Ratones, de tipo salvaje (Mavs + / +) y knockout (Mavs - / -) de tipo salvaje (Mavs + / +) y knockout (Mavs - / -) MEFs fueron amablemente proporcionados por el Dr. Zhijian J. Chen (Universidad de Texas Southwestern Medical Center) 13. Esta publicación se basa en un trabajo financiado por subvenciones del NIH (R01 CA134241 y R01 DE021445) y la Sociedad Americana del Cáncer (RSG-11-162-01-MPC).

Declaración de Ética: Todo animal de trabajo se realizó en estricta conformidad con las recomendaciones de la Guía para el Cuidado y Uso de Animales de Laboratorio de los Institutos Nacionales de Salud. El protocolo fue aprobado por el Cuidado de Animales y el empleo Comisión Institucional (IACUC) de la Universidad del Sur de California. 1. Cytokine Gene Expression Cuantitativo en tiempo real PCR y secreción por ELISA en ratones infectados-HV68 <ol><li> Anestesie, 6-8 semanas de edad C57BL / 6 de camada (B6) emparejados por sexo (8-12 ratones / grupo) a través de la inyección intraperitoneal de 1,5 mg de ketamine/0.12 mg de xilazina, e inocular por vía intranasal con 40 UFP de HV68 en 40 l (infección se detalla en el Dong Feng y 11). En diferentes puntos de tiempo después de la infección, la eutanasia a los ratones mediante inhalación de CO 2 seguido por dislocación cervical. </li><li> Abre el cofre con un corte lateral izquierda por el sternum y cortar a través de las costillas con unas tijeras afiladas. Recoge los tejidos pulmonares. </li><li> Recoger medio del tejido pulmonar (lóbulo izquierdo) en tubos de 1,5 ml con tapón de rosca estériles que contienen 500 l 1,0 mm perlas de zirconia / sílice. Añadir 1 ml de DMEM libre de suero frío en el tubo y homogeneizar el tejido pulmonar por el grano que el maltrato durante 30 segundos. Chill tubos en hielo durante 2 minutos y repetir este proceso una vez. </li><li> Centrifugar los tubos (15.000 x g durante 10 min) a 4 ° C, recoger el sobrenadante y medir la producción de citoquinas como se describe a continuación. </li><li> Medir citoquinas utilizando kits de ELISA de citoquinas disponibles en el mercado de acuerdo con las instrucciones del fabricante. </li><li> Recoger la otra mitad del tejido pulmonar (lóbulo derecho) en otro tubo que contiene perlas y añadir 1 ml de TRIzol. Homogeneizar y se recoge el sobrenadante como se describe en el paso 1.3 y ARN extracto de acuerdo con las instrucciones del fabricante. Determinar la concentración de ARN mediante la adopción de las lecturas de absorbancia a 260 y 280 nm. </li&gt; <li> Preparar ADNc con 1 g de ARN total y la transcriptasa inversa de acuerdo con las instrucciones del fabricante (el volumen final total fue de 20 l). Diluir cDNA 50 veces con DNasa y RNasa libre de agua y llevar a cabo cuantitativa en tiempo real PCR. </li><li> Lleve a cabo el programa en un tiempo real de la máquina de PCR cuantitativa. Cada reacción contiene 0,5 l de un par de cebadores específicos de gen o cebadores de control de GAPDH (la concentración de trabajo de los cebadores eran 10 mM, CE 500 nM para cada cebador), 5 l de la mezcla maestra de SYBR y 4 l de la diluyeron ADNc. Calcular ΔΔCt para determinar la cantidad relativa de transcritos de ARNm de citoquinas antivirales. </li></ol> 2. La infección de la célula MEF y citoquinas cuantificación por ELISA y QRT-PCR <ol><li> Crecer Mavs + / + y Mavs - / - células MEF a sub-confluente (aproximadamente el 80%) la densidad de las placas, las células. </li><li> Dividir células MEF en 12-queplacas ll en 100.000 células / pocillo (la densidad celular será de alrededor de 70% en el segundo día). Llevar a cabo la infección HV68 por triplicado, con una multiplicidad de infección (MOI) de 5-10 para sincronizar y maximizar la inducción de citoquinas. </li><li> Preparar HV68 suspensión en medio DMEM completo que contiene la cantidad adecuada de virus (1 ml para cada pocillo). </li><li> Retire medio y agregue HV68-que contiene la suspensión de células MEF. </li><li> Colocar la placa en el cultivo de tejidos incubadora, el rock cada 30 minutos, y permitir un total de 2 horas de incubación. </li><li> Retire el medio que contiene HV68-, lavar una vez con PBS, y reemplazar con DMEM completo fresco. </li><li> En varios puntos de tiempo después de la infección, el medio de la cosecha en 1,5 ml de tubos de Eppendorf. Lavar las células con PBS frío y recoger las células infectadas por digestión con tripsina. </li><li> Mida citocinas antivirales en un medio tal como se describe en el paso 1.5. </li><li> Extraer el ARN, ADNc preparar y realizar QRT-PCR para determinar la expresión de genes de citocina antiviralcomo se describe en los pasos 1.5 hasta 1.7. </li></ol> 3. Producción lentivirus, Infección, y Generación de líneas celulares estables <ol><li> Dividir las células 293T un día antes de la transfección y permiten que las células lleguen a ~ 40% de confluencia en el momento de la transfección. </li><li> Transfectar 10 cm placa de células 293T con los plásmidos de embalaje (1,2 microgramos de pVSV-G y 6 g de pDR8.9) y 7,2 g de Pcdh-Bandera-MAVS o el control Pcdh por precipitación de fosfato de calcio. </li><li> Reemplazar medio a 6 a 8 horas después de la transfección con DMEM completo fresco. </li><li> En 72 horas después de la transfección, recoger medio que contiene lentivirus, centrifugar a 4000 xg durante 15 min, y el filtro con 0,22 m de membrana. Para aumentar el título de lentivirus, que centrífuga el medio que contiene el virus a 110.000 xg durante 2,5 horas a 4 ° C. Resuspender cuidadosamente el sedimento viral en pequeño volumen de medio de interés. </li><li> Mavs Seed - / - MEF células u otras células MEF nocaut un día before infección en placas de 6 pocillos a ~ 30-40% de confluencia. </li><li> Infectar las células MEF con 1 ml de lentivirus y 2 ml de DMEM completo fresco, suplementado con polibreno a una concentración final de 10 mg / ml. </li><li> Centrifugar la placa a 500 xg a 30 º C durante 30 min y transferir la placa a una incubadora de cultivo de tejidos. </li><li> Reemplace medio a 6 horas después de la infección con DMEM completo fresco. </li><li> Dividir las células MEF en 24 horas después de la infección y se suman a la puromicina a una concentración final de 1 mg / ml a las 48 horas después de la infección para seleccionar las células que expresan de forma estable MAVS. </li><li> Mantener MEF células en medio que contenía puromicina y verificar la expresión de proteínas por inmunotransferencia con anticuerpos correspondientes. </li><li> Las células se pueden utilizar para la infección viral, la expresión de genes de citoquinas y la secreción de experimentos como se describe en el Protocolo 2. </li></ol>

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

Los autores declaran no tener ningún conflicto de intereses.

Evasión inmune viral es una de las interacciones más dinámicas y fascinantes interfaces delito viral y la defensa de acogida 9. Los componentes de la inmunidad innata de acogida están estructurados de tal manera que la transducción de señales que se inicie de manera efectiva y transmitida fielmente. Delimitación de la jerarquía y la regulación de las cascadas de señalización es un tema prominente de la inmunidad innata. Aquí, presentamos un protocolo para identificar las funciones de regulación d...

Estudios recientes han indicado las cascadas de señalización en general en el montaje de acogida la respuesta inmune innata. Residiendo en compartimentos distintos, los receptores de reconocimiento de patrones (RRP) detectar patógenos asociados a patrones moleculares (PAMP) de diverso origen para desencadenar inmune innato señalización 1. El gen inducida por ácido retinoico-I (GAR-I) y antígeno de diferenciación de melanoma (5) MDA5 proteínas citosólicas son sensores que reconocen especies de ARN con características estructurales específicas 2. Después de la activación, RIG-I interactúa con sus MAVS aguas abajo (también conocido como IPS-1, VISA y CARDIF) adaptador que, a su vez, activa la IKK (IKKαβγ) y relacionados con IKK-quinasa (TBK1 y IKKε, también conocido como Ikki ) Los complejos de 3-6. Quinasas activadas fosforilan inmunes innatas reguladores clave de la expresión génica, incluyendo factores de transcripción y los inhibidores de los mismos, y permiten la activación transcripcional de los genes antivirales de acogida (por ejemplo, IL-6, TNF &amp; #945;, CCL5, y IFNß). Estas cascadas de señalización constituyen potentes respuestas inmunes innatas intrínsecas que establecen un estado anti-microbiana para restringir la propagación de patógenos durante las primeras etapas de la infección. Murino HV68 está estrechamente relacionado con oncogénico VHSK humana y VEB. Así, la infección de los ratones HV68 proporciona un modelo animal pequeño manejable para examinar la respuesta inmune del huésped a la infección por virus del herpes gamma in vivo 7. Usando HV68, nuestro laboratorio ha descubierto una estrategia compleja cual HV68 secuestra albergar señalización inmune innata para permitir la infección viral. Por un lado, HV68 activa la vía MAVS-IKKβ para promover la activación de la transcripción viral a través de la dirección de IKKβ activado para fosforilar transactivador la replicación (ACR), el factor de transcripción clave para la replicación viral HV68 8. Por otra parte, la fosforilación mediada por IKKβ prepara de RelA para la degradación y plazoinates activación de NFkB 9. Como tal, la infección HV68 evita con eficacia la producción de citoquinas antivirales. Curiosamente, una proyección que utiliza una biblioteca de expresión de la HV68 identificó RTA como una ligasa E3 para inducir la degradación de RelA y suprimirá la activación de NFkB 10. Estos resultados descubren una estrategia de evasión inmune compleja mediante el cual los eventos de señalización inmune aguas arriba son aprovechados por HV68 para negar lo último la producción de citoquinas antivirales. Aquí se describe un protocolo para medir la producción de citoquinas antivirales en ratones infectados con HV68 tanto in vivo como ex viv o. En el protocolo se explora aún más la expresión &quot;reconstituido&quot; de los componentes de la inmunidad innata en los fibroblastos de embriones knockout mediante transducción lentiviral, que establece claramente la función de las moléculas inmunes innatas específicas en la regulación de la producción de citoquinas antivirales. Este protocolo se puede adaptar fácilmente a otros viruses y vías de señalización.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

En respuesta a una infección viral, la respuesta inmune innata de acogida se activa para regular por incremento la expresión génica y la producción de citoquinas antivirales. Por el contrario, los virus han desarrollado estrategias complejas para evadir y explotar la señalización inmune del huésped para la supervivencia y propagación. Evasión inmune viral, lo que implica la defensa del huésped y la evasión viral, ofrece una de las interfaces más fascinantes y dinámicos para discernir la interacción huésped-virus. Estos estudios avanzan nuestros conocimientos en la regulación inmune innata y allanan el camino para desarrollar nuevas terapias antivirales. Murino HV68 es un patógeno natural de los roedores murinos. HV68 infección de ratones como modelo animal pequeño manejable para examinar la respuesta antiviral a HVSK humana y VEB de que la perturbación de la in vivo interacciones virus-huésped no es aplicable. Aquí se describe un protocolo para determinar la producción de citoquinas antivirales. Este protocolo se puede adaptar a otros Virusos y las vías de señalización. Recientemente, se ha descubierto que HV68 secuestra MAVS y IKKβ, componentes inmunes innatas clave de señalización corriente abajo de la citosólica RIG-I y MDA5, se decida suprimir la activación de NFkB y la producción de citoquinas antivirales. Específicamente, la infección activa HV68 IKKβ y que IKKβ activado fosforila relación a acelerar la degradación de RelA. Como tal, γ HV68 desacopla eficazmente la activación de NFkB de su ascendente IKKβ activado, negando antiviral expresión génica de citocinas. Este estudio aclara una estrategia compleja por lo que la activación inmune innata aguas arriba es interceptada por un patógeno viral para anular la activación transcripcional intermedio inmediato y evadir la producción de citoquinas antivirales.

Tres figuras representativas se muestran aquí, incluyendo la producción de citoquinas en el pulmón de Mavs infectados-HV68 + / + y Mavs-/ - ratón, la secreción de citoquinas y la expresión génica nivel de Mavs infectados-HV68 + / + y Mavs - / - MEFs, y niveles de citoquinas mRNA de Mavs infectadas HV68 - / - MEFs &quot;reconstituidas&quot; con MAVS. Estos experimentos representativos utilizan ratones knockout de ge...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Se describe un protocolo para medir la producción de citoquinas antivirales en ratones infectados con un virus herpes modelo, murino herpesvirus gamma 68 (γ HV68) que está relacionado con estrechamente a sarcoma de herpesvirus asociado de Kaposi humano (VHSK) y virus de Epstein-Barr (EBV). La utilización de cepas de ratones genéticamente modificados y los fibroblastos de embriones de ratón (MEFs), se evaluó la producción de citocina antiviral tanto in vivo como ex vivo. &quot;Reconstituir&quot; la expresión de los componentes inmunes innatas en eliminatorias fibroblastos embrionarios de transducción lentiviral, Señalamos además moléculas inmunes innatas específicas y diseccionar los eventos de señalización clave que regulan diferencialmente la producción de citocina antiviral.

La disección de señalización inmune innata en Evasion Viral de la producción de citoquinas

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

dissecting-innate-immune-signaling-viral-evasion-cytokine

Research

JoVE Journal

Immunology and Infection

10.4K vistas.  Keck School of Medicine, University of Southern California.  Se describe un protocolo para medir la producción de citoquinas antivirales en ratones infectados con un virus herpes modelo, murino herpesvirus gamma 68 (γ HV68) que está relacionado con estrechamente a sarcoma de herpesvirus asociado de Kaposi humano (VHSK) y virus de Epstein-Barr (EBV). La utilización de cepas de ratones genéticamente modificados y los fibroblastos de embriones...

Video: Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently being tested in human clinical trials. Wild-type AAV is a non-pathogenic member of the parvoviridae family and inherently replication-deficient. The broad transduction profile, low immune response as well as the strong and persistent transgene expression achieved with these vectors has made them a popular and versatile tool for in vitro and in vivo gene delivery. rAAVs can be easily and cheaply produced in the laboratory and, based on their favourable safety profile, are generally given a low safety classification. Here, we describe a method for the production and titering of chimeric rAAVs containing the capsid proteins of both AAV1 and AAV2. The use of these so-called chimeric vectors combines the benefits of both parental serotypes such as high titres stocks (AAV1) and purification by affinity chromatography (AAV2). These AAV serotypes are the best studied of all AAV serotypes, and individually have a broad infectivity pattern. The chimeric vectors described here should have the infectious properties of AAV1 and AAV2 and can thus be expected to infect a large range of tissues, including neurons, skeletal muscle, pancreas, kidney among others. The method described here uses heparin column purification, a method believed to give a higher viral titer and cleaner viral preparation than other purification methods, such as centrifugation through a caesium chloride gradient. Additionally, we describe how these vectors can be quickly and easily titered to give accurate reading of the number of infectious particles produced.

Recombinant adeno-associated virus (rAAVs) vectors are becoming increasingly valuable for in vivo studies in animals. We describe how rAAVs can be produced in the laboratory and how these vectors can be titered to give an accurate reading of the number of infectious particles produced.

Producción y Titulación de recombinantes adeno-asociado vectores virales

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Investigación

Inmunología e Infección

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

The phagocyte respiratory burst is part of the innate immune response to pathogen infection and involves the production of reactive oxygen species (ROS). ROS are toxic and function to kill phagocytized microorganisms. In vivo quantification of phagocyte-derived ROS provides information regarding an organism's ability to mount a robust innate immune response. Here we describe a protocol to quantify and compare ROS in whole zebrafish embryos upon chemical induction of the phagocyte respiratory burst. This method makes use of a non-fluorescent compound that becomes fluorescent upon oxidation by ROS. Individual zebrafish embryos are pipetted into the wells of a microplate and incubated in this fluorogenic substrate with or without a chemical inducer of the respiratory burst. Fluorescence in each well is quantified at desired time points using a microplate reader. Fluorescence readings are adjusted to eliminate background fluorescence and then compared using an unpaired t-test. This method allows for comparison of the respiratory burst potential of zebrafish embryos at different developmental stages and in response to experimental manipulations such as protein knockdown, overexpression, or treatment with pharmacological agents. This method can also be used to monitor the respiratory burst response in whole dissected kidneys or cell preparations from kidneys of adult zebrafish and some other fish species. We believe that the relative simplicity and adaptability of this protocol will complement existing protocols and will be of interest to researchers who seek to better understand the innate immune response.

The innate immune response protects organisms against pathogen infection. A critical component of the innate immune response, the phagocyte respiratory burst, generates reactive oxygen species that kill invading microorganisms. We describe a respiratory burst assay that quantifies reactive oxygen species produced when the innate immune response is chemically induced.

Cuantificación de la respuesta estallido respiratorio como un indicador de la salud inmune innata en el pez cebra

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

El uso de ARN de interferencia para Investigar la respuesta inmune innata en macrófagos de ratón

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of causing systemic disease in both fish and humans. A better understanding of S. iniae disease pathogenesis requires an appropriate model system. The genetic tractability and the optical transparency of the early developmental stages of zebrafish allow for the generation and non-invasive imaging of transgenic lines with fluorescently tagged immune cells. The adaptive immune system is not fully functional until several weeks post fertilization, but zebrafish larvae have a conserved vertebrate innate immune system with both neutrophils and macrophages. Thus, the generation of a larval infection model allows the study of the specific contribution of innate immunity in controlling S. iniae infection.
The site of microinjection will determine whether an infection is systemic or initially localized. Here, we present our protocols for otic vesicle injection of zebrafish aged 2-3 days post fertilization as well as our techniques for fluorescent confocal imaging of infection. A localized infection site allows observation of initial microbe invasion, recruitment of host cells and dissemination of infection. Our findings using the zebrafish larval model of S. iniae infection indicate that zebrafish can be used to examine the differing contributions of host neutrophils and macrophages in localized bacterial infections. In addition, we describe how photolabeling of immune cells can be used to track individual host cell fate during the course of infection.

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Here, we present a protocol for the generation and imaging of a localized bacterial infection in the zebrafish otic vesicle.

Imagen no invasiva de la respuesta inmune innata en un modelo de larvas de pez cebra de<em&gt; Streptococcus iniae</em&gt; Infección

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research is deciphering how these dynamic protein complexes act to integrate signals from multiple sources in order to direct a specific biological response, and how this becomes deregulated in many disease settings. Despite the importance of this key biochemical mechanism, there is a lack of experimental techniques that can facilitate the specific and sensitive deconvolution of these multi-molecular signaling complexes.
Here this shortcoming is addressed through the combination of a protein complementation assay with a conformation-specific nanobody, which we have termed Bimolecular Complementation Affinity Purification (BiCAP). This novel technique facilitates the specific isolation and downstream proteomic characterization of any pair of interacting proteins, to the exclusion of un-complexed individual proteins and complexes formed with competing binding partners. 
The BiCAP technique is adaptable to a wide array of downstream experimental assays, and the high degree of specificity afforded by this technique allows more nuanced investigations into the mechanics of protein complex assembly than is currently possible using standard affinity purification techniques.

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

This manuscript describes the protocol for Bimolecular Complementation Affinity Purification (BiCAP). This novel method facilitates the specific isolation and downstream proteomic characterization of any two interacting proteins, while excluding un-complexed individual proteins as well as complexes formed with competing binding partners.

Disección señalización complejos por purificación de la afinidad de complementación Bimolecular (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies in an attempt to understand the precise mechanisms that lead to the breakdown of self-tolerance and subsequent autoimmunity. Approaches thus far have been based on the study of one specific aspect of the immune system (a single or few cell types or cytokines), and do not offer a global assessment of complex autoimmune disease. While patient sera-based studies have afforded important insights into autoimmunity, they do not provide the specific cellular source of the dysregulated cytokines detected. A comprehensive single-cell approach to evaluate cytokine production in multiple immune cell subsets, within the context of &#34;intrinsic&#34; patient-specific plasma circulating factors, is described here. This approach enables monitoring of the patient-specific immune phenotype (surface markers) and function (cytokines), either in its native &#34;intrinsic pathogenic&#34; disease state, or in the presence of therapeutic agents (in vivo or ex vivo).

Here we describe a single-cell proteomic approach to evaluate immune phenotypic and functional (intracellular cytokine induction) alterations in peripheral whole blood samples, analyzed via mass cytometry.

Análisis unicelular de Immunophenotype y producción de citoquinas en sangre periférica por citometría de masas

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

Un modelo de ratón para evaluar respuesta inmune innata a la infección por Staphylococcus aureus

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal host-microbe interactions. It is well established that different commensals exhibit a different potential to stimulate the host intestinal immune system. Such investigations involve vertebrate animals, especially rodents. Since increasing ethical concerns are linked with experiments involving vertebrates, there is a high demand for invertebrate replacements models. 
Here, we provide a Galleria mellonella oral administration model using commensal non-pathogenic bacteria and the possible assessment of the immunogenic potential of commensals on the G. mellonella immune system. We demonstrate that G. mellonella is a useful alternative invertebrate replacement model that allows the analysis of commensals with different immunogenic potential such as Bacteroides vulgatus and Escherichia coli. Interestingly, the bacteria exhibited no killing effect on the larvae, which is similar to mammals. The immune responses of G. mellonella were comparable with vertebrate innate immune responses and involve recognition of the bacteria and production of antimicrobial molecules. We propose that G. mellonella was able to restore previous microbiota balance, which is well known from healthy mammalian individuals. Although providing comparable innate immune responses in both G. mellonella and vertebrates, G. mellonella does not harbor an adaptive immune system. Since the investigated components of the innate immune system are evolutionary conserved, the model allows a prescreening and first analysis of bacterial immunogenic properties.

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Here, we provide a detailed protocol for an oral administration model using Galleria mellonella larvae and how to characterize induced innate immune responses. Using this protocol, researchers without practical experience will be able to use the G. mellonella force-feeding method.

Un modelo de administración Oral de Galleria mellonella para la respuesta inmune innata Study Commensal-Induced

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal immunity, because they can model host-pathogen interactions in the tissue. While isolated cells derived from tissues were the first cell culture model, their use has been neglected because tissue can be hard to obtain. In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells (TMCs) from healthy human tonsils to study innate immune responses upon activation, mimicking viral infection in mucosal tissues. Isolation of TMCs from the tonsils is quick, because the tonsils barely have any epithelium and yield up to billions of all major immune cell types. This method allows detection of cytokine production using several techniques, including immunoassays, qPCR, microscopy, flow cytometry, etc., similar to the use of peripheral mononuclear cells (PBMCs) from blood. Furthermore, TMCs show a higher sensitivity to drug testing than PBMCs, which needs to be considered for future toxicity assays. Thus, ex vivo TMCs cultures are an easy and accessible mucosal model.

In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells from healthy humans undergoing partial surgical tonsillectomy to study innate immune responses upon activation, mimicking viral infection in mucosal tissues.

Aislamiento de células mononucleares tonitarias para estudiar las respuestas inmunitarias innatas ex vivo en un tejido linfático mucoso humano

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...

Microfluidic Co-Culture Models for Dissecting the Immune Response in in vitro Tumor Microenvironments

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise invisible processes. Advanced cell assays closely mimicking in vivo scenery are establishing themselves as novel ways to visualize and measure the bidirectional tumor-host interplay influencing the progression of cancer. Here we describe two versatile protocols to recreate highly controllable 2D and 3D co-cultures in microdevices, mimicking the complexity of the tumor microenvironment (TME), under natural and therapy-induced immunosurveillance. In section 1, an experimental setting is provided to monitor crosstalk between adherent tumor cells and floating immune populations, by bright field time-lapse microscopy. As an applicative scenario, we analyze the effects of anti-cancer treatments, such as the so-called immunogenic cancer cell death inducers on the recruitment and activation of immune cells. In section 2, 3D tumor-immune microenvironments are assembled in a competitive layout. Differential immune infiltration is monitored by fluorescence snapshots up to 72 h, to evaluate combination therapeutic strategies. In both settings, image processing steps are illustrated to extract a plethora of immune cell parameters (e.g., immune cell migration and interaction, response to therapeutic agents). These simple and powerful methods can be further tailored to simulate the complexity of the TME encompassing the heterogeneity and plasticity of cancer, stromal and immune cells subtypes, as well as their reciprocal interactions as drivers of cancer evolution. The compliance of these rapidly evolving technologies with live-cell high-content imaging can lead to the generation of large informative datasets, bringing forth new challenges. Indeed, the triangle &#39;&#39;co-cultures/microscopy/advanced data analysis&#34; sets the path towards a precise problem parametrization that may assist tailor-made therapeutic protocols. We expect that future integration of cancer-immune on-a-chip with artificial intelligence for high-throughput processing will synergize a large step forward in leveraging the capabilities as predictive and preclinical tools for precision and personalized oncology.

In the age of immunotherapy and single-cell genomic profiling, cancer biology requires novel in vitro and computational tools for investigating the tumor-immune interface in a proper spatiotemporal context. We describe protocols to exploit tumor-immune microfluidic co-cultures in 2D and 3D settings, compatible with dynamic, multiparametric monitoring of cellular functions.

Modelos de cocultivo microfluídico para diseccionar la respuesta inmune en microambientes tumorales in vitro

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise ...