك المحتملة لالجهاز التنفسي بسبب الاستعمار إمكاناتها وقدرتها على تثبيط المكورات الرئوية ومسببات الأمراض التنفسية الأخرى في المختبر 11 - 13. بروتوكول المعروضة هنا يصف مقايسة التقيد تستخدم للتحقيق في آثار S. اللعابية K12 على الالتزام المكورات الرئويةإلى خط الخلايا الظهارية البشرية CCL-23. قبل استخدامها في الفحص، وجرى تقييم عزلات المكورات الرئوية لقدرات الالتزام، والنمو وخصائص الالتزام يمكن أن تختلف بشكل كبير بين العزلات 10،14. منحنيات نمو المكورات الرئوية وS. أجريت اللعابية لتحديد مرحلة منتصف السجل والتركيز تقدير (وحدات تشكيل مستعمرة أو كفو / مل) من خلال الكثافة الضوئية (OD، الشكل 1). فمن المستحسن لدراسة النمو من خلال عدد قابلة للحياة والتطوير التنظيمي لكل عزل قبل استخدامها في الفحص. هذا الاختبار لا يمكن أن يؤديها في أي مختبر زراعة الأنسجة مع مرافق القياسية والمعدات. في هذا البروتوكول، وآثار ثلاث جرعات من S. اللعابية تدار 1 ساعة قبل إضافة المكورات الرئوية على التزام S. PMP843 الرئوية، وهو النمط المصلي 19F عزل النقل المستمدة من مسحة البلعوم، ويتم فحص. يتم عرض طريقتين مختلفتين لتقدير المكورات الرئوية تمسكا: الطلاء على أجار الدم لردعالألغام التهم قابلة للحياة، واستخراج الحمض النووي والكشف عن الجين lytA المكورات الرئوية التي كتبها QPCR 15. تمسك بروتوكول الفحص الأساسية يمكن تعديلها بسهولة لاختبار الجرعات أو الوقت لإقامة البروبيوتيك مختلفة، ويمكن أن تستخدم أيضا مع السلالات أو الأنواع البكتيرية الأخرى.

<table border="0" cellpadding="0" cellspacing="0" width="1318">
	<colgroup>
		<col />
		<col />
		<col />
		<col span="2" />
	</colgroup>
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Minimum Essential Media (MEM)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">SH30244.01</td>
			<td style="width:377px;"> </td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Fetal Bovine Serum (FBS)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td>SH30084.03</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">T-75 Flask</td>
			<td style="width:155px;">Nunc</td>
			<td>156472</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">CCL-23 cells</td>
			<td style="width:155px;">ATCC</td>
			<td style="width:147px;">CCL-23</td>
			<td style="width:377px;"> </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Trypsin</td>
			<td>Life Technologies</td>
			<td>15090046</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:264px;">24-well cell culture plate</td>
			<td style="width:155px;">Nunc</td>
			<td style="width:147px;">142475</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Horse blood agar (HBA) plates</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">PP2001</td>
			<td>Sheep blood agar plates also acceptable</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Todd-Hewitt Broth</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">CM0189</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Yeast Extract</td>
			<td style="width:155px;">Beckton Dickinson</td>
			<td style="width:147px;">212750</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Digitonin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:147px;">D141-100MG</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Disposable cuvettes</td>
			<td style="width:155px;">Kartell</td>
			<td>1938</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Heparin</td>
			<td style="width:155px;">Pfizer</td>
			<td style="width:147px;">2112105</td>
			<td>comes in sterile ampules at 5,000IU/5mL </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">sterile spreader</td>
			<td style="width:155px;">Technoplas</td>
			<td style="width:147px;">S10805050</td>
			<td style="width:377px;">alternatively, a glass spreader can be dipped in 96% ethanol and flame sterilized before each use</td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">L6876</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mutanolysin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">M9901</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Proteinase K</td>
			<td>Qiagen</td>
			<td>19133</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">SDS 20% solution</td>
			<td>Ambion </td>
			<td style="width:147px;">AM9820</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">RNase A</td>
			<td>Qiagen</td>
			<td style="width:147px;">19101</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">QIAamp DNA mini-kit (250)</td>
			<td>Qiagen</td>
			<td style="width:147px;">51306</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA F primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence ACGCAATCTAGCAGATGAAGCA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA R primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence TCGTGCGTTTTAATTCCAGCT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA probe</td>
			<td>Eurogentec</td>
			<td style="width:147px;">Custom made</td>
			<td colspan="2">5&#39; -&#62; 3&#39; sequence Cy5-TGCCGAAAACGCTTGATACAGGGAG-BHQ3, alternative fluorophores can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Nuclease free water</td>
			<td>Ambion</td>
			<td style="width:147px;">AM9906</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Brilliant III Ultra Fast QPCR mastermix</td>
			<td>Agilent Technologies </td>
			<td style="width:147px;">600880</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Thermo-Fast 96 Detection plate </td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-1100</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Ultra clear qPCR cap strips</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-0866</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mx3005 QPCR System</td>
			<td style="width:155px;">Agilent Technologies </td>
			<td style="width:147px;">401449</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;"> </td>
			<td style="width:155px;"> </td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">* alternative sources are available for most/all products listed</td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

investigating the effects of probiotics on pneumococcal colonization using an in vitro adherence assay

تمسك العقدية الرئوية (المكورة الرئوية و) لبطانة الظهارية من البلعوم الأنفي يمكن أن يؤدي إلى الاستعمار، ويعتبر شرطا أساسيا للعدوى المكورات الرئوية مثل الالتهاب الرئوي والتهاب الأذن الوسطى. في المختبر فحوصات الالتزام يمكن استخدامها لدراسة المرفق من المكورات الرئوية إلى الخلايا الظهارية الطبقات الوحيدة للتحقيق والتدخلات المحتملة، مثل استخدام البروبيوتيك، لمنع استعمار المكورات الرئوية. يتم استخدام بروتوكول الموصوفة هنا للتحقيق في الآثار المترتبة على اللعابية العقدية بروبيوتيك على التزام المكورات الرئوية إلى خط الخلايا الظهارية البشرية CCL-23 (التي يشار إليها أحيانا التهاب الكبد-2 خلايا). ينطوي على فحص ثلاث خطوات رئيسية: 1) إعداد الخلايا الظهارية والبكتيرية، 2) إضافة إلى البكتيريا الظهارية الطبقات الوحيدة الخلية، و3) الكشف عن المكورات الرئوية تمسكا من قبل التهم قابلة للحياة (التخفيف المتسلسل وتصفيح) أو الكمي في الوقت الحقيقي PCR (QPCR ). هذا تكhnique واضح ومباشر نسبيا ولا تتطلب معدات متخصصة أخرى من الإعداد زراعة الأنسجة. الفحص يمكن استخدامها لاختبار أنواع الكائنات الحية المجهرية الأخرى و / أو مثبطات المحتملة للاستعمار المكورات الرئوية ويمكن تعديلها بسهولة لمعالجة المسائل العلمية الأخرى بشأن الانضمام المكورات الرئوية والغزو.

النتائج من تجربة تمثيلية في المكورات الرئوية التي تمت إضافتها (S. الرئوية PMP843، وهو 19F عزل استعمار) لCCL-23 الخلايا 1 ساعة بعد إضافة S. اللعابية، وكان كميا الالتزام من قبل كل من المكورات الرئوية العد قابلة للحياة وlytA QPCR وترد في الجدول 2. وكانت النتائج ...

Watch this Scientific Journal Video about Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay at JoVE.com

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

في فحوصات المختبر التقيد يمكن استخدامها لدراسة إلحاق العقدية الرئوية لالظهارية الطبقات الوحيدة الخلية والتحقيق التدخلات المحتملة مثل استخدام البروبيوتيك لتثبيط استعمار المكورات الرئوية.

التحقيق في آثار البروبيوتيك على المكورات الرئوية الاستعمار باستخدام<em&gt; في المختبر</em&gt; الالتزام الفحص

Adherence of Streptococcus pneumoniae (the pneumococcus) to the epithelial lining of the nasopharynx can result in colonization and is considered a ...

investigating-effects-probiotics-on-pneumococcal-colonization-using

Research

JoVE Journal

Immunology and Infection

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

12.5K Views.  Murdoch Childrens Research Institute.  في فحوصات المختبر التقيد يمكن استخدامها لدراسة إلحاق العقدية الرئوية لالظهارية الطبقات الوحيدة الخلية والتحقيق التدخلات المحتملة مثل استخدام البروبيوتيك لتثبيط استعمار المكورات الرئوية. 

Video: Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

In vitro Biofilm Formation in an 8-well Chamber Slide

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. Biofilms are community-associated bacteria attached to a surface and encased in a matrix. The role of the extracellular matrix is multifaceted, including facilitating nutrient acquisition, and offers significant protection against environmental stresses (e.g. host immune responses). In an effort to acquire a better understanding as to how the bacteria within a biofilm respond to environmental stresses we have used a protocol wherein we visualize bacterial biofilms which have formed in an 8-well chamber slide. The biofilms were stained with the BacLight Live/Dead stain and examined using a confocal microscope to characterize the relative biofilm size, and structure under varying incubation conditions. Z-stack images were collected via confocal microscopy and analyzed by COMSTAT. This protocol can be used to help elucidate the mechanism and kinetics by which biofilms form, as well as identify components that are important to biofilm structure and stability.

In vitro Biofilm Formation in an 8-well Chamber Slide

This article describes the procedure for the formation and visualization of a bacterial biofilm grown within an 8-well chamber slide

تشكيل بيوفيلم في المختبر في غرفة الشرائح 8 جيد

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. ...

A Microplate Assay to Assess Chemical Effects on RBL-2H3 Mast Cell Degranulation: Effects of Triclosan without Use of an Organic Solvent

Mast cells play important roles in allergic disease and immune defense against parasites. Once activated (e.g. by an allergen), they degranulate, a process that results in the exocytosis of allergic mediators. Modulation of mast cell degranulation by drugs and toxicants may have positive or adverse effects on human health. Mast cell function has been dissected in detail with the use of rat basophilic leukemia mast cells (RBL-2H3), a widely accepted model of human mucosal mast cells3-5. Mast cell granule component and the allergic mediator &#946;-hexosaminidase, which is released linearly in tandem with histamine from mast cells6, can easily and reliably be measured through reaction with a fluorogenic substrate, yielding measurable fluorescence intensity in a microplate assay that is amenable to high-throughput studies1. Originally published by Naal et al.1, we have adapted this degranulation assay for the screening of drugs and toxicants and demonstrate its use here.
Triclosan is a broad-spectrum antibacterial agent that is present in many consumer products and has been found to be a therapeutic aid in human allergic skin disease7-11, although the mechanism for this effect is unknown. Here we demonstrate an assay for the effect of triclosan on mast cell degranulation. We recently showed that triclosan strongly affects mast cell function2. In an effort to avoid use of an organic solvent, triclosan is dissolved directly into aqueous buffer with heat and stirring, and resultant concentration is confirmed using UV-Vis spectrophotometry (using &#949;280 = 4,200 L/M/cm)12. This protocol has the potential to be used with a variety of chemicals to determine their effects on mast cell degranulation, and more broadly, their allergic potential.

Mast cell degranulation, the release of allergic mediators, is important in allergy, asthma, and parasite defense. Here we demonstrate techniques1 for assessing effects of drugs and toxicants on degranulation, methodology recently utilized to exhibit the powerful inhibitory effect of antibacterial agent triclosan2.

والفحص صفيحة ميكروسكوبية لتقييم تأثيرات المواد الكيماوية على RBL-2H3 الصاري تحبب الخلايا: آثار التريكلوسان بدون استخدام مذيب عضوي

Mast cells play important roles in allergic disease and immune defense against parasites. Once activated (e.g. by an allergen), they degranulate, a ...

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are upregulated upon this ongoing antigen exposure and contribute to loss of proliferation, reduced cytolytic function, and impaired cytokine production by CD4 and CD8 T cells. In the murine model of LCMV infection, administration of blocking antibodies against these two pathways augmented T cell responses. However, there is currently no in vitro assay to measure the impact of such blockade on cytokine secretion in cells from human samples. Our protocol and experimental approach enable us to accurately and efficiently quantify the restoration of cytokine production by HIV-specific CD4 T cells from HIV infected subjects.
Here, we depict an in vitro experimental design that enables measurements of cytokine secretion by HIV-specific CD4 T cells and their impact on other cell subsets. CD8 T cells were depleted from whole blood and remaining PBMCs were isolated via Ficoll separation method. CD8-depleted PBMCs were then incubated with blocking antibodies against PD-L1 and/or IL-10R&#945; and, after stimulation with an HIV-1 Gag peptide pool, cells were incubated at 37 &#176;C, 5% CO2. After 48 hr, supernatant was collected for cytokine analysis by beads arrays and cell pellets were collected for either phenotypic analysis using flow cytometry or transcriptional analysis using qRT-PCR. For more detailed analysis, different cell populations were obtained by selective subset depletion from PBMCs or by sorting using flow cytometry before being assessed in the same assays. These methods provide a highly sensitive and specific approach to determine the modulation of cytokine production by antigen-specific T-helper cells and to determine functional interactions between different populations of immune cells.

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

We developed an in vitro assay to investigate the role of immunoregulatory pathways in the regulation of cytokine secretion by HIV-specific CD4 T cells.

في المختبر الفحص لتقييم أثر مناعة مقررات تمهيدية بشأن فيروس نقص المناعة CD4 T محددة المستجيب خلية وظيفة

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

التالية في الوقت الحقيقي تأثير العوامل الالتهاب الرئوي الحاد الفوعة في نموذج الفأر الالتهاب الرئوي عن طريق البكتيريا للإضاءة الحيوية

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal epidemiology, capsular serotyping can provide useful information for vaccine efficacy and impact studies.&#160;The Quellung reaction is the gold standard method for pneumococcal capsular serotyping. The method involves testing a pneumococcal cell suspension with pooled and specific antisera directed against the capsular polysaccharide. The antigen-antibody reactions are observed microscopically. The protocol has three main steps: 1) preparation of a bacterial cell suspension, 2) mixing of cells and antisera on a glass slide, and 3) reading the Quellung reaction using a microscope. The Quellung reaction is reasonably simple to perform and can be applied wherever a suitable microscope and antisera are available.

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

The Quellung reaction is the gold standard technique for serotyping Streptococcus pneumoniae. This technique utilizes a microscope and specific pneumococcal antisera and is commonly used in reference and research laboratories worldwide.

المحفظة المصلي من<em&gt; العقدية الرئوية</em&gt; باستخدام تفاعل الانتباج

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major cause of morbidity and mortality world-wide. Current vaccines target the pneumococcal capsule, and there are over 90 capsular serotypes. Serotyping pneumococcal isolates is therefore important for assessing the impact of vaccination programs and for epidemiological purposes. The World Health Organization has recommended latex agglutination as an alternative method to the &#8216;gold standard&#8217; Quellung test for serotyping pneumococci. Latex agglutination is a relatively simple, quick and inexpensive method; and is therefore suitable for resource-poor settings as well as laboratories with high-volume workloads. Latex agglutination reagents can be prepared in-house utilizing commercially-sourced antibodies that are passively attached to latex particles. This manuscript describes a method of production and quality control of latex agglutination reagents, and details a sequential testing approach which is time- and cost-effective. 
This method of production and quality control may also be suitable for other testing purposes.

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination testing is a simple, rapid and inexpensive method for serotyping Streptococcus pneumoniae, and has also been widely applied in diagnostic microbiology. This manuscript describes the in-house production of latex agglutination reagents, quality control procedures and the application of this technique to pneumococcal serotyping.

المحفظة المصلي من<em&gt; العقدية الرئوية</em&gt; من جانب تراص اللاتكس

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

Using the Overlay Assay to Qualitatively Measure Bacterial Production of and Sensitivity to Pneumococcal Bacteriocins

Streptococcus pneumoniae colonizes the highly diverse polymicrobial community of the nasopharynx where it must compete with resident organisms. We have shown that bacterially produced antimicrobial peptides (bacteriocins) dictate the outcome of these competitive interactions. All fully-sequenced pneumococcal strains harbor a bacteriocin-like peptide (blp) locus. The blp locus encodes for a range of diverse bacteriocins and all of the highly conserved components needed for their regulation, processing, and secretion. The diversity of the bacteriocins found in the bacteriocin immunity region (BIR) of the locus is a major contributor of pneumococcal competition. Along with the bacteriocins, immunity genes are found in the BIR and are needed to protect the producer cell from the effects of its own bacteriocin. The overlay assay is a quick method for examining a large number of strains for competitive interactions mediated by bacteriocins. The overlay assay also allows for the characterization of bacteriocin-specific immunity, and detection of secreted quorum sensing peptides. The assay is performed by pre-inoculating an agar plate with a strain to be tested for bacteriocin production followed by application of a soft agar overlay containing a strain to be tested for bacteriocin sensitivity. A zone of clearance surrounding the stab indicates that the overlay strain is sensitive to the bacteriocins produced by the pre-inoculated strain. If no zone of clearance is observed, either the overlay strain is immune to the bacteriocins being produced or the pre-inoculated strain does not produce bacteriocins. To determine if the blp locus is functional in a given strain, the overlay assay can be adapted to evaluate for peptide pheromone secretion by the pre-inoculated strain. In this case, a series of four lacZ-reporter strains with different pheromone specificity are used in the overlay.

Competition in Streptococcus pneumoniae is mediated by bacteriocins, small antimicrobial peptides with inhibitory activity towards pneumococcus and other related species.&#160; Here we describe an optimized bacterial overlay assay that allows for the characterization of bacteriocin activity and inhibitory spectrum, bacteriocin-specific immunity, and detection of secreted quorum sensing peptides.

باستخدام تراكب الفحص لقياس نوعيا الإنتاج الجرثومي من والحساسية للالرئوية Bacteriocins

Streptococcus pneumoniae colonizes the highly diverse polymicrobial community of the nasopharynx where it must compete with resident organisms.  We have ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

ل<em&gt; في المختبر</em&gt; نموذج من حاجز الدم في الدماغ عن طريق التحليل الطيفي المعاوقة: التركيز على التفاعل خلية تي خلية البطانية

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Flow Cytometric Analysis of Particle-bound Bet v 1 Allergen in PM10

Flow cytometry is a method widely used to quantify suspended solids such as cells or bacteria in a size range from 0.5 to several tens of micrometers in diameter. In addition to a characterization of forward and sideward scatter properties, it enables the use of fluorescent labeled markers like antibodies to detect respective structures. Using indirect antibody staining, flow cytometry is employed here to quantify birch pollen allergen (precisely Bet v 1)-loaded particles of 0.5 to 10 &#181;m in diameter in inhalable particulate matter (PM10, particle size &#8804;10 &#181;m in diameter). PM10 particles may act as carriers of adsorbed allergens possibly transporting them to the lower respiratory tract, where they could trigger allergic reactions.
So far the allergen content of PM10 has been studied by means of enzyme linked immunosorbent assays (ELISAs) and scanning electron microscopy. ELISA measures the dissolved and not the particle-bound allergen. Compared to scanning electron microscopy, which can visualize allergen-loaded particles, flow cytometry may additionally quantify them. As allergen content of ambient air can deviate from birch pollen count, allergic symptoms might perhaps correlate better with allergen exposure than with pollen count. In conjunction with clinical data, the presented method offers the opportunity to test in future experiments whether allergic reactions to birch pollen antigens are associated with the Bet v 1 allergen content of PM10 particles &#62;0.5 &#181;m.

Here, we present a protocol to quantify allergen-loaded particles by flow cytometry. Ambient particulate matter particles may act as carriers of adsorbed allergens. We show here that flow cytometry, a method widely used to characterize suspended solids &#62;0.5 &#181;m in diameter, can be used to measure these allergen-loaded particles.

تدفق تحليل Cytometric من متجهة الجسيمات بيت ت 1 مسببات الحساسية في PM10

Flow cytometry is a method widely used to quantify suspended solids such as cells or bacteria in a size range from 0.5 to several tens of micrometers in ...

Visualizing the Effects of Sputum on Biofilm Development Using a Chambered Coverglass Model

Biofilms consist of groups of bacteria encased in a self-secreted matrix. They play an important role in industrial contamination as well as in the development and persistence of many health related infections. One of the most well described and studied biofilms in human disease occurs in chronic pulmonary infection of cystic fibrosis patients. When studying biofilms in the context of the host, many factors can impact biofilm formation and development. In order to identify how host factors may affect biofilm formation and development, we used a static chambered coverglass method to grow biofilms in the presence of host-derived factors in the form of sputum supernatants. Bacteria are seeded into chambers and exposed to sputum filtrates. Following 48 hr of growth, biofilms are stained with a commercial biofilm viability kit prior to confocal microscopy and analysis. Following image acquisition, biofilm properties can be assessed using different software platforms. This method allows us to visualize key properties of biofilm growth in presence of different substances including antibiotics.

This protocol describes the visualization of biofilm development following exposure to host-factors using a slide chamber model. This model allows for direct visualization of biofilm development as well as analysis of biofilm parameters using computer software programs.

تصور آثار البلغم للتنمية بيوفيلم باستخدام نموذج غرف ساترة

Biofilms consist of groups of bacteria encased in a self-secreted matrix. They play an important role in industrial contamination as well as in the ...