البرية من نوع (مافريكس + / +) وخروج المغلوب (مافريكس - / -) الفئران، وايلد من نوع (مافريكس + / +) وخروج المغلوب (مافريكس - / -) وMEFs المقدمة التفضل الدكتور تشي جيان تشن J. (جامعة تكساس جنوب غرب المركز الطبي) 13. ويستند هذا المنشور على العمل الممولة من المنح المقدمة من المعاهد الوطنية للصحة (R01 R01 CA134241 وDE021445) والجمعية الأميركية للسرطان (RSG-11-162-01-MPC).

تم تنفيذ جميع أعمال الحيوان تحت يتفق تماما مع التوصيات الواردة في دليل لرعاية واستخدام الحيوانات المختبرية من المعاهد الوطنية للصحة: ​​بيان الأخلاق. تمت الموافقة على البروتوكول من قبل اللجنة المؤسسية رعاية الحيوان واستخدام (IACUC) من جامعة جنوب كاليفورنيا. 1. خلوى التعبير الجيني عن طريق الكمي في الوقت الحقيقي PCR وإفراز بواسطة ELISA في الفئران γHV68 المصابة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تخدير، البالغ من العمر 6-8 أسابيع C57BL / 6 (B6) تتزاحم المطابقة بين الجنسين (8-12 الفئران / مجموعة) عن طريق الغشاء البريتونى ضخ 1.5 ملغ من ketamine/0.12 ملغ من زيلازين، وتطعيم الأنف مع 40 PFU من γHV68 في 40 ميكرولتر (عدوى المفصل في دونغ فنغ و11). في نقاط زمنية مختلفة بعد العدوى، الموت ببطء الفئران باستخدام ثاني أكسيد الكربون 2 استنشاق تليها خلع عنق الرحم. </li><li style=";text-align:right;direction:rtl"> فتح الصدر مع خفض الجانبي الأيسر على طول ستيرالأسطوانات وقطع طريق الأضلاع مع مقص حاد. جمع أنسجة الرئة. </li><li style=";text-align:right;direction:rtl"> جمع نصف أنسجة الرئة (الفص الأيسر) إلى 1.5 مل أنابيب معقمة المغطاة المسمار تحتوي على 500 ميكرولتر 1.0 مم حبات زركونيا / السيليكا. إضافة 1 مل من البرد المصل خالية DMEM في أنبوب والتجانس في أنسجة الرئة التي كتبها حبة الضرب لمدة 30 ثانية. هدئ أنابيب على الجليد لمدة 2 دقيقة، وتكرار هذه العملية مرة واحدة. </li><li style=";text-align:right;direction:rtl"> أنابيب الطرد المركزي (15،000 س ز لمدة 10 دقيقة) في 4 درجات مئوية، وجمع طاف وقياس إنتاج السيتوكينات كما هو موضح أدناه. </li><li style=";text-align:right;direction:rtl"> قياس السيتوكينات باستخدام المتاحة تجاريا خلوى مجموعات ELISA وفقا لتعليمات الشركة الصانعة. </li><li style=";text-align:right;direction:rtl"> جمع النصف الآخر من أنسجة الرئة (الفص الأيمن) في أنبوب يحتوي على حبة أخرى وإضافة 1 مل TRIzol. التجانس وجمع طاف كما هو موضح في الخطوة 1.3 و استخراج الحمض النووي الريبي وفقا لتعليمات لتصنيع. تحديد تركيز الحمض النووي الريبي من خلال اتخاذ قراءات الامتصاصية في 260 و 280 نانومتر. </li&gt; <li style=";text-align:right;direction:rtl"> إعداد [كدنا] مع 1 ميكروغرام من الحمض النووي الريبي مجموع والناسخ العكسي وفقا لتعليمات تصنيع و(بلغ مجموع الحجم النهائي 20 ميكرولتر). تمييع [كدنا 50 مرات مع الدناز وريبونوكلياز خالية من المياه وأداء الكمي في الوقت الحقيقي PCR. </li><li style=";text-align:right;direction:rtl"> تنفيذ البرنامج على الوقت الحقيقي PCR الكمي الجهاز. يحتوي كل رد فعل 0.5 ميكرولتر من زوج من الجينات المحددة الاشعال الاشعال أو السيطرة على GAPDH (تركيز عمل الاشعال كانت 10 ميكرومتر، م 500 نانومتر لكل التمهيدي)، 5 ميكرولتر من مزيج الرئيسي SYBR و 4 ميكرولتر من المخفف [كدنا]. حساب ΔΔCt لتحديد كمية النسبية للمحاضر مرنا السيتوكينات المضادة للفيروسات. </li></ol> 2. عدوى الخلية وخلوى MEF الكمي بواسطة ELISA وQRT-PCR <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تنمو مافريكس + / + ومافريكس - / - الخلايا MEF إلى شبه متموجة (حوالي 80٪) الكثافة قبل الطلاء الخلايا. </li><li style=";text-align:right;direction:rtl"> تقسيم الخلايا MEF في 12 نحنلوحات ليرة لبنانية في خلايا 100،000 / جيد (سوف تكون كثافة الخلية حوالي 70٪ في اليوم الثاني). تنفيذ الإصابة γHV68 في يثلث، مع عدد وافر من العدوى (وزارة الداخلية) من 5-10 لمزامنة وتعظيم خلوى الاستقراء. </li><li style=";text-align:right;direction:rtl"> إعداد γHV68 التعليق في المتوسطة DMEM كاملة تحتوي على كمية مناسبة من فيروس (1 مل لكل بئر). </li><li style=";text-align:right;direction:rtl"> إزالة المتوسطة وإضافة γHV68 التي تحتوي على التعليق على الخلايا MEF. </li><li style=";text-align:right;direction:rtl"> وضع لوحة في نسيج الثقافة الحاضنة، صخرة كل 30 دقيقة، ويسمح ما مجموعه 2 ساعة من الحضانة. </li><li style=";text-align:right;direction:rtl"> إزالة المحتوية على γHV68 المتوسطة، ويغسل مرة واحدة مع برنامج تلفزيوني، واستبدالها مع DMEM كاملة جديدة. </li><li style=";text-align:right;direction:rtl"> في وقت مختلف وتشير آخر العدوى والمتوسطة الحصاد إلى 1.5 مل أنابيب إيبندورف. غسل الخلايا مع برنامج تلفزيوني الباردة وجمع الخلايا المصابة بواسطة التربسين الهضم. </li><li style=";text-align:right;direction:rtl"> قياس السيتوكينات المضادة للفيروسات في المتوسط ​​كما هو موضح في الخطوة 1.5. </li><li style=";text-align:right;direction:rtl"> استخراج الحمض النووي الريبي، وإعداد وتنفيذ كدنا] QRT-PCR لتحديد المضادة للفيروسات خلوى التعبير الجينيكما هو موضح في الخطوات 1،5-1،7. </li></ol> 3. إنتاج الفيروسة البطيئة، العدوى، وجيل من خطوط الخلايا مستقرة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> انقسام الخلايا 293T قبل يوم واحد ترنسفكأيشن وتسمح للخلايا لتصل إلى 40٪ ~ confluency في وقت ترنسفكأيشن. </li><li style=";text-align:right;direction:rtl"> بالنقل 10 سم طبق من الخلايا 293T مع البلازميدات التعبئة والتغليف (1.2 ميكروغرام من pVSV-G و 6 ميكروغرام من pDR8.9) و 7.2 ميكروغرام من pCDH-FLAG-مافريكس أو السيطرة pCDH بواسطة الكالسيوم فوسفات هطول الأمطار. </li><li style=";text-align:right;direction:rtl"> استبدال المتوسطة في 6-8 ساعة بعد ترنسفكأيشن مع DMEM كاملة جديدة. </li><li style=";text-align:right;direction:rtl"> في 72 ساعة بعد ترنسفكأيشن، وجمع المتوسطة التي تحتوي على الفيروسة البطيئة، أجهزة الطرد المركزي في 4000 x ج لمدة 15 دقيقة، والتصفية مع 0.22 ميكرون الغشاء. لزيادة عيار الفيروسة البطيئة، ونحن الطرد المركزي المتوسطة المحتوية على الفيروس في 110،000 x ج لمدة 2.5 ساعة عند 4 درجات مئوية. في resuspend بعناية بيليه الفيروسية في حجم صغير من المتوسط ​​من الفائدة. </li><li style=";text-align:right;direction:rtl"> مافريكس البذور - / - الخلايا أو خلايا MEF خروج المغلوب MEF أخرى يوم واحد befoإعادة العدوى في 6 لوحات جيدة في ~ 30-40٪ confluency. </li><li style=";text-align:right;direction:rtl"> تصيب الخلايا MEF مع 1 مل الفيروسة البطيئة و2 مل DMEM كاملة جديدة، على أن تستكمل مع polybrene إلى تركيز النهائي من 10 ميكروغرام / مل. </li><li style=";text-align:right;direction:rtl"> أجهزة الطرد المركزي لوحة في 500 x ج في 30 درجة مئوية لمدة 30 دقيقة، ونقل لوحة لحاضنة زراعة الأنسجة. </li><li style=";text-align:right;direction:rtl"> استبدال المتوسطة في 6 ساعة بعد الإصابة مع DMEM كاملة جديدة. </li><li style=";text-align:right;direction:rtl"> انقسام الخلايا MEF في 24 ساعة بعد العدوى وإضافة بوروميسين إلى تركيز النهائي من 1 ميكروغرام / مل في 48 ساعة بعد الإصابة لتحديد الخلايا معربا عن ستابلي مافريكس. </li><li style=";text-align:right;direction:rtl"> الحفاظ على خلايا MEF في المحتوية على بوروميسين المتوسطة والتحقق من البروتين التعبير immunoblotting مع الأجسام المضادة المقابلة. </li><li style=";text-align:right;direction:rtl"> الخلايا يمكن استخدامها لعدوى فيروسية، خلوى التعبير الجيني وتجارب إفراز كما هو موضح في البروتوكول 2. </li></ol>

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

الكتاب تعلن أي تضارب في المصالح.

التهرب المناعة الفيروسية هي واحدة من التفاعلات الأكثر ديناميكية ومثيرة تفاعل جريمة الفيروسية والدفاع المضيف 9. وتنظم المضيف المكونات المناعية الفطرية بحيث يتم نقل الإشارة بدأت تنتقل بفعالية وإخلاص. ترسيم وتنظيم التسلسل الهرمي يشير شلالات هو موضوع بارز الحصا?...

وقد أوجز الدراسات الحديثة على شلالات إشارات الشاملة في تصاعد المضيف الاستجابات المناعية الفطرية. المقيمين داخل مقصورات مميزة، والمستقبلات التعرف على الأنماط (خنازير) كشف أنماط الجزيئية المرتبطة الممرض (PAMPs) المنشأ متنوعة لتحريك المناعة الفطرية يشير 1. التي يسببها حمض الريتينويك الجين الأول (RIG-I) وسرطان الجلد التمايز مستضد 5 (MDA5) البروتينات هي أجهزة الاستشعار التي تعترف عصاري خلوي الأنواع RNA مع سمات هيكلية محددة 2. عند التنشيط، RIG-I يتفاعل مع مافريكس في المصب (المعروف أيضا باسم IPS-1، فيزا، وCARDIF) المحول الذي، بدوره، ينشط IKK (IKKαβγ) وكيناز المتعلقة IKK (TBK1 وIKKε، المعروف أيضا باسم IKKI ) مجمعات 3-6. تنشيط المناعة الفطرية تحركات الفوسفات المنظمين الرئيسيين في التعبير الجيني، بما في ذلك عوامل النسخ ومثبطات منها، وتمكين تفعيل الجينات المضادة للفيروسات النسخي المضيف (على سبيل المثال IL6، TNF &amp; #945؛، CCL5، وIFNβ). هذه الشلالات يشير تشكل الاستجابات الفطرية المتأصلة قوية المناعي أن إقامة دولة المضادة للميكروبات لتقييد انتشار مسببات المرض خلال المراحل المبكرة من العدوى. ويرتبط ارتباطا وثيقا الفئران γHV68 أنكجنيك KSHV الإنسان وEBV. وهكذا، والعدوى من الفئران γHV68 نموذجا حيوان صغير الانقياد لدراسة استجابة المضيف المناعية لعدوى فيروس قوباء جاما في الجسم الحي 7. باستخدام γHV68، كشفت مختبرنا استراتيجية معقدة حيث يخطف γHV68 استضافة إشارات المناعية الفطرية لتمكين عدوى فيروسية. من جهة، γHV68 ينشط مسارا مافريكس-IKKβ لتعزيز تفعيل النسخي الفيروسية عن طريق توجيه تنشيط IKKβ لالفوسفات transactivator النسخ المتماثل (RTA)، والنسخ مفتاح عامل فيروسي للγHV68 تكرار 8. من ناحية أخرى، فإن الفسفرة IKKβ بوساطة يعبي RELA لتدهور والمدىinates تفعيل NFΚB 9. على هذا النحو، والعدوى γHV68 يتجنب إنتاج السيتوكينات المضادة للفيروسات بشكل فعال. ومن المثير للاهتمام، والفحص باستخدام مكتبة تعبير عن γHV68 حددت هيئة الطرق والمواصلات باعتبارها يغاز E3 للحث على تدهور العالقات وإلغاء تفعيل NFΚB 10. هذه النتائج تكشف عن استراتيجية التهرب المناعي معقدة حيث يتم تسخيرها المنبع الأحداث يشير المناعي عن طريق γHV68 لينفي في نهاية المطاف إنتاج السيتوكينات المضادة للفيروسات. نحن هنا وصف بروتوكول لقياس إنتاج السيتوكينات المضادة للفيروسات في الفئران المصابة مع γHV68 سواء في الجسم الحي وخارج فيف س. في البروتوكول ومواصلة استكشاف &quot;المعاد&quot; التعبير عن مكونات المناعة الفطرية في الخلايا الليفية الجنينية خروج المغلوب من قبل تنبيغ lentiviral، والذي يبرز وظيفة المناعة الفطرية جزيئات محددة في تنظيم إنتاج السيتوكينات المضادة للفيروسات. هذا البروتوكول يمكن تكييفها بسهولة إلى فيرو أخرىسيس ومسارات الإشارات.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

ردا على عدوى فيروسية، يتم تنشيط الاستجابة المناعية الفطرية المضيفة ليصل تنظيم التعبير الجيني وإنتاج السيتوكينات المضادة للفيروسات. على العكس، تطورت الفيروسات استراتيجيات معقدة للتهرب واستغلال المضيف يشير المناعي من أجل البقاء والانتشار. التهرب المناعة الفيروسية، تستتبع دفاع المضيف والتهرب الفيروسية، ويوفر واحدة من أروع واجهات وديناميكية لتبين التفاعل المضيفة للفيروسات. هذه الدراسات تقدم فهمنا في تنظيم المناعة الفطرية ويمهد طريقنا لتطوير علاجات مضادة للفيروسات الرواية. الفئران γHV68 هو الممرض الطبيعية من القوارض الفئران. الإصابة γHV68 الفئران تقدم نموذجا حيوان صغير الانقياد لدراسة الاستجابة المضادة للفيروسات لKSHV الإنسان وEBV منها اضطراب في الجسم الحي التفاعلات الفيروسات المضيف ليست قابلة للتطبيق. نحن هنا وصف بروتوكول لتحديد إنتاج السيتوكينات المضادة للفيروسات. هذا البروتوكول يمكن تكييفها لفير أخرىويستخدم مسارات الإشارات. مؤخرا، اكتشفنا أن يخطف γHV68 مافريكس وIKKβ، الفطرية مكونات إشارات المناعية الرئيسية المصب من عصاري خلوي RIG-I وMDA5، لإلغاء تفعيل NFΚB وإنتاج السيتوكينات المضادة للفيروسات. على وجه التحديد، والعدوى γHV68 ينشط IKKβ وأن تنشيط IKKβ phosphorylates RELA لتسريع تدهور العالقات. على هذا النحو، γ HV68 uncouples بكفاءة تفعيل NFΚB من المنبع لها IKKβ تفعيلها، يلغي المضادة للفيروسات التعبير خلوى الجينات. يلقي ضوءا هذه الدراسة استراتيجية معقدة حيث يتم اعتراضها تفعيل المناعة الفطرية المنبع من قبل الممرض الفيروسية لإلغاء تفعيل النسخي المصب الفوري والتهرب من إنتاج السيتوكينات المضادة للفيروسات.

وتظهر ثلاث شخصيات ممثلة هنا، بما في ذلك الإنتاج خلوى في الرئة من مافريكس γHV68 المصابة + / + ودالاس / - الماوس، إفراز السيتوكينات والتعبير الجيني مستوى مافريكس γHV68 المصابة + / + ومافريكس - / - MEFs، و مستويات خلوى مرنا من مافري?...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

وصفنا بروتوكول لقياس إنتاج السيتوكينات المضادة للفيروسات في الفئران المصابة مع هربس النموذج، الفئران غاما هربس 68 (γ HV68) التي هي ذات الصلة ارتباطا وثيقا المرتبطة ساركوما هربس الإنسان كابوزي (KSHV) وفيروس ابشتاين بار (EBV). استخدام سلالات الفئران المعدلة وراثيا والخلايا الليفية الماوس الجنينية (MEFs)، قمنا بتقييم إنتاج السيتوكينات المضادة للفيروسات سواء في الجسم الحي وخارج الحي. &quot;اعادة تشكيل&quot; التعبير عن مكونات المناعة الفطرية في الخلايا الليفية الجنينية خروج المغلوب من قبل تنبيغ lentiviral، ونحن كذلك تحديد جزيئات محددة المناعة الفطرية وتشريح الأحداث الإشارات الرئيسية التي تنظم بشكل مختلف في إنتاج السيتوكينات المضادة للفيروسات.

تشريح الفطري اشارة المناعة في التهرب الفيروسية من الإنتاج خلوى

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

dissecting-innate-immune-signaling-viral-evasion-cytokine

Research

JoVE Journal

Immunology and Infection

10.4K Views.  Keck School of Medicine, University of Southern California.  وصفنا بروتوكول لقياس إنتاج السيتوكينات المضادة للفيروسات في الفئران المصابة مع هربس النموذج، الفئران غاما هربس 68 (γ HV68) التي هي ذات الصلة ارتباطا وثيقا المرتبطة ساركوما هربس الإنسان كابوزي (K...

Video: Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently being tested in human clinical trials. Wild-type AAV is a non-pathogenic member of the parvoviridae family and inherently replication-deficient. The broad transduction profile, low immune response as well as the strong and persistent transgene expression achieved with these vectors has made them a popular and versatile tool for in vitro and in vivo gene delivery. rAAVs can be easily and cheaply produced in the laboratory and, based on their favourable safety profile, are generally given a low safety classification. Here, we describe a method for the production and titering of chimeric rAAVs containing the capsid proteins of both AAV1 and AAV2. The use of these so-called chimeric vectors combines the benefits of both parental serotypes such as high titres stocks (AAV1) and purification by affinity chromatography (AAV2). These AAV serotypes are the best studied of all AAV serotypes, and individually have a broad infectivity pattern. The chimeric vectors described here should have the infectious properties of AAV1 and AAV2 and can thus be expected to infect a large range of tissues, including neurons, skeletal muscle, pancreas, kidney among others. The method described here uses heparin column purification, a method believed to give a higher viral titer and cleaner viral preparation than other purification methods, such as centrifugation through a caesium chloride gradient. Additionally, we describe how these vectors can be quickly and easily titered to give accurate reading of the number of infectious particles produced.

Recombinant adeno-associated virus (rAAVs) vectors are becoming increasingly valuable for in vivo studies in animals. We describe how rAAVs can be produced in the laboratory and how these vectors can be titered to give an accurate reading of the number of infectious particles produced.

إنتاج وناقلات Titering الغدة المؤتلف المرتبطة الفيروسية

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

The phagocyte respiratory burst is part of the innate immune response to pathogen infection and involves the production of reactive oxygen species (ROS). ROS are toxic and function to kill phagocytized microorganisms. In vivo quantification of phagocyte-derived ROS provides information regarding an organism's ability to mount a robust innate immune response. Here we describe a protocol to quantify and compare ROS in whole zebrafish embryos upon chemical induction of the phagocyte respiratory burst. This method makes use of a non-fluorescent compound that becomes fluorescent upon oxidation by ROS. Individual zebrafish embryos are pipetted into the wells of a microplate and incubated in this fluorogenic substrate with or without a chemical inducer of the respiratory burst. Fluorescence in each well is quantified at desired time points using a microplate reader. Fluorescence readings are adjusted to eliminate background fluorescence and then compared using an unpaired t-test. This method allows for comparison of the respiratory burst potential of zebrafish embryos at different developmental stages and in response to experimental manipulations such as protein knockdown, overexpression, or treatment with pharmacological agents. This method can also be used to monitor the respiratory burst response in whole dissected kidneys or cell preparations from kidneys of adult zebrafish and some other fish species. We believe that the relative simplicity and adaptability of this protocol will complement existing protocols and will be of interest to researchers who seek to better understand the innate immune response.

The innate immune response protects organisms against pathogen infection. A critical component of the innate immune response, the phagocyte respiratory burst, generates reactive oxygen species that kill invading microorganisms. We describe a respiratory burst assay that quantifies reactive oxygen species produced when the innate immune response is chemically induced.

الكمي للاستجابة انفجر الجهاز التنفسي باعتبارها مؤشر الفطري المناعي الصحة في الزرد

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

باستخدام الحمض النووي الريبي التدخل للتحقيق في الاستجابة المناعية الفطرية في الفأر الضامة

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of causing systemic disease in both fish and humans. A better understanding of S. iniae disease pathogenesis requires an appropriate model system. The genetic tractability and the optical transparency of the early developmental stages of zebrafish allow for the generation and non-invasive imaging of transgenic lines with fluorescently tagged immune cells. The adaptive immune system is not fully functional until several weeks post fertilization, but zebrafish larvae have a conserved vertebrate innate immune system with both neutrophils and macrophages. Thus, the generation of a larval infection model allows the study of the specific contribution of innate immunity in controlling S. iniae infection.
The site of microinjection will determine whether an infection is systemic or initially localized. Here, we present our protocols for otic vesicle injection of zebrafish aged 2-3 days post fertilization as well as our techniques for fluorescent confocal imaging of infection. A localized infection site allows observation of initial microbe invasion, recruitment of host cells and dissemination of infection. Our findings using the zebrafish larval model of S. iniae infection indicate that zebrafish can be used to examine the differing contributions of host neutrophils and macrophages in localized bacterial infections. In addition, we describe how photolabeling of immune cells can be used to track individual host cell fate during the course of infection.

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Here, we present a protocol for the generation and imaging of a localized bacterial infection in the zebrafish otic vesicle.

التصوير غير الغازية من الاستجابة المناعية الفطرية في نموذج الزرد يرقات<em&gt; العقدية iniae</em&gt; العدوى

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research is deciphering how these dynamic protein complexes act to integrate signals from multiple sources in order to direct a specific biological response, and how this becomes deregulated in many disease settings. Despite the importance of this key biochemical mechanism, there is a lack of experimental techniques that can facilitate the specific and sensitive deconvolution of these multi-molecular signaling complexes.
Here this shortcoming is addressed through the combination of a protein complementation assay with a conformation-specific nanobody, which we have termed Bimolecular Complementation Affinity Purification (BiCAP). This novel technique facilitates the specific isolation and downstream proteomic characterization of any pair of interacting proteins, to the exclusion of un-complexed individual proteins and complexes formed with competing binding partners. 
The BiCAP technique is adaptable to a wide array of downstream experimental assays, and the high degree of specificity afforded by this technique allows more nuanced investigations into the mechanics of protein complex assembly than is currently possible using standard affinity purification techniques.

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

This manuscript describes the protocol for Bimolecular Complementation Affinity Purification (BiCAP). This novel method facilitates the specific isolation and downstream proteomic characterization of any two interacting proteins, while excluding un-complexed individual proteins as well as complexes formed with competing binding partners.

تشريح مجمعات البروتين متعدد الإشارات بالتكامل Bimolecular انجذاب تطهير (بيكاب)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies in an attempt to understand the precise mechanisms that lead to the breakdown of self-tolerance and subsequent autoimmunity. Approaches thus far have been based on the study of one specific aspect of the immune system (a single or few cell types or cytokines), and do not offer a global assessment of complex autoimmune disease. While patient sera-based studies have afforded important insights into autoimmunity, they do not provide the specific cellular source of the dysregulated cytokines detected. A comprehensive single-cell approach to evaluate cytokine production in multiple immune cell subsets, within the context of &#34;intrinsic&#34; patient-specific plasma circulating factors, is described here. This approach enables monitoring of the patient-specific immune phenotype (surface markers) and function (cytokines), either in its native &#34;intrinsic pathogenic&#34; disease state, or in the presence of therapeutic agents (in vivo or ex vivo).

Here we describe a single-cell proteomic approach to evaluate immune phenotypic and functional (intracellular cytokine induction) alterations in peripheral whole blood samples, analyzed via mass cytometry.

تحليل خلية واحدة من إيمونوفينوتيبي وإنتاج سيتوكين في الدم كله الطرفية عبر الخلوي الشامل

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

نموذج الماوس لتقييم الفطرية الاستجابة المناعية للعدوى المكوّرات العنقودية الذهبية

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal host-microbe interactions. It is well established that different commensals exhibit a different potential to stimulate the host intestinal immune system. Such investigations involve vertebrate animals, especially rodents. Since increasing ethical concerns are linked with experiments involving vertebrates, there is a high demand for invertebrate replacements models. 
Here, we provide a Galleria mellonella oral administration model using commensal non-pathogenic bacteria and the possible assessment of the immunogenic potential of commensals on the G. mellonella immune system. We demonstrate that G. mellonella is a useful alternative invertebrate replacement model that allows the analysis of commensals with different immunogenic potential such as Bacteroides vulgatus and Escherichia coli. Interestingly, the bacteria exhibited no killing effect on the larvae, which is similar to mammals. The immune responses of G. mellonella were comparable with vertebrate innate immune responses and involve recognition of the bacteria and production of antimicrobial molecules. We propose that G. mellonella was able to restore previous microbiota balance, which is well known from healthy mammalian individuals. Although providing comparable innate immune responses in both G. mellonella and vertebrates, G. mellonella does not harbor an adaptive immune system. Since the investigated components of the innate immune system are evolutionary conserved, the model allows a prescreening and first analysis of bacterial immunogenic properties.

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Here, we provide a detailed protocol for an oral administration model using Galleria mellonella larvae and how to characterize induced innate immune responses. Using this protocol, researchers without practical experience will be able to use the G. mellonella force-feeding method.

نموذج الإدارة عن طريق الفم Galleria mellonella للاستجابات المناعية الفطرية Study Commensal-Induced

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal immunity, because they can model host-pathogen interactions in the tissue. While isolated cells derived from tissues were the first cell culture model, their use has been neglected because tissue can be hard to obtain. In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells (TMCs) from healthy human tonsils to study innate immune responses upon activation, mimicking viral infection in mucosal tissues. Isolation of TMCs from the tonsils is quick, because the tonsils barely have any epithelium and yield up to billions of all major immune cell types. This method allows detection of cytokine production using several techniques, including immunoassays, qPCR, microscopy, flow cytometry, etc., similar to the use of peripheral mononuclear cells (PBMCs) from blood. Furthermore, TMCs show a higher sensitivity to drug testing than PBMCs, which needs to be considered for future toxicity assays. Thus, ex vivo TMCs cultures are an easy and accessible mucosal model.

In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells from healthy humans undergoing partial surgical tonsillectomy to study innate immune responses upon activation, mimicking viral infection in mucosal tissues.

عزل الخلايا أحادية النوى اللوزتين لدراسة استجابات المناعة الفطرية Ex Vivo في الأنسجة اللمفاوية المخاطية البشرية

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...

Microfluidic Co-Culture Models for Dissecting the Immune Response in in vitro Tumor Microenvironments

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise invisible processes. Advanced cell assays closely mimicking in vivo scenery are establishing themselves as novel ways to visualize and measure the bidirectional tumor-host interplay influencing the progression of cancer. Here we describe two versatile protocols to recreate highly controllable 2D and 3D co-cultures in microdevices, mimicking the complexity of the tumor microenvironment (TME), under natural and therapy-induced immunosurveillance. In section 1, an experimental setting is provided to monitor crosstalk between adherent tumor cells and floating immune populations, by bright field time-lapse microscopy. As an applicative scenario, we analyze the effects of anti-cancer treatments, such as the so-called immunogenic cancer cell death inducers on the recruitment and activation of immune cells. In section 2, 3D tumor-immune microenvironments are assembled in a competitive layout. Differential immune infiltration is monitored by fluorescence snapshots up to 72 h, to evaluate combination therapeutic strategies. In both settings, image processing steps are illustrated to extract a plethora of immune cell parameters (e.g., immune cell migration and interaction, response to therapeutic agents). These simple and powerful methods can be further tailored to simulate the complexity of the TME encompassing the heterogeneity and plasticity of cancer, stromal and immune cells subtypes, as well as their reciprocal interactions as drivers of cancer evolution. The compliance of these rapidly evolving technologies with live-cell high-content imaging can lead to the generation of large informative datasets, bringing forth new challenges. Indeed, the triangle &#39;&#39;co-cultures/microscopy/advanced data analysis&#34; sets the path towards a precise problem parametrization that may assist tailor-made therapeutic protocols. We expect that future integration of cancer-immune on-a-chip with artificial intelligence for high-throughput processing will synergize a large step forward in leveraging the capabilities as predictive and preclinical tools for precision and personalized oncology.

In the age of immunotherapy and single-cell genomic profiling, cancer biology requires novel in vitro and computational tools for investigating the tumor-immune interface in a proper spatiotemporal context. We describe protocols to exploit tumor-immune microfluidic co-cultures in 2D and 3D settings, compatible with dynamic, multiparametric monitoring of cellular functions.

نماذج الاستزراع المشترك للموائع الدقيقة لتشريح الاستجابة المناعية في البيئات الدقيقة للورم في المختبر

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise ...