야생형 (매버릭스 + / +) 및 녹아웃 (매버릭스 - / -) 생쥐는 야생형 (매버릭스 + / +) 및 녹아웃 (매버릭스 - / -) MEFs는 친절 박사 Zhijian J. 첸 (대학에 의해 제공되었다 텍사스 남서부 의료 센터) 13. 이 책은 NIH (R01 CA134241 및 R01 DE021445)와 미국 암 협회 (RSG - 11-162-01-MPC)에서 교부금에 의해 투자 작업을 기반으로합니다.

윤리 정책 : 모든 동물의 작업은 건강의 국립 연구소의 실험 동물의 관리 및 사용을위한 설명서의 권장 사항에 따라 설치에서 수행 하였다. 프로토콜은 남부 캘리포니아 대학의 기관 동물 케어 및 사용위원회 (IACUC)의 승인을 받았다. 1. γHV68에 감염된 마우스의 ELISA로 정량 실시간 PCR 및 분비에 의한 사이토 카인 유전자 발현 <ol><li> 복강 자일 라진의 ketamine/0.12 MG 1.5 mg의 주입을 통해 성별을 일치 6-8 주령 C57BL / 6 (B6) 한배 새끼 (8-12 마우스 / 그룹) 마취, 40 μL에 γHV68 40 PFU와 비강 접종 (동과 펭 11에 자세히 감염). 서로 다른 시간 지점에서 후 감염, 자궁 경부 전위 다음 CO 2 흡입을 사용하여 쥐를 안락사. </li><li> 아이돌 마스터를 따라 왼쪽 측면 컷으로 가슴을 열고숫자와 날카로운 가위로 갈비뼈를 잘라. 폐 조직을 수집합니다. </li><li> 500 ㎕의 1.0 mm 지르코니아 / 실리카 비드를 포함하는 멸균 1.5 ML 스크류 캡 튜브에 폐 조직 (왼쪽 엽)의 절반을 수집합니다. 튜브에 차가운 혈청이없는 DMEM의 1 ML을 추가하고 30 초 동안 비드 박동에 의해 폐 조직을 균질화. 2 분 동안 얼음에 튜브를 진정 한 번이 과정을 반복합니다. </li><li> 튜브 (15,000 X를 원심 분리기 4 ° C에서 10 분)에 대한 G는, 상층 액을 수집하고 아래에 설명 된대로 사이토 카인의 생산을 측정합니다. </li><li> 제조업체의 지시에 따라 시중에서 사이토 카인 ELISA 키트를 사용하여 사이토 카인을 측정합니다. </li><li> 다른 비드 함유 튜브에 폐 조직 (우엽)의 나머지 절반을 수집하고 1 ㎖의 트리 졸을 추가합니다. 균질화 및 제조업체의 지시에 따라 단계 1.3 및 추출 RNA에 설명 된대로 상층 액을 수집합니다. 260 및 280 nm에서 흡광도 판독 값을 고려하여 RNA 농도를 결정합니다. </li&gt; <li> 총 RNA 1 μg과의 cDNA를 준비하고 제조의 명령 (총 최종 부피가 20 μL이었다)에 따라 역전사. DNA 분해 효소 및 RNase가없는 물과 cDNA를 50 배 희석하여 정량 실시간 PCR을 수행합니다. </li><li> 정량적 실시간 PCR 기계에서 프로그램을 수행합니다. 각각의 반응이 GAPDH (프라이머의 작업 농도 각 프라이머 10 μM, CE 500 ㎚ 인이었다)의 유전자 특이 프라이머 또는 제어 한 쌍의 프라이머 0.5 μl를 포함, SYBR 마스터 믹스의 5 μL와의 4 μL는 희석 cDNA를. 항 바이러스 사이토 카인의 mRNA의 성적의 상대적인 양을 결정하는 ΔΔCT을 계산합니다. </li></ol> 2. ELISA와 QRT-PCR에 의한 MEF 세포 감염 및 사이토 카인 정량 <ol><li> 매버릭스 + / + 및 매버릭스 성장 - / - 세포를 도금하기 전에 하위 합류 (약 80 %) 밀도에 MEF 세포. </li><li> 12 - 우리에 MEF 세포를 분할100,000 개 세포 / (세포 밀도가 두 번째 날에 약 70 %가됩니다)에서 LL 접시. 사이토 카인의 유도를 동기화하고 극대화하기 위해 5 ~ 10의 감염의 다중성 (MOI)와, 삼중의 γHV68 감염을 수행하십시오. </li><li> 바이러스의 적당량 (각 웰에 대한 1 ㎖)를 포함하는 완전한 DMEM 매체에 γHV68 현탁액을 준비합니다. </li><li> 매체를 제거하고 MEF 세포에 γHV68 함유 현탁액을 추가합니다. </li><li> , 조직 문화 인큐베이터에서 접시를 놓고 30 분마다 바위, 배양의 2 시간의 총 수 있습니다. </li><li> , γHV68 함유 매체를 제거 PBS로 한번 씻어 신선한 완전한 DMEM으로 교체합니다. </li><li> 다양한 시간에 1.5 ㎖의 에펜 도르프 튜브에 감염 후, 수확 매체를 가리 킵니다. 차가운 PBS로 세포를 세척하고 소화를 트립신에 의해 감염된 세포를 수집합니다. </li><li> 단계 1.5에 설명 된대로 매체에 항 바이러스 사이토 카인을 측정합니다. </li><li> , RNA를 추출하는 cDNA를 준비하고 항 바이러스 사이토 카인 유전자 발현을 결정하기 위해 QRT-PCR을 수행단계 1.5-1.7에서 설명한대로. </li></ol> 3. 안정 세포주의 렌티 바이러스 생산, 감염, 및 생성 <ol><li> 스플릿 293T 세포 일일 형질 감염 전에 세포가 트랜시 ~ 40 % 포화 상태에 도달하는 것을 허용한다. </li><li> 포장 플라스미드 (1.2 pVSV-G ㎍의 6 μg pDR8.9의) 7.2 pCDH-FLAG-MAVS 또는 인산 칼슘 침전에 의해 pCDH 제어 ㎍의와 293T 세포의 10cm 접시 형질. </li><li> 신선한 완전한 DMEM으로 6 ~ 8 시간의 포스트 형질에 매체를 교체합니다. </li><li> 72 시간 사후 형질에서 0.22 μm의 막 중간 포함 렌티 바이러스, 15 분 4,000 XG에 원심 분리기 및 필터를 수집합니다. 렌티 바이러스 역가를 증가시키기 위해, 우리는 4 ℃에서 2.5 시간 동안 110,000 XG에서 바이러스 함유 배지를 원심 분리 조심스럽게 그 중간의 작은 양의 바이러스 성 펠렛을 재현 탁. </li><li> 시드 매버릭스 - / - MEF 세포 또는 다른 녹아웃 MEF 세포 일일 befo~ 30~40%의 포화 상태에서 6 - 웰 플레이트에 감염 재. </li><li> 1 ㎖의 렌티 바이러스 및 10 ㎍ / ml의 최종 농도로 폴리 브렌이 보충 된 2 ㎖의 신선한 완전 DMEM을 가진 MEF 세포를 감염. </li><li> 30 분 동안 30 ° C에서 500 XG에서 접시를 원심 분리기와 조직 문화 인큐베이터에 접시를 전송합니다. </li><li> 신선한 완전한 DMEM으로 6 시간 후 감염에 매체를 교체합니다. </li><li> 분할 MEF의 24 시간 후 감염의 세포와 안정 MAVS를 발현하는 세포를 선택하기 위해 48 시간 게시물 감염에서 1 μg / ML의 최종 농도로 마이신을 추가합니다. </li><li> 퓨로 마이신 함유 배지에서 MEF 세포를 유지하고 대응하는 항체와 면역 블에 의해 단백질 발현을 확인합니다. </li><li> 세포는 바이러스 감염, 사이토 카인 유전자 발현 및 프로토콜이 설명에 따라 분비 실험에 사용될 수있다. </li></ol>

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

저자는 관심 없음 충돌 선언하지 않습니다.

바이러스 성 면역 회피는 바이러스 공격과 숙주 방어 9 인터페이스에서 가장 역동적이고 매혹적인 상호 작용 중 하나입니다. 호스트 타고난 면역 성분은 신호 전달을 효과적으로 시작하고 충실하게 전달되도록 구성되어있다. 폭포 신호의 계층 구조 및 규제를 서술하는 선천성 면역의 발군의 주제입니다. 여기서, 우리는 사이토 카인 생성의 바이러스 기피에 선천성 면역 성분 MAVS의 규제 ?...

최근의 연구는 호스트 타고난 면역 반응을 설치에서 전체 신호 폭포를 설명했다. 별개의 구획 내에 거주, 패턴 인식 수용체 (PRRS) 1 신호 선천성 면역을 유발하는 다양한 기원의 병원체 - 관련 분자 패턴 (PAMPS)를 감지합니다. 레티노 산에 의한 유전자 I (RIG-I)과 흑색 종 분화 항원 5 (MDA5) 단백질은 특정 구조적 특징 2 RNA 종을 인식 세포질 센서입니다. 활성화되면, RIG-I 차례도 일기당천로 알려진 IKK (IKKαβγ)와 IKK 관련 키나제 (TBK1 및 IKKε을 활성화 어댑터 (또한 IPS-1 비자 CARDIF라고도 함)의 다운 스트림 MAVS와 상호 작용 )는 3-6의 콤플렉스. 활성화 선천성 면역 키나제는 그 전사 인자와 억제 등의 유전자 발현의 핵심 규제를 인산화 및 호스트 항 바이러스 유전자 (예를 들어, IL6, TNF &amp; #의 전사 활성을 가능하게945;, CCL5 및 IFNβ). 이러한 시그널링 캐스케이드는 감염의 초기 단계에서 병원체의 전파를 제한하는 항균성 상태를 확립 유력한 극한 선천성 면역 반응을 구성한다. 쥐 γHV68 밀접하게 인간의 종양 KSHV와 EBV 관련이있다. 따라서, 쥐의 γHV68 감염 생체 7 감마 헤르페스 바이러스 감염 숙주 면역 반응을 조사하는 온순 작은 동물 모델을 제공한다. γHV68 바이러스 성 감염을 가능하게하는 타고난 면역 신호를 호스트 탈취있다 γHV68을 사용하여, 우리 연구소는 복잡한 전략을 발견했다. 한편, γHV68 복제 transactivator (RTA), γHV68 복제 8 바이러스 전사 인자 키를 인산화 활성화 IKKβ 연출을 통해 바이러스의 전사 활성을 촉진하기 위해 MAVS-IKKβ 경로를 활성화합니다. 한편, IKKβ 매개 인산화 저하 및 용어에 대한 상대적를 준비시킨다NFκB 활성화 9 inates. 이와 같이, γHV68 감염 효과적으로 바이러스 사이토 카인 생성을 피한다. 흥미롭게도, γHV68의 표현 라이브러리를 활용하여 심사는 상대적 저하를 유도하고 NFκB 활성화 (10)를 폐지하는 E3 리가 아제로 RTA을 확인했다. 이러한 연구 결과는 상류 면역 신호 이벤트가 궁극적 인 항 바이러스 사이토 카인의 생산을 부정하기 γHV68에 의해 무력화되어있다 복잡한 면역 회피 전략을 발견. 여기에서 우리는 생체 내에서와 전 비브 O 모두 γHV68에 감염된 마우스에서 항 바이러스 사이토 카인의 생산을 측정하기 위해 프로토콜을 설명합니다. 프로토콜에서 우리는 상기 바이러스 사이토킨 생성 조절에 특정 선천성 면역 분자의 기능을 정확하게 지적 렌티 바이러스 형질 도입에 의해 녹아웃 배아 섬유 아세포에서 선천성 면역 성분 &quot;재구성&quot;표현을 찾아. 이 프로토콜은 쉽게 다른 비루에 적용 할 수있다SES와 신호 전달 경로.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

바이러스 감염에 응답하여, 호스트 선천성 면역 반응은 바이러스 사이토 카인 유전자 발현 및 생산 조절이 최대 활성화된다. 반대로, 바이러스는 생존과 번식을 위해 숙주 면역 신호를 회피하고 악용하는 복잡한 전략을 진화했다. 바이러스 성 면역 회피는 숙주 방어와 바이러스 회피를 수반하는, 호스트 바이러스 상호 작용을 식별하는 가장 매력적이고 역동적 인 인터페이스 중 하나를 제공합니다. 이러한 연구는 선천성 면역 조절에 대한 우리의 이해를 발전시키고 새로운 항 바이러스 치료를 개발하는 우리의 방법을 포장. 쥐 γHV68는 쥐 설치류의 자연 병원체이다. 마우스의 γHV68 감염은 생체 바이러스 호스트 상호 작용의 교란을 적용하지 않은 인간의 KSHV와 EBV에 대한 바이러스 반응을 조사하기 위해 다루기 쉬운 작은 동물 모델을 제공합니다. 여기서 우리는 항 바이러스 사이토 카인의 생산을 결정하는 프로토콜에 대해 설명합니다. 이 프로토콜은 다른 VIR에 적용 할 수있다사용 및 신호 통로. 최근에, 우리는 γHV68는 NFκB 활성화 및 항 바이러스 사이토 카인의 생산을 폐지하는 MAVS와 IKKβ, 세포질 RIG-I와 MDA5의 다운 스트림 키 선천성 면역 신호 구성 요소를 탈취 것을 발견했다. 특히, γHV68 감염 IKKβ를 활성화하고 활성화 된 IKKβ는 상대적 저하를 가속화하기 위해 상대적를 인산화. 따라서, γ HV68 효율적으로 항 바이러스 사이토 카인 유전자 발현을 부정, 상류 활성화 IKKβ에서 NFκB 활성화를 분리됩니다. 이 연구는 상류 선천성 면역 활성화가 즉시 다운 스트림의 전사 활성화를 무효화 및 항 바이러스 사이토 카인의 생산을 피하기 위해 바이러스 성 병원체에 의해 차단된다 복잡한 전략을 해명.

세 대표 수치는 γHV68에 감염된 매버릭스의 폐에있는 사이토 카인 생산을 포함하여, 여기에 표시됩니다 + / + 및 매버릭스 - / - / - - γHV68에 감염된 매버릭스 + / +와 매버릭스의 마우스, 사이토 카인의 분비와 유전자 발현 수준 MEFs 및 γHV68에 감염된 매버릭스의 사이토 카인 mRNA 수준은 - / - MEFs는 MAVS에 &quot;재구성&quot;. 이 대표 실험?...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

우리는 인간 카포시 육종 관련 헤르페스 바이러스 (KSHV)와 엡스타인 - 바 바이러스 (EBV)와 밀접하게 관련되는 모델 헤르페스 바이러스, 뮤린 감마 허피스 바이러스 68 (γ HV68)로 감염된 마우스에서 항 바이러스 사이토 카인 생성을 측정하기 위해 프로토콜을 설명한다. 유전자 변형 마우스 종자와 마우스 배아 섬유 아 세포 (MEFs)를 활용하여, 우리는 항 바이러스 사이토 카인 생산 생체 내 및 생체 모두를 평가. 렌티 바이러스 전달하여 녹아웃 배아 섬유 아세포에서 선천성 면역 구성 요소의 표현을 &quot;재구성&quot;, 우리는 더 특정 선천성 면역 분자를 정확하게 지적하고 차등 항 바이러스 사이토 카인의 생산을 조절하는 중요한 신호 이벤트를 해부하다.

사이토 카인 생산의 바이러스 성 회피에 타고난 면역 신호를 해부

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

dissecting-innate-immune-signaling-viral-evasion-cytokine

Research

JoVE Journal

Immunology and Infection

10.4K 조회수.  Keck School of Medicine, University of Southern California.  우리는 인간 카포시 육종 관련 헤르페스 바이러스 (KSHV)와 엡스타인 - 바 바이러스 (EBV)와 밀접하게 관련되는 모델 헤르페스 바이러스, 뮤린 감마 허피스 바이러스 68 (γ HV68)로 감염된 마우스에서 항 바이러스 사이토 카인 생성을 측정하기 위해 프로토콜을 설명한다. 유전자 변형 마우스 종자와 ...

비디오: Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently being tested in human clinical trials. Wild-type AAV is a non-pathogenic member of the parvoviridae family and inherently replication-deficient. The broad transduction profile, low immune response as well as the strong and persistent transgene expression achieved with these vectors has made them a popular and versatile tool for in vitro and in vivo gene delivery. rAAVs can be easily and cheaply produced in the laboratory and, based on their favourable safety profile, are generally given a low safety classification. Here, we describe a method for the production and titering of chimeric rAAVs containing the capsid proteins of both AAV1 and AAV2. The use of these so-called chimeric vectors combines the benefits of both parental serotypes such as high titres stocks (AAV1) and purification by affinity chromatography (AAV2). These AAV serotypes are the best studied of all AAV serotypes, and individually have a broad infectivity pattern. The chimeric vectors described here should have the infectious properties of AAV1 and AAV2 and can thus be expected to infect a large range of tissues, including neurons, skeletal muscle, pancreas, kidney among others. The method described here uses heparin column purification, a method believed to give a higher viral titer and cleaner viral preparation than other purification methods, such as centrifugation through a caesium chloride gradient. Additionally, we describe how these vectors can be quickly and easily titered to give accurate reading of the number of infectious particles produced.

Recombinant adeno-associated virus (rAAVs) vectors are becoming increasingly valuable for in vivo studies in animals. We describe how rAAVs can be produced in the laboratory and how these vectors can be titered to give an accurate reading of the number of infectious particles produced.

재조합 Adeno - 관련 바이러스성 벡터의 생산 및 Titering

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

연구

면역학 및 감염병학

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

The phagocyte respiratory burst is part of the innate immune response to pathogen infection and involves the production of reactive oxygen species (ROS). ROS are toxic and function to kill phagocytized microorganisms. In vivo quantification of phagocyte-derived ROS provides information regarding an organism's ability to mount a robust innate immune response. Here we describe a protocol to quantify and compare ROS in whole zebrafish embryos upon chemical induction of the phagocyte respiratory burst. This method makes use of a non-fluorescent compound that becomes fluorescent upon oxidation by ROS. Individual zebrafish embryos are pipetted into the wells of a microplate and incubated in this fluorogenic substrate with or without a chemical inducer of the respiratory burst. Fluorescence in each well is quantified at desired time points using a microplate reader. Fluorescence readings are adjusted to eliminate background fluorescence and then compared using an unpaired t-test. This method allows for comparison of the respiratory burst potential of zebrafish embryos at different developmental stages and in response to experimental manipulations such as protein knockdown, overexpression, or treatment with pharmacological agents. This method can also be used to monitor the respiratory burst response in whole dissected kidneys or cell preparations from kidneys of adult zebrafish and some other fish species. We believe that the relative simplicity and adaptability of this protocol will complement existing protocols and will be of interest to researchers who seek to better understand the innate immune response.

The innate immune response protects organisms against pathogen infection. A critical component of the innate immune response, the phagocyte respiratory burst, generates reactive oxygen species that kill invading microorganisms. We describe a respiratory burst assay that quantifies reactive oxygen species produced when the innate immune response is chemically induced.

제브라 피쉬의 선천성 면역 건강의 지표로 호흡 버스트 응답의 정량화

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

마우스 대 식세포의 타고난 면역 반응을 조사하기 위해 RNA 간섭을 사용하여

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of causing systemic disease in both fish and humans. A better understanding of S. iniae disease pathogenesis requires an appropriate model system. The genetic tractability and the optical transparency of the early developmental stages of zebrafish allow for the generation and non-invasive imaging of transgenic lines with fluorescently tagged immune cells. The adaptive immune system is not fully functional until several weeks post fertilization, but zebrafish larvae have a conserved vertebrate innate immune system with both neutrophils and macrophages. Thus, the generation of a larval infection model allows the study of the specific contribution of innate immunity in controlling S. iniae infection.
The site of microinjection will determine whether an infection is systemic or initially localized. Here, we present our protocols for otic vesicle injection of zebrafish aged 2-3 days post fertilization as well as our techniques for fluorescent confocal imaging of infection. A localized infection site allows observation of initial microbe invasion, recruitment of host cells and dissemination of infection. Our findings using the zebrafish larval model of S. iniae infection indicate that zebrafish can be used to examine the differing contributions of host neutrophils and macrophages in localized bacterial infections. In addition, we describe how photolabeling of immune cells can be used to track individual host cell fate during the course of infection.

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Here, we present a protocol for the generation and imaging of a localized bacterial infection in the zebrafish otic vesicle.

의 Zebrafish의 애벌레 모델의 선천성 면역 반응의 비 침습적 영상<em&gt; 연쇄상 구균 iniae</em&gt; 감염

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research is deciphering how these dynamic protein complexes act to integrate signals from multiple sources in order to direct a specific biological response, and how this becomes deregulated in many disease settings. Despite the importance of this key biochemical mechanism, there is a lack of experimental techniques that can facilitate the specific and sensitive deconvolution of these multi-molecular signaling complexes.
Here this shortcoming is addressed through the combination of a protein complementation assay with a conformation-specific nanobody, which we have termed Bimolecular Complementation Affinity Purification (BiCAP). This novel technique facilitates the specific isolation and downstream proteomic characterization of any pair of interacting proteins, to the exclusion of un-complexed individual proteins and complexes formed with competing binding partners. 
The BiCAP technique is adaptable to a wide array of downstream experimental assays, and the high degree of specificity afforded by this technique allows more nuanced investigations into the mechanics of protein complex assembly than is currently possible using standard affinity purification techniques.

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

This manuscript describes the protocol for Bimolecular Complementation Affinity Purification (BiCAP). This novel method facilitates the specific isolation and downstream proteomic characterization of any two interacting proteins, while excluding un-complexed individual proteins as well as complexes formed with competing binding partners.

해 다중 단백질 신호 복합물 분자 보완성 친 화력 정화 (BiCAP)에 의해

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies in an attempt to understand the precise mechanisms that lead to the breakdown of self-tolerance and subsequent autoimmunity. Approaches thus far have been based on the study of one specific aspect of the immune system (a single or few cell types or cytokines), and do not offer a global assessment of complex autoimmune disease. While patient sera-based studies have afforded important insights into autoimmunity, they do not provide the specific cellular source of the dysregulated cytokines detected. A comprehensive single-cell approach to evaluate cytokine production in multiple immune cell subsets, within the context of &#34;intrinsic&#34; patient-specific plasma circulating factors, is described here. This approach enables monitoring of the patient-specific immune phenotype (surface markers) and function (cytokines), either in its native &#34;intrinsic pathogenic&#34; disease state, or in the presence of therapeutic agents (in vivo or ex vivo).

Here we describe a single-cell proteomic approach to evaluate immune phenotypic and functional (intracellular cytokine induction) alterations in peripheral whole blood samples, analyzed via mass cytometry.

Immunophenotype 및 Cytokine 생산 대량 Cytometry 통해 주변 전 혈의 단일 세포 분석

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

마우스 모델을 평가 타고 난 면역 반응 포도 상 구 균 감염

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal host-microbe interactions. It is well established that different commensals exhibit a different potential to stimulate the host intestinal immune system. Such investigations involve vertebrate animals, especially rodents. Since increasing ethical concerns are linked with experiments involving vertebrates, there is a high demand for invertebrate replacements models. 
Here, we provide a Galleria mellonella oral administration model using commensal non-pathogenic bacteria and the possible assessment of the immunogenic potential of commensals on the G. mellonella immune system. We demonstrate that G. mellonella is a useful alternative invertebrate replacement model that allows the analysis of commensals with different immunogenic potential such as Bacteroides vulgatus and Escherichia coli. Interestingly, the bacteria exhibited no killing effect on the larvae, which is similar to mammals. The immune responses of G. mellonella were comparable with vertebrate innate immune responses and involve recognition of the bacteria and production of antimicrobial molecules. We propose that G. mellonella was able to restore previous microbiota balance, which is well known from healthy mammalian individuals. Although providing comparable innate immune responses in both G. mellonella and vertebrates, G. mellonella does not harbor an adaptive immune system. Since the investigated components of the innate immune system are evolutionary conserved, the model allows a prescreening and first analysis of bacterial immunogenic properties.

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Here, we provide a detailed protocol for an oral administration model using Galleria mellonella larvae and how to characterize induced innate immune responses. Using this protocol, researchers without practical experience will be able to use the G. mellonella force-feeding method.

갤러리아 mellonella 구강 관리 모델 Study Commensal-Induced 타고 난 면역 반응에

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal immunity, because they can model host-pathogen interactions in the tissue. While isolated cells derived from tissues were the first cell culture model, their use has been neglected because tissue can be hard to obtain. In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells (TMCs) from healthy human tonsils to study innate immune responses upon activation, mimicking viral infection in mucosal tissues. Isolation of TMCs from the tonsils is quick, because the tonsils barely have any epithelium and yield up to billions of all major immune cell types. This method allows detection of cytokine production using several techniques, including immunoassays, qPCR, microscopy, flow cytometry, etc., similar to the use of peripheral mononuclear cells (PBMCs) from blood. Furthermore, TMCs show a higher sensitivity to drug testing than PBMCs, which needs to be considered for future toxicity assays. Thus, ex vivo TMCs cultures are an easy and accessible mucosal model.

In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells from healthy humans undergoing partial surgical tonsillectomy to study innate immune responses upon activation, mimicking viral infection in mucosal tissues.

편도선 단핵 세포의 격리는 인간 점막 림프구 조직에서 Ex Vivo 타고난 면역 반응을 연구합니다

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...

Microfluidic Co-Culture Models for Dissecting the Immune Response in in vitro Tumor Microenvironments

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise invisible processes. Advanced cell assays closely mimicking in vivo scenery are establishing themselves as novel ways to visualize and measure the bidirectional tumor-host interplay influencing the progression of cancer. Here we describe two versatile protocols to recreate highly controllable 2D and 3D co-cultures in microdevices, mimicking the complexity of the tumor microenvironment (TME), under natural and therapy-induced immunosurveillance. In section 1, an experimental setting is provided to monitor crosstalk between adherent tumor cells and floating immune populations, by bright field time-lapse microscopy. As an applicative scenario, we analyze the effects of anti-cancer treatments, such as the so-called immunogenic cancer cell death inducers on the recruitment and activation of immune cells. In section 2, 3D tumor-immune microenvironments are assembled in a competitive layout. Differential immune infiltration is monitored by fluorescence snapshots up to 72 h, to evaluate combination therapeutic strategies. In both settings, image processing steps are illustrated to extract a plethora of immune cell parameters (e.g., immune cell migration and interaction, response to therapeutic agents). These simple and powerful methods can be further tailored to simulate the complexity of the TME encompassing the heterogeneity and plasticity of cancer, stromal and immune cells subtypes, as well as their reciprocal interactions as drivers of cancer evolution. The compliance of these rapidly evolving technologies with live-cell high-content imaging can lead to the generation of large informative datasets, bringing forth new challenges. Indeed, the triangle &#39;&#39;co-cultures/microscopy/advanced data analysis&#34; sets the path towards a precise problem parametrization that may assist tailor-made therapeutic protocols. We expect that future integration of cancer-immune on-a-chip with artificial intelligence for high-throughput processing will synergize a large step forward in leveraging the capabilities as predictive and preclinical tools for precision and personalized oncology.

In the age of immunotherapy and single-cell genomic profiling, cancer biology requires novel in vitro and computational tools for investigating the tumor-immune interface in a proper spatiotemporal context. We describe protocols to exploit tumor-immune microfluidic co-cultures in 2D and 3D settings, compatible with dynamic, multiparametric monitoring of cellular functions.

in vitro 종양 미세환경에서 면역 반응을 해부하기 위한 미세유체 공동 배양 모델

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise ...