עכברים, wild-type (Mavs + / +) ונוקאאוט (Mavs - / -) wild-type (Mavs + / +) ונוקאאוט (Mavs - - /) MEFs סופקו באדיבות על ידי ד&quot;ר ג &#39;יי Zhijian חן (אוניברסיטת מרכז טקסס Southwestern Medical) 13. פרסום זה מבוסס על מומנה על ידי מענקים מ-NIH (R01 CA134241 וR01 DE021445) ואגודה האמריקנית לסרטן (RSG-11-162-01-MPC) עבודה.

הצהרת אתיקה: כל העבודה בבעלי החיים בוצעה תחת בהתאם קפדן עם ההמלצות במדריך לטיפול והשימוש בחי מעבדה של המכון הלאומי לבריאות. הפרוטוקול אושר על ידי הוועדה המוסדית טיפול בבעלי חיים ושימוש (IACUC) מאוניברסיטת הדרום קליפורניה. 1. ביטוי גני ציטוקין ידי Real-Time PCR כמותי והפרשה על ידי ELISA בעכברים נגועים ב-γHV68 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הרדימי, C57BL / 6 להמלטת בהתאמה מגדר 6-8 שבועות בן (B6) (8-12 עכברים / קבוצה) באמצעות הזרקת intraperitoneally 1.5 מ&quot;ג ketamine/0.12 מ&quot;ג xylazine, ולחסן intranasally עם 40 PFU של γHV68 ב40 μl (זיהום מפורט בדונג ו11 פנג). בנקודות זמן שונות לאחר פגיעה, להרדים את העכברים באמצעות משאיפת CO 2 ואחריו נקע בצוואר הרחם. </li><li style=";text-align:right;direction:rtl"> פתח את החזה עם חתך רוחב שמאל לאורך sternum ולחתוך דרך הצלעות במספריים חדים. לאסוף את רקמות הריאה. </li><li style=";text-align:right;direction:rtl"> לאסוף מחצית מרקמת הריאה (אונה השמאלית) לתוך צינורות 1.5 מיליליטר בורג הכתיר סטרילי המכילים 500 μl חרוזים Zirconia / סיליקה 1.0 מ&quot;מ. הוסף 1 מיליליטר של סרום ללא DMEM הקר לתוך הצינור וhomogenize רקמת הריאה על ידי חרוז הכאה ל30 שניות. צ&#39;יל צינורות על קרח במשך 2 דקות ולחזור על תהליך זה פעם אחת. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה הצינורות (15,000 x גרם ל10 דקות) בשעה 4 ° C, לאסוף את supernatant ולמדוד את ייצור ציטוקינים כמתואר להלן. </li><li style=";text-align:right;direction:rtl"> מדוד ציטוקינים באמצעות ערכות ELISA ציטוקינים זמינות מסחרי על פי הוראות היצרן. </li><li style=";text-align:right;direction:rtl"> לאסוף את החצי השני של רקמת הריאה (אונה ימנית) לתוך צינור המכיל חרוז אחר ולהוסיף TRIzol 1 מיליליטר. Homogenize ולאסוף supernatant כמתואר בשלב 1.3 ו-RNA תמצית על פי ההוראה של הייצור. לקבוע את ריכוז RNA על ידי לקיחת קריאות הספיגה ב 260 ו280 ננומטר. </li&gt; <li style=";text-align:right;direction:rtl"> הכן cDNA עם 1 מיקרוגרם של רנ&quot;א הכל ולהפוך טרנסקריפטאז על פי ההוראה של הייצור (הנפח הסופי בסך הכל היה 20 μl). לדלל cDNA 50 פעמים עם DNAse וRNase ללא מים ולבצע בזמן אמת PCR כמוני. </li><li style=";text-align:right;direction:rtl"> לבצע את התכנית על מחשב בזמן אמת PCR כמותית. כל תגובה מכילה 0.5 μl של זוג פריימרים גן ספציפי או פריימרים שליטת GAPDH (ריכוז העבודה של פריימרים היו 10 מיקרומטר, CE 500 ננומטר עבור כל צבע יסוד), 5 μl של מיקס מאסטר SYBR ו4 μl של דילול מלא cDNA. חישוב ΔΔCt כדי לקבוע את הכמות היחסית של תעתיקי mRNA של ציטוקינים אנטי. </li></ol> 2. זיהום MEF נייד וציטוקין כימות על ידי ELISA וqRT-PCR <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לגדול Mavs + / + וMavs - / - תאי MEF לצפיפות תת מחוברות (כ 80%) לפני תאי ציפוי. </li><li style=";text-align:right;direction:rtl"> פיצול תאי MEF ל12צלחות ll וב100,000 תאים / (צפיפות התאים תהיה סביב 70% ביום השני). לבצע את זיהום γHV68 בtriplicates, עם ריבוי של זיהום (משרד הפנים) של 5-10 לסנכרון ולמקסם את האינדוקציה ציטוקינים. </li><li style=";text-align:right;direction:rtl"> הכן את ההשעיה γHV68 בינוני מלא DMEM המכיל כמות מתאימה של וירוס (1 מיליליטר לכל טוב). </li><li style=";text-align:right;direction:rtl"> הסר בינוני ולהוסיף השעיה γHV68 המכיל תאי MEF. </li><li style=";text-align:right;direction:rtl"> מניחים את הצלחת בתרבית רקמת חממה, רוק כל 30 דקות, ולאפשר כולל של 2 שעות של דגירה. </li><li style=";text-align:right;direction:rtl"> הסר בינוני המכיל γHV68, לשטוף פעם עם PBS, ולהחליף עם DMEM להשלים טרי. </li><li style=";text-align:right;direction:rtl"> בזמן שונים מציין שלאחר זיהום, בינוני קציר ל1.5 צינורות מיליליטר Eppendorf. שטוף תאים עם PBS הקר ולאסוף תאים נגועים על ידי טריפסין עיכול. </li><li style=";text-align:right;direction:rtl"> מדוד ציטוקינים אנטי במדיום כמתואר בשלב 1.5. </li><li style=";text-align:right;direction:rtl"> חלץ RNA, להכין cDNA ולבצע qRT-PCR כדי לקבוע ביטוי גני ציטוקינים אנטיכפי שמתואר ב1.5-1.7 צעדים. </li></ol> 3. הפקת lentivirus, זיהום, ודור של שורות תאי יציבות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> פיצול תאי 293T יום אחד לפני transfection ולאפשר לתאים להגיע ~ confluency 40% בזמן של transfection. </li><li style=";text-align:right;direction:rtl"> Transfect 10 צלחת סנטימטר של תאי 293T עם פלסמידים האריזה (1.2 מיקרוגרם של pVSV-G ו6 מיקרוגרם של pDR8.9) ו7.2 מיקרוגרם של pCDH-FLAG-Mavs או pCDH שליטה על ידי משקעים סידן זרחה. </li><li style=";text-align:right;direction:rtl"> החלף בינוני ב6 עד 8 שעות לאחר transfection עם DMEM להשלים טרי. </li><li style=";text-align:right;direction:rtl"> ב72 לאחר transfection שעות, לאסוף lentivirus בינוני המכיל, צנטריפוגות ב 4,000 XG במשך 15 דקות, ומסנן עם 0.22 מיקרומטר הממברנה. כדי להגדיל את כייל lentivirus, אנו צנטריפוגות בינונית המכיל הווירוס ב110,000 XG במשך 2.5 שעות ב 4 ° C. resuspend בזהירות את גלולה נגיפית בנפח קטן של מדיום של עניין. </li><li style=";text-align:right;direction:rtl"> Mavs זרע - / - תאי MEF או תאי MEF נוקאאוט אחרים יום אחד befoמחדש זיהום ב6 צלחות היטב ב ~ confluency 30-40%. </li><li style=";text-align:right;direction:rtl"> להדביק תאי MEF עם lentivirus 1 מיליליטר ו 2 מיליליטר DMEM השלם טרי, בתוספת polybrene לריכוז סופי של 10 מיקרוגרם / מיליליטר. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה את הצלחת ב XG 500 ב30 מעלות צלזיוס במשך 30 דקות ולהעביר את הצלחת לחממה בתרבית רקמה. </li><li style=";text-align:right;direction:rtl"> החלף בינוני ב6 שעות לאחר פגיעה עם DMEM להשלים טרי. </li><li style=";text-align:right;direction:rtl"> פיצול תאי MEF ב24 לאחר זיהום שעה ולהוסיף puromycin לריכוז סופי של 1 מיקרוגרם / מיליליטר ב48 לאחר זיהום שעה לבחור תאים ביציבות להביע Mavs. </li><li style=";text-align:right;direction:rtl"> שמור על תאי MEF במדיום המכיל puromycin ולאמת ביטוי חלבון על ידי immunoblotting עם נוגדנים מתאימים. </li><li style=";text-align:right;direction:rtl"> תאים יכולים לשמש לזיהום נגיפי, ביטוי גנים וציטוקינים ניסויי הפרשה כפי שתואר בפרוטוקול 2. </li></ol>

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

המחברים מצהירים שום ניגוד עניינים.

התחמקות חיסונית נגיפית היא אחת האינטראקציות דינמיות ומרתקות ביותר התממשקות עבירה נגיפית ומארח הגנה 9. מרכיבי החיסון המולדים המארח בנויים כך שהולכים אותות הוא יזם ביעילות ובמועבר בנאמנות. המגדיר את ההיררכיה ופיקוח על איתות מפלים הוא נושא בולט של חסינות מולדת. ?...

מחקרים שנעשו לאחרונה תארו את מפלי איתות הכוללים בהרכבת מערכת חיסונית מולדת מארח. המתגורר בתוך תאים נפרדים, קולטני זיהוי תבניות (PRRs) לזהות דפוסים מולקולריים הקשורים הפתוגן (PAMPs) ממוצא המגוון כדי לעורר חיסון מולדים איתות 1. הגן רטינואית-Induced חומצתי (RIG-I) ואנטיגן בידול מלנומה 5 חלבונים (MDA5) הם חיישני cytosolic שיכירו מיני RNA עם תכונות מבניות ספציפיות 2. עם ההפעלה, RIG-I אינטראקציה עם Mavs ההמשך שלה (הידוע גם בIPS-1, ויזה, וCARDIF) מתאם זה, בתורו, מפעיל את IKK (IKKαβγ) וקינאז הקשורות IKK (TBK1 וIKKε, הידוע גם Ikki ) קומפלקסי 3-6. קינאזות חיסון המולדת מופעלת phosphorylate רגולטורים מפתח של ביטוי גנים, ובם גורמי שעתוק ומעכביהם, ולאפשר הפעלת תעתיק של גנים אנטי מארח (למשל IL6, TNF &amp; #945;, CCL5, וIFNβ). מפלי איתות אלה מהווים תגובות עוצמה פנימיות מולדת חיסונית שלהקים מדינה אנטי מיקרוביאליים להגביל את התפשטות הפתוגן במהלך של זיהום בשלבים מוקדמים. Murine γHV68 קשור קשר הדוק לKSHV שעור האדם וEBV. לכן, זיהום γHV68 של עכברים מספק מודל חיה קטן צייתן כדי לבחון את התגובה החיסונית המארחת לזיהום בנגיף הרפס גמא in vivo 7. שימוש γHV68, המעבדה שלנו חשפה אסטרטגיה מורכבת לפי γHV68 חטיפת לארח איתות חיסונית מולדת כדי לאפשר הדבקה בנגיף. מצד אחד, γHV68 מפעיל את מסלול Mavs-IKKβ לקדם הפעלת תעתיק ויראלי באמצעות בימוי IKKβ הופעל לphosphorylate transactivator שכפול (להרכבה עצמית), המפתח גורם שעתוק הנגיפי עבור שכפול γHV68 8. מצד השני, זירחון תיווך IKKβ מספרים ראשוני רלה לשפלה וטווחinates NFΚB הפעלת 9. ככזה, זיהום γHV68 יעיל ימנע ייצור ציטוקינים אנטי. מעניין, הקרנת ניצול ספריית ביטוי של γHV68 זיהתה הרכבה עצמית כאנזים E3 כדי לגרום השפלה רלה ולבטל NFΚB הפעלת 10. ממצאים אלה לחשוף אסטרטגיית התחמקות חיסונית מורכבת לפיה אירועי איתות חיסוניים נגד הזרם הם רתמו על ידי γHV68 לשלול את ייצור ציטוקינים אנטי האולטימטיבי. כאן אנו מתארים פרוטוקול למדוד את ייצור ציטוקינים אנטי בעכברים נגועים בγHV68 גם in vivo לשעבר ויו o. בפרוטוקול אנחנו עוד לחקור את הביטוי &quot;מחדש&quot; של רכיבים חיסוניים מולדים בfibroblasts העוברי בנוקאאוט על ידי התמרה lentiviral, אשר מאתרת את הפונקציה של מולקולות חיסון המולדים הספציפיות בויסות ייצור ציטוקינים אנטי. פרוטוקול זה ניתן להתאים בקלות לviru האחרses ומסלולי איתות.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

בתגובה לזיהום נגיפי, התגובה החיסונית המולדת המארח מופעלת כדי למעלה לווסת ביטוי גנים וייצור של ציטוקינים אנטי. לעומת זאת, וירוסים התפתחו אסטרטגיות מורכבות להתחמק ולנצל את איתות חיסונית מארחת להישרדות ולרבייה. התחמקות חיסונית נגיפית, כרוך הגנת מארחת והעלמת נגיפית, מספקת את אחד הממשקים המרתקים ודינמיים ביותר להבחין באינטראקציה מארח וירוס. מחקרים אלה מקדמים את ההבנה שלנו בויסות מערכת החיסונית מולדת ולסלול את הדרך שלנו לפתח טיפולים אנטי רומן. Murine γHV68 הוא הפתוגן טבעי של מכרסמים עכבריים. γHV68 זיהום של עכברים מספק מודל חיה קטן צייתן כדי לבחון את התגובה אנטי לKSHV אדם וEBV שהפרעות של in vivo אינטראקציות מארח וירוס אינה ישימות. כאן אנו מתארים פרוטוקול כדי לקבוע את ייצור ציטוקינים אנטי. פרוטוקול זה יכול להיות מותאם לvir האחרמשתמש ואיתות מסלולים. לאחרונה, גילו כי γHV68 חטיפת Mavs וIKKβ, רכיבי מפתח מולדים חיסוניים איתות במורד הזרם של RIG-I cytosolic וMDA5, כדי לבטל את הפעלת NFΚB וייצור ציטוקינים אנטי. באופן ספציפי, זיהום γHV68 מפעיל IKKβ ושIKKβ הופעל phosphorylates רלה להאיץ השפלה רלה. ככזה, HV68 γ יעילות uncouples הפעלת NFΚB מIKKβ הופעל במעלה הזרם שלו, שולל את ביטוי גני ציטוקינים אנטי. מחקר זה מבהיר אסטרטגיה מורכבת לפיה הפעלת מערכת החיסון המולדת במעלה הזרם הוא יורטה על ידי פתוגן ויראלי כדי לבטל את הפעלת תעתיק מורד הזרם המיידית ולהתחמק ייצור ציטוקינים אנטי.

שלוש דמויות נציג מוצגות כאן, כוללים ייצור ציטוקינים בריאות של Mavs נגוע γHV68 + / + וMavs-/ - רמת עכבר, הפרשת ציטוקינים וביטוי גנים של Mavs נגוע γHV68 + / + וMavs - / - MEFs, ו רמות ה-mRNA של ציטוקינים Mavs נגוע γHV68 - / - MEFs &quot;מחדש&quot; עם Mavs. ניסויי נצ...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

אנו מתארים פרוטוקול למדוד את ייצור ציטוקינים אנטי בעכברים נגועים בוירוס ההרפס מודל, וירוס ההרפס עכברי גמא 68 (γ HV68) הקשור-הדוק לההרפס של קפוסי האנושי הקשורים סרקומה (KSHV) ווירוס אפשטיין בר (EBV). ניצול זני עכבר מהונדס גנטי וfibroblasts העכבר העוברי (MEFs), אנחנו הערכנו את ייצור ציטוקינים אנטי גם in vivo לשעבר vivo. &quot;בנייה מחדש&quot; את הביטוי של מרכיבי חיסון מולדים בfibroblasts העוברי בנוקאאוט על ידי התמרה lentiviral, אנחנו עוד לאתר מולקולות חיסון מולדים ספציפיות ולנתח את אירועי איתות מפתח שדיפרנציאלי להסדיר את ייצור ציטוקינים אנטי.

הביתור מולדת איתות חיסון בהתחמקות ויראלי של ציטוקין ייצור

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

dissecting-innate-immune-signaling-viral-evasion-cytokine

Research

JoVE Journal

Immunology and Infection

10.4K Views.  Keck School of Medicine, University of Southern California.  אנו מתארים פרוטוקול למדוד את ייצור ציטוקינים אנטי בעכברים נגועים בוירוס ההרפס מודל, וירוס ההרפס עכברי גמא 68 (γ HV68) הקשור-הדוק לההרפס של קפוסי האנושי הקשורים סרקומה (KSHV) ווירוס אפשטיין בר (EBV). ני...

Video: Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently being tested in human clinical trials. Wild-type AAV is a non-pathogenic member of the parvoviridae family and inherently replication-deficient. The broad transduction profile, low immune response as well as the strong and persistent transgene expression achieved with these vectors has made them a popular and versatile tool for in vitro and in vivo gene delivery. rAAVs can be easily and cheaply produced in the laboratory and, based on their favourable safety profile, are generally given a low safety classification. Here, we describe a method for the production and titering of chimeric rAAVs containing the capsid proteins of both AAV1 and AAV2. The use of these so-called chimeric vectors combines the benefits of both parental serotypes such as high titres stocks (AAV1) and purification by affinity chromatography (AAV2). These AAV serotypes are the best studied of all AAV serotypes, and individually have a broad infectivity pattern. The chimeric vectors described here should have the infectious properties of AAV1 and AAV2 and can thus be expected to infect a large range of tissues, including neurons, skeletal muscle, pancreas, kidney among others. The method described here uses heparin column purification, a method believed to give a higher viral titer and cleaner viral preparation than other purification methods, such as centrifugation through a caesium chloride gradient. Additionally, we describe how these vectors can be quickly and easily titered to give accurate reading of the number of infectious particles produced.

Recombinant adeno-associated virus (rAAVs) vectors are becoming increasingly valuable for in vivo studies in animals. We describe how rAAVs can be produced in the laboratory and how these vectors can be titered to give an accurate reading of the number of infectious particles produced.

ייצור Titering של Adeno הקשורים ווקטורים רקומביננטי ויראלי

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

The phagocyte respiratory burst is part of the innate immune response to pathogen infection and involves the production of reactive oxygen species (ROS). ROS are toxic and function to kill phagocytized microorganisms. In vivo quantification of phagocyte-derived ROS provides information regarding an organism's ability to mount a robust innate immune response. Here we describe a protocol to quantify and compare ROS in whole zebrafish embryos upon chemical induction of the phagocyte respiratory burst. This method makes use of a non-fluorescent compound that becomes fluorescent upon oxidation by ROS. Individual zebrafish embryos are pipetted into the wells of a microplate and incubated in this fluorogenic substrate with or without a chemical inducer of the respiratory burst. Fluorescence in each well is quantified at desired time points using a microplate reader. Fluorescence readings are adjusted to eliminate background fluorescence and then compared using an unpaired t-test. This method allows for comparison of the respiratory burst potential of zebrafish embryos at different developmental stages and in response to experimental manipulations such as protein knockdown, overexpression, or treatment with pharmacological agents. This method can also be used to monitor the respiratory burst response in whole dissected kidneys or cell preparations from kidneys of adult zebrafish and some other fish species. We believe that the relative simplicity and adaptability of this protocol will complement existing protocols and will be of interest to researchers who seek to better understand the innate immune response.

The innate immune response protects organisms against pathogen infection. A critical component of the innate immune response, the phagocyte respiratory burst, generates reactive oxygen species that kill invading microorganisms. We describe a respiratory burst assay that quantifies reactive oxygen species produced when the innate immune response is chemically induced.

כימות תגובת Burst נשימה כאינדיקטור של החיסון מולדת בריאות בדג הזברה

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

באמצעות RNA-התערבות לחקר התגובה החיסונית המולדת בהמקרופאגים עכבר

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of causing systemic disease in both fish and humans. A better understanding of S. iniae disease pathogenesis requires an appropriate model system. The genetic tractability and the optical transparency of the early developmental stages of zebrafish allow for the generation and non-invasive imaging of transgenic lines with fluorescently tagged immune cells. The adaptive immune system is not fully functional until several weeks post fertilization, but zebrafish larvae have a conserved vertebrate innate immune system with both neutrophils and macrophages. Thus, the generation of a larval infection model allows the study of the specific contribution of innate immunity in controlling S. iniae infection.
The site of microinjection will determine whether an infection is systemic or initially localized. Here, we present our protocols for otic vesicle injection of zebrafish aged 2-3 days post fertilization as well as our techniques for fluorescent confocal imaging of infection. A localized infection site allows observation of initial microbe invasion, recruitment of host cells and dissemination of infection. Our findings using the zebrafish larval model of S. iniae infection indicate that zebrafish can be used to examine the differing contributions of host neutrophils and macrophages in localized bacterial infections. In addition, we describe how photolabeling of immune cells can be used to track individual host cell fate during the course of infection.

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Here, we present a protocol for the generation and imaging of a localized bacterial infection in the zebrafish otic vesicle.

הדמיה לא פולשנית של התגובה החיסונית המולדת בדגם דג הזברה הזחל של<em&gt; Streptococcus iniae</em&gt; זיהום

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research is deciphering how these dynamic protein complexes act to integrate signals from multiple sources in order to direct a specific biological response, and how this becomes deregulated in many disease settings. Despite the importance of this key biochemical mechanism, there is a lack of experimental techniques that can facilitate the specific and sensitive deconvolution of these multi-molecular signaling complexes.
Here this shortcoming is addressed through the combination of a protein complementation assay with a conformation-specific nanobody, which we have termed Bimolecular Complementation Affinity Purification (BiCAP). This novel technique facilitates the specific isolation and downstream proteomic characterization of any pair of interacting proteins, to the exclusion of un-complexed individual proteins and complexes formed with competing binding partners. 
The BiCAP technique is adaptable to a wide array of downstream experimental assays, and the high degree of specificity afforded by this technique allows more nuanced investigations into the mechanics of protein complex assembly than is currently possible using standard affinity purification techniques.

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

This manuscript describes the protocol for Bimolecular Complementation Affinity Purification (BiCAP). This novel method facilitates the specific isolation and downstream proteomic characterization of any two interacting proteins, while excluding un-complexed individual proteins as well as complexes formed with competing binding partners.

ויבתר חלבון רב מתחמי איתות על ידי טיהור זיקה קומפלמנטציה ריאקציה דו-מולקולרית (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies in an attempt to understand the precise mechanisms that lead to the breakdown of self-tolerance and subsequent autoimmunity. Approaches thus far have been based on the study of one specific aspect of the immune system (a single or few cell types or cytokines), and do not offer a global assessment of complex autoimmune disease. While patient sera-based studies have afforded important insights into autoimmunity, they do not provide the specific cellular source of the dysregulated cytokines detected. A comprehensive single-cell approach to evaluate cytokine production in multiple immune cell subsets, within the context of &#34;intrinsic&#34; patient-specific plasma circulating factors, is described here. This approach enables monitoring of the patient-specific immune phenotype (surface markers) and function (cytokines), either in its native &#34;intrinsic pathogenic&#34; disease state, or in the presence of therapeutic agents (in vivo or ex vivo).

Here we describe a single-cell proteomic approach to evaluate immune phenotypic and functional (intracellular cytokine induction) alterations in peripheral whole blood samples, analyzed via mass cytometry.

ניתוח מתא בודד של Immunophenotype וייצור ציטוקין בדם כל הפריפריה באמצעות Cytometry המונית

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

דגם העכבר כדי להעריך מולדת התגובה החיסונית לזיהום Staphylococcus aureus

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal host-microbe interactions. It is well established that different commensals exhibit a different potential to stimulate the host intestinal immune system. Such investigations involve vertebrate animals, especially rodents. Since increasing ethical concerns are linked with experiments involving vertebrates, there is a high demand for invertebrate replacements models. 
Here, we provide a Galleria mellonella oral administration model using commensal non-pathogenic bacteria and the possible assessment of the immunogenic potential of commensals on the G. mellonella immune system. We demonstrate that G. mellonella is a useful alternative invertebrate replacement model that allows the analysis of commensals with different immunogenic potential such as Bacteroides vulgatus and Escherichia coli. Interestingly, the bacteria exhibited no killing effect on the larvae, which is similar to mammals. The immune responses of G. mellonella were comparable with vertebrate innate immune responses and involve recognition of the bacteria and production of antimicrobial molecules. We propose that G. mellonella was able to restore previous microbiota balance, which is well known from healthy mammalian individuals. Although providing comparable innate immune responses in both G. mellonella and vertebrates, G. mellonella does not harbor an adaptive immune system. Since the investigated components of the innate immune system are evolutionary conserved, the model allows a prescreening and first analysis of bacterial immunogenic properties.

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Here, we provide a detailed protocol for an oral administration model using Galleria mellonella larvae and how to characterize induced innate immune responses. Using this protocol, researchers without practical experience will be able to use the G. mellonella force-feeding method.

גלרייה mellonella מודל הניהול אוראלי את תגובות מערכת החיסון מולדים Study Commensal-Induced

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal immunity, because they can model host-pathogen interactions in the tissue. While isolated cells derived from tissues were the first cell culture model, their use has been neglected because tissue can be hard to obtain. In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells (TMCs) from healthy human tonsils to study innate immune responses upon activation, mimicking viral infection in mucosal tissues. Isolation of TMCs from the tonsils is quick, because the tonsils barely have any epithelium and yield up to billions of all major immune cell types. This method allows detection of cytokine production using several techniques, including immunoassays, qPCR, microscopy, flow cytometry, etc., similar to the use of peripheral mononuclear cells (PBMCs) from blood. Furthermore, TMCs show a higher sensitivity to drug testing than PBMCs, which needs to be considered for future toxicity assays. Thus, ex vivo TMCs cultures are an easy and accessible mucosal model.

In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells from healthy humans undergoing partial surgical tonsillectomy to study innate immune responses upon activation, mimicking viral infection in mucosal tissues.

בידוד של התאים המוננובית מונמונומנט ללמוד Ex Vivo מולדת תגובות החיסונית ברקמת הלימפה של האדם Mucosal

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...

Microfluidic Co-Culture Models for Dissecting the Immune Response in in vitro Tumor Microenvironments

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise invisible processes. Advanced cell assays closely mimicking in vivo scenery are establishing themselves as novel ways to visualize and measure the bidirectional tumor-host interplay influencing the progression of cancer. Here we describe two versatile protocols to recreate highly controllable 2D and 3D co-cultures in microdevices, mimicking the complexity of the tumor microenvironment (TME), under natural and therapy-induced immunosurveillance. In section 1, an experimental setting is provided to monitor crosstalk between adherent tumor cells and floating immune populations, by bright field time-lapse microscopy. As an applicative scenario, we analyze the effects of anti-cancer treatments, such as the so-called immunogenic cancer cell death inducers on the recruitment and activation of immune cells. In section 2, 3D tumor-immune microenvironments are assembled in a competitive layout. Differential immune infiltration is monitored by fluorescence snapshots up to 72 h, to evaluate combination therapeutic strategies. In both settings, image processing steps are illustrated to extract a plethora of immune cell parameters (e.g., immune cell migration and interaction, response to therapeutic agents). These simple and powerful methods can be further tailored to simulate the complexity of the TME encompassing the heterogeneity and plasticity of cancer, stromal and immune cells subtypes, as well as their reciprocal interactions as drivers of cancer evolution. The compliance of these rapidly evolving technologies with live-cell high-content imaging can lead to the generation of large informative datasets, bringing forth new challenges. Indeed, the triangle &#39;&#39;co-cultures/microscopy/advanced data analysis&#34; sets the path towards a precise problem parametrization that may assist tailor-made therapeutic protocols. We expect that future integration of cancer-immune on-a-chip with artificial intelligence for high-throughput processing will synergize a large step forward in leveraging the capabilities as predictive and preclinical tools for precision and personalized oncology.

In the age of immunotherapy and single-cell genomic profiling, cancer biology requires novel in vitro and computational tools for investigating the tumor-immune interface in a proper spatiotemporal context. We describe protocols to exploit tumor-immune microfluidic co-cultures in 2D and 3D settings, compatible with dynamic, multiparametric monitoring of cellular functions.

מודלים של תרבית משותפת מיקרופלואידית לניתוח התגובה החיסונית במיקרו-סביבות גידוליות במבחנה

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise ...