RSM reconoce el financiamiento de la NSF Graduate Research Fellowship. MBN reconoce la financiación de un Lewis-Sigler Fellowship y el don dotado de Peter Lewis. DB reconoce la financiación de los NIH (GM046406) del Instituto Nacional de Ciencias Médicas Generales Centro de Biología Cuantitativa (GM071508). Reconocemos Christina DeCoste para obtener ayuda con los experimentos de citometría de flujo.

La Figura 2 proporciona un esquema de las secciones de protocolo 1-3. 1. Creación de ATF <ol><li> Crear cebadores para PCR amplificando dominio de unión a ADN de interés. La homología con el receptor de promotor ACT1 y la hormona (tal como se describe en las Figuras 3 y 4) se añade a través de PCR para facilitar la recombinación correcta en la cepa yMN15. </li><li> Amplificar por PCR DBD de interés utilizando una polimerasa de alta fidelidad. </li><li> Transformar&gt; 1 g de producto de PCR purificado en levadura usando el método de acetato de litio 13. </li><li> Después de la transformación, las células de la vuelta a la máxima velocidad durante 15 segundos en microcentrífuga y quite mezcla de transformación. </li><li> Resuspender en ~ 200 l de agua estéril y placa en YPD. </li><li> Al día siguiente, réplica de la placa de YPD en placas 5-FOA (placas 5-FOA se hacen como se describe en el Manual de levadura Cold Spring Harbor) 13. </li><li> Permitir el crecimiento de 2-4 days, y restreak al menos 5-10 colonias en YPD. Realizar una PCR de colonias usando los cebadores de la Tabla 1 y la secuencia para verificar la inclusión. </li></ol> 2. Creación de ATF plásmido reportero <ol><li> Determinar el sitio de unión de la ATF (más probable que provenga de la literatura). </li><li> Orden deseado región de unión como los oligos (o Ultramers, si es necesario). Ordene como superior e inferior con hebras salientes correctas para NotI y XbaI como se muestra en la Tabla 2. </li><li> Diluir oligos a concentraciones equimolares (100 micras). </li><li> Fosforilan utilizando T4 polinucleótido quinasa y luego recocido en un termociclador. Las condiciones de reacción son en la Tabla 3. </li><li> Resumen ~ 1-2 mg de pMN8 con NotI-HF y XbaI durante 1 hora a 37 ° C (condiciones de reacción en la Tabla 4). </li><li> Gel purifican la banda de la columna vertebral. </li><li> Diluir la columna vertebral purificada a 10 ng / l. </li><li> Diluir la doble cadena, fosforiloATED sitio de unión a 5 veces la concentración molar de la columna vertebral por l. </li><li> El uso de ADN ligasa de T4, ligar los sitios de unión en la cadena principal digerido a temperatura ambiente durante 30 min (Tabla 5). </li><li> Para la transformación, agregue la mitad de la reacción de ligación a 50 l de estándar, Escherichia coli químicamente competentes como XL1-Blue o DH5-alfa. </li><li> Células de choque térmico durante 45 segundos en un 42 ° C baño de agua y luego se coloca en hielo durante 2 min. </li><li> Añadir 900 l de medio SOC a una reacción de transformación. </li><li> Crece a 37 ° C durante 1 hora en un tambor de rodillo. </li><li> Corre 100-200 mu l de células por LB + AMP (100 mg / ml) para placas e incubar durante la noche. </li><li> Crece E. coli en LB + AMP ADN plásmido líquido y la cosecha. Secuencia verifique nuevo plásmido reportero de colonias de ligamiento utilizando el cebador 5&#39;-GTACCTTATATTGAATTTTC-3 &#39;. </li><li> Transformar nuevo plásmido indicador que contiene en ATF-levadura strAin de la Sección 1 usando transformación con acetato de litio. </li></ol> 3. Cuantificar el efecto de la ATF inducción en la expresión génica utilizando GFP reportero Preparación de las muestras: <ol><li> Hacer 25 mM de stock β-estradiol (10 ml de etanol + 0,0681 g de β-estradiol). Mantener refrigerado. </li><li> Grow ATF + Periodista que contienen la cepa durante la noche en 5 ml SC-URA. </li><li> Obtener nueve 250 ml frascos de agitación y añadir 25 ml SC-URA a cada uno. </li><li> Añadir 0 nM, 0,1 nM, 1 nM, 10 nM, 100 nM, 1 mM, o 10 mM β-estradiol. Esto se hace más fácilmente al hacer diluciones seriadas de 10 veces de la acción β-estradiol 25 mM. Para obtener una concentración final de 10 mM β-estradiol, añadir 10 l de la población de β-estradiol 25 mM a 25 ml de SC-ura. </li><li> Añadir 125 l de cultivos de una noche a matraces (1:200 dilución). </li><li> Durante los 2 frascos restantes, inocular con una producción de GFP constitutiva strain y una cepa que carece de buenas prácticas agrarias. Estos son necesarios para la calibración del citómetro de flujo. </li><li> Agitar a 200 rpm a 30 º C durante 12-18 horas. Nota: El tiempo óptimo de incubación se determina mediante la identificación de las buenas prácticas agrarias de inducción cuando ya no cambia tras la adición de β-estradiol. </li><li> Tomar 500 l de cada cultura y de girar en tubos de 1,7 ml de microcentrífuga separados. </li><li> Aspirar SC-URA. </li><li> Lavar una vez en 1 ml de PBS 0,1% de Tween-20 y aspirado. </li><li> Añadir 1 ml de PBS 0,1% de Tween-20 y resuspender. </li><li> Añadir 1 ml de PBS 0,1% de Tween-20 a tubos Falcon. </li><li> Añadir las células resuspendidas a tubos de 5 ml (volumen final = 2 ml) (se puede almacenar a 4 ° C durante varios días). </li><li> Opcional: células Sonicar ligeramente para cualquier ruptura de células agrupadas. La citometría de flujo análisis: Información general: La fluorescencia de 10.000-100.000 células se analiza normalmente por muestra. Los datos pueden ser procesados ​​ni en FlowJo o utilizar scripts personalizados en MATLAB oR. Asegúrese de calibrar el voltaje del canal GFP GFP utilizando controles positivos y negativos. Una vez que los archivos de FCS se exportan, un guión como el de la Figura 6, junto con los fca_readfcs función ( <a href="http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader">http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader</a> ) se puede utilizar para procesar el datos. </li><li> Lleve a cabo la citometría de flujo. <ol><li> Uso dispersión frontal (FSC) y la dispersión lateral (SSC) para identificar las células de levadura. </li><li> Ajuste el caudal de ~ 3.000 células / seg. </li><li> Mida GFP (canal FITC). </li><li> Una vez que se recopilan los datos, archivos de exportación. FCS </li></ol></li><li> Cargue MATLAB. </li><li> Mueva los archivos. FCS, fcs_readfcs.m y un guión similar al de la Figura 6 en la misma carpeta. </li><li> Cambie el directorio de trabajo actual a la carpeta que contiene los datos y scripts. </li><li> Ejecute el script de la Figura 6 (nota: laleyenda ha sido introducida manualmente para producir lo que se ve en la figura 7). </li></ol> 4. Cuantificar el efecto de la ATF inducción sobre el crecimiento celular <ol><li> Desde existencias congeladas, veta a cabo tanto (1) una cepa que contiene ATF-y (2) una cepa ATF-faltando (tal como yMN15) en placas de YPD separadas. </li><li> Después de 2 días de crecimiento, inocular tubos de cultivo separados que contienen 5 ml de líquido YPD con cada cepa y crecer durante la noche a 30 ° C. </li><li> Lleve a cabo 10 veces diluciones seriadas de un mM β-estradiol solución 0,25 abastecerse de 10.000 veces (0.025 M β-estradiol) en etanol al 100%. </li><li> Añadir 40 l de cultivos durante la noche a 10 ml de líquido YPD (1-250 dilución). </li><li> Para cada cepa, añadir 96 l de células diluidas a 18 pocillos de una placa de 96 pocillos. </li><li> Añadir 4 l de β-estradiol a las células. Un punto esencial es asegurarse de que cada pozo tiene la misma cantidad de etanol total. (Como alternativa, un mo<html> re madre concentrada de β-estradiol se puede utilizar y se diluyó posteriormente hasta el punto el efecto del etanol sobre el crecimiento no es medible). </li><li> Lleve a cabo por triplicado. Tres de los pozos para cada cepa debe ser de sólo etanol controles. </li><li> Cubrir la placa de 96 pocillos de gas permeable. </li><li> Controle atentamente el crecimiento (OD 600) en un lector de placas. </li><li> Cuantificar las tasas de crecimiento utilizando cualquier número de métodos estándar tales como encontrar la pendiente máxima. Nota: Hemos tenido buen éxito con el código abierto del paquete de software Grofit 14, que se ejecuta en el entorno de programación R Vale la pena mencionar que, si bien las tasas de crecimiento calculadas a partir de los ensayos de placa de 96 pocillos en comparación con matraces de agitación (25 ml culturas). no son necesariamente los mismos (debido tanto a las diferencias en la fisiología y en la instrumentación), que hemos observado que las tasas relativas de crecimiento son similares (aunque esto puede no ser siempre el caso). </li></ol>tle &quot;&gt; 5. Crear inducibles Genomic alelos <ol><li> Obtener pMN10, un plásmido noncentromeric con el promotor-ATF sensible de pMN8 fusionado a KanMX (en la orientación opuesta). </li><li> Digestión de restricción de la cadena principal del vector y el extracto de gel como en la Sección 2. </li><li> Recocido, fosforilar y oligos ligar contienen sitios de unión apropiadas como se describe en la Sección 2. </li><li> Secuencia de verificar. Este plásmido ahora servirá como un molde de ADN para crear el alelo inducible. </li><li> Obtener la cepa de levadura que expresa la ATF correspondiente de intereses. </li><li> Amplificar por PCR el casete KanMX-Promotor (~ 2 kb) usando los cebadores de la Tabla 6. </li><li> Transformar el producto de la PCR en la cepa de ATF-expresar utilizando el método de acetato de litio. </li><li> Placa en YPD y réplica placa en YPD + G418 al día siguiente. </li><li> Confirmar la inserción apropiada del promotor utilizando el cebador directo (5&#39;-CTGCAGCGAGGAGCCGTAAT-3 &#39;) y un cebador inverso interno a the gen cuyo promotor ha sido sustituido. El cebador inverso está típicamente diseñado para ser de entre 200-300 pb aguas abajo de la primera ATG de 15. El producto final de la PCR es de ~ 1,2 kb. </li></ol>

<ol>
	<li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+gene+expression+perturbation+systems+with+rapid,+tunable,+single-gene+specificity+in+yeast.">Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast.</a> Nucleic acids res. 41, e57 (2013).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast-acting+and+nearly+gratuitous+induction+of+gene+expression+and+protein+depletion+in+Saccharomyces+cerevisiae.">Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae.</a> Mol. Biol. cell. 22, 4447-4459 (2011).</li><li>Louvion, J. F., Havaux-Copf, B., Picard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+of+GAL4-VP16+to+a+steroid-binding+domain+provides+a+tool+for+gratuitous+induction+of+galactose-responsive+genes+in+yeast.">Fusion of GAL4-VP16 to a steroid-binding domain provides a tool for gratuitous induction of galactose-responsive genes in yeast.</a> Gene. 131, 129-134 (1993).</li><li>Littlewood, T. D., Hancock, D. C., Danielian, P. S., Parker, M. G., Evan, G. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+oestrogen+receptor+ligand-binding+domain+as+an+improved+switch+for+the+regulation+of+heterologous+proteins.">A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins.</a> Nucleic acids res. 23, 1686-1690 (1995).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+Analysis+of+mRNA+Molecules+Using+Fluorescence+In+Situ+Hybridization+in+Saccharomyces+cerevisiae.">Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae.</a> J. Vis. Exp. (76), e50382 (2013).</li><li>McIsaac, R. S., Petti, A. A., Bussemaker, H. J., Botstein, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perturbation-based+analysis+and+modeling+of+combinatorial+regulation+in+the+yeast+sulfur+assimilation+pathway.">Perturbation-based analysis and modeling of combinatorial regulation in the yeast sulfur assimilation pathway.</a> Mol. Biol. cell. 23, 2993-3007 (2012).</li><li>Belli, G., Gari, E., Piedrafita, L., Aldea, M., Herrero, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+activator/repressor+dual+system+allows+tight+tetracycline-regulated+gene+expression+in+budding+yeast.">An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.</a> Nucleic acids res. 26, 942-947 (1998).</li><li>Baron, U., Bujard, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tet+repressor-based+system+for+regulated+gene+expression+in+eukaryotic+cells:+principles+and+advances.">Tet repressor-based system for regulated gene expression in eukaryotic cells: principles and advances.</a> Meth. Enzymol. 327, 401-421 (2000).</li><li>Kodama, S., Okada, K., Akimoto, K., Inui, H., Ohkawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+aryl+hydrocarbon+receptors+for+bioassay+of+aryl+hydrocarbon+receptor+ligands+in+transgenic+tobacco+plants.">Recombinant aryl hydrocarbon receptors for bioassay of aryl hydrocarbon receptor ligands in transgenic tobacco plants.</a> Plant Biotechnol. J. 7, 119-128 (2009).</li><li>Hickman, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+regulation+of+sulfur+and+phospholipid+metabolism+reflects+the+importance+of+methylation+in+the+growth+of+yeast.">Coordinated regulation of sulfur and phospholipid metabolism reflects the importance of methylation in the growth of yeast.</a> Mol. Biol. cell. 22, 4192-4204 (2011).</li><li>Taxis, C., Stier, G., Spadaccini, R., Knop, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+protein+depletion+by+genetically+controlled+deprotection+of+a+dormant+N-degron.">Efficient protein depletion by genetically controlled deprotection of a dormant N-degron.</a> Mol. Syst. Biol. 5, 267 (2009).</li><li>Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+auxin-based+degron+system+for+the+rapid+depletion+of+proteins+in+nonplant+cells.">An auxin-based degron system for the rapid depletion of proteins in nonplant cells.</a> Nat. methods. 6, 917-922 (2009).</li><li>Burke, D. J., Amberg, D. C., Strathern, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. , (2005).</li><li>Kahm, M., Hasenbrink, G., Lichtenberg-Frate, H., Ludwig, J., Kschischo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=grofit:+Fitting+Biological+Growth+Curves+with+R.">grofit: Fitting Biological Growth Curves with R.</a> J. Stat. Softw. 33, 1-21 (2010).</li><li>Rozen, S., Skaletsky, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer3+on+the+WWW+for+general+users+and+for+biologist+programmers.">Primer3 on the WWW for general users and for biologist programmers.</a> Methods Mol. Biol. 132, 365-386 (2000).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150, 647-658 (2012).</li><li>Chockalingam, K., Chen, Z., Katzenellenbogen, J. A., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+specific+receptor-ligand+pairs+for+use+in+the+creation+of+gene+switches.">Directed evolution of specific receptor-ligand pairs for use in the creation of gene switches.</a> Proceedings of the National Academy of Sciences of the United States of America. 102, 5691-5696 (2005).</li><li>McLachlan, M. J., Chockalingam, K., Lai, K. C., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+orthogonal+ligand+specificity+in+a+single+scaffold.">Directed evolution of orthogonal ligand specificity in a single scaffold.</a> Angewandte Chemie. 48, 7783-7786 (2009).</li><li>Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J., Tyers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+pathways+that+couple+cell+growth+and+division+in+yeast.">Systematic identification of pathways that couple cell growth and division in yeast.</a> Science. 297, 395-400 (2002).</li><li>Sopko, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+pathways+and+phenotypes+by+systematic+gene+overexpression.">Mapping pathways and phenotypes by systematic gene overexpression.</a> Mol. cell. 21, 319-330 (2006).</li><li>Shimizu-Sato, S., Huq, E., Tepperman, J. M., Quail, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+light-switchable+gene+promoter+system.">A light-switchable gene promoter system.</a> Nat. biotechnol. 20, 1041-1044 (2002).</li><li>Polstein, L. R., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Light-inducible+spatiotemporal+control+of+gene+activation+by+customizable+zinc+finger+transcription+factors.">Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors.</a> J. Am. Chem. Soc. 134, 16480-16483 (2012).</li><li>Losi, A., Gartner, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Old+chromophores,+new+photoactivation+paradigms,+trendy+applications:+flavins+in+blue+light-sensing+photoreceptors.">Old chromophores, new photoactivation paradigms, trendy applications: flavins in blue light-sensing photoreceptors.</a> Photochem. Photobiol. 87, 491-510 (2011).</li><li>Boyden, E. S., Zhang, F., Bamberg, E., Nagel, G., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond-timescale,+genetically+targeted+optical+control+of+neural+activity.">Millisecond-timescale, genetically targeted optical control of neural activity.</a> Nat. Neurosci. 8, 1263-1268 (2005).</li><li>Gradinaru, V., Mogri, M., Thompson, K. R., Henderson, J. M., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+deconstruction+of+parkinsonian+neural+circuitry.">Optical deconstruction of parkinsonian neural circuitry.</a> Science. 324, 354-359 (2009).</li><li>Milias-Argeitis, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+silico+feedback+for+in+vivo+regulation+of+a+gene+expression+circuit.">In silico feedback for in vivo regulation of a gene expression circuit.</a> Nat. biotechnol. 29, 1114-1116 (2011).</li></ol>

McIsaac, Noyes y Botstein (con otros) han presentado parte de este sistema en su Descripción de la Patente.

Los conmutadores a base de hormonas descritos aquí tienen numerosas aplicaciones, desde el estudio de la biología celular nativa de ensayo de la capacidad de un dominio de unión de ADN de interés para apuntar a una secuencia de ADN in vivo. El sistema tiene muchas características deseables, incluyendo una respuesta gradual a inductor, de acción rápida, y una regulación estricta (es decir. No leakiness medible, ver Figura 7). Sin embargo, todavía hay margen de mejora y expansión. Trabajos recientes en la biología sintética ha hecho hincapié en los sistemas de síntesis de multiplexación y ampliar el repertorio de bien caracterizados, piezas de ADN programables 16. Expresión independiente, condicional de genes diana distintas requiere tanto múltiples inductores y los dominios de unión al ADN que carecen de especificidad de la superposición. La disponibilidad de los receptores diseñados y de origen natural ofrece un gran conjunto de piezas con las que el desarrollo de nuevos factores de transcripción artificial. La ampliación de larepertorio de interruptores mutuamente ortogonales ha sido ayudado en gran medida por la evolución dirigida enfoques 17,18. Los esfuerzos actuales para reprogramar la especificidad de unión al ligando de nuestros factores de transcripción artificiales se presentarán en el futuro. Anteriormente, las consecuencias fenotípicas de deleción del gen / sobreexpresión han sido ampliamente estudiados en la levadura 19,20. Sin embargo, no ha sido sencillo para estudiar el efecto de la expresión en diferentes fenotipos en un rango de niveles de expresión. Una característica principal del sistema presentado en este documento es su naturaleza gradual (Figura 8). Aunque a menudo asumido, la relación entre la expresión génica y fenotipos de interés puede no ser necesariamente monotónica. Factores de transcripción artificiales como Z3 y Z4 EV EV harán la tarea de ensayar las respuestas fenotípicas a los cambios en la expresión génica directa. Por último, los protocolos de discutired en este manuscrito son para la ingeniería y la caracterización de los factores de transcripción artificiales que den respuesta a β-estradiol, sin embargo, una importante alternativa a los dominios químicamente sensibles es el uso de dominios de luz que responden (como el PhyB/Pif3, LOV, y BLUF), cuyas actividades son reversibles sin necesidad de perturbar el medio de cultivo de crecimiento 21-23. Sistemas basados ​​en la luz facilitar el control espacio-temporal de la expresión génica, las interacciones proteína-proteína, el transporte de iones, y la actividad enzimática, que ya han demostrado ser de gran alcance 21-26. En conclusión, hemos presentado los métodos para la rápida construcción de factores de transcripción inducibles, artificiales en levadura. Este protocolo proporciona una plantilla para su construcción en conjunto con GFP reporteros afines, así como los métodos para el análisis de los datos reportero usando citometría de flujo y analizando el efecto de la activación de ATF en el crecimiento.

El desarrollo de interruptores genéticos en levaduras es de gran interés en la investigación tanto a nivel académico e industrial. En el caso ideal, interruptores genéticos pueden ser utilizados para activar un gen particular (o conjunto de genes) sólo cuando se desee por el experimentador. Secuencia de codificación de un gen situado aguas abajo de un promotor sintético no se expresa en la ausencia de una molécula de la inducción de: después de la adición del inductor del gen debe expresarse rápidamente. Se ha demostrado recientemente que un interruptor de este tipo puede ser diseñado en la levadura, donde en ausencia de inductor, la cepa muestra un fenotipo de supresión, pero en presencia de inductor, la expresión se activa en proporción al nivel de inductor en todas las células 1,2. Históricamente, los sistemas de expresión condicional en la levadura se han basado en gran medida en las secuencias de ADN que responden a nutrientes, incluyendo la MET, FO, y promotores GAL (cuyas actividades son sensibles a los niveles extracelulares de metionina, fosfato, ygalactosa, respectivamente). Mientras que la expresión condicional se puede lograr, se trata en el coste de los efectos pleiotrópicos significativos. Los receptores de hormonas tales como los receptores de estrógenos humanos han demostrado ser eficaces interruptores en eucariotas 3,4. En ausencia de hormona, una proteína fusionada a un receptor de la hormona puede ser secuestrado en el citoplasma donde interactúa con el complejo chaperona Hsp90. Tras la unión del ligando apropiado, el receptor experimenta un cambio conformacional, haciendo que se libera del complejo chaperona Hsp90 y revelando una señal de localización nuclear. Para observar la dinámica de localización de una proteína que contiene al receptor de hormona en particular, hemos creado una fusión C-terminal de Gal4dbd.ER.VP16 (GEV, un factor de transcripción sintética que contiene el dominio de unión de ADN Gal4p, el dominio de unión a ligando del receptor de estrógeno humano , y VP16) con GFP 2. Localización nuclear se observó dentro de 8 min después de la adición decantidades saturantes del inductor, ß-estradiol, a la que levadura de tipo salvaje es completamente inerte. En ese momento, la mayoría de las células tienen sitios de transcripción activos claramente visibles para los genes diana GEV (ensayadas mediante hibridación in situ fluorescente), así como los ARNm completamente maduros 2,5. Genes diana GEV aumentaron en la expresión de&gt; 2 veces en 2,5 min 2,6 (medido utilizando microarrays), lo que demuestra que se tarda &lt;2,5 min para el activador quimérico para trasladar al núcleo, unirse al ADN, y activar la transcripción. Mientras que varios otros mecanismos de activación que se han aplicado en la levadura que utilizan diversas pequeñas moléculas o fármacos (incluidos los conmutadores basados ​​en doxiciclina clásicos de Escherichia coli 7,8 y un interruptor basado en el añil 9 de Arabidopsis thaliana), ninguno ha alcanzado la velocidad, especificidad, o rigidez de la regulación que presentan los switches basados ​​en hormonas. Vale la pena mencionar tsombrero rápida fuera de los interruptores también se han desarrollado en la levadura, y típicamente trabajar por la fusión de un gen para una proteasa o ubiquitina ligasa secuencia dirigida 2,10,11,12. La capacidad de eliminar rápidamente una proteína diana de la célula facilita el estudio de los genes esenciales, así como los genes que son propensos a la supresión genética cuando se suprime 10. Los métodos descritos en este protocolo son para la construcción y caracterización sintética en los interruptores en la levadura. En primer lugar, se muestra cómo generar rápidamente las proteínas de fusión genómicamente integradas-que consisten en un dominio de unión al ADN de interés, el ligando vinculante de dominio del receptor de estrógeno humano y VP16 (DBD-EV). Después de nuestro protocolo, la proteína de fusión se expresa a partir de un promotor ACT1. Luego mostramos cómo crear un plásmido indicador análogo para la ATF y probar su funcionalidad mediante citometría de flujo. Aunque prevemos estos plásmidos indicadores que se utilizan con nuevos CATs (Figura 1), que pueden be utilizado como reporteros de un activador transcripcional nativa así. Finalmente, se proporcionan detalles para probar el efecto de la activación de ATF sobre el crecimiento celular en placas de 96 pocillos y para la ingeniería de alelos genómicas inducibles.

<table border="0" cellpadding="0" cellspacing="0" width="352">
	<colgroup>
		<col span="4" />
	</colgroup>
	<tbody>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Name of the Reagent</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments&#160;</td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Expand High Fidelity PCR System</td>
			<td style="width:88px;">Roche</td>
			<td style="width:88px;">11 732 650 001</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">T4 DNA Ligase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0202S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Competent E. coli</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">18258-012</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Estradiol</td>
			<td style="width:88px;">Tocris Biosciences</td>
			<td style="width:88px;">2824</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Ampicillin</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">BP1760-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">T4 Polynucleotide Kinase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0201</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">PBS</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">10010-23</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">Tween-20</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">9005-64-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">clonNAT</td>
			<td style="width:88px;">Jena Bioscience</td>
			<td style="width:88px;">AB-102L</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">XbaI</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R0145S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">NotI-HF</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R3189S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">CutSmart Buffer</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">B7204S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Glucose</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">D15-500</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Bacto-Peptone</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">211677</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Yeast Extract</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">210929</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Agarose</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">214010</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">100% Ethanol</td>
			<td style="width:88px;">Decon Laboratories</td>
			<td style="width:88px;">04-355-222</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">G418</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">11811-031</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:88px;">QIAGEN</td>
			<td style="width:88px;">27104</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Lithium acetate dihydrate</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">L-6883</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Salmon sperm DNA</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">93283</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">PEG 3350</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">P-3640</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plasmids pMN8 and pMN10; yeast strain yMN15</td>
			<td style="width:88px;">Noyes or Botstein labs</td>
			<td style="width:88px;"></td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Luria Broth</td>
			<td>Sigma-Aldrich</td>
			<td>L3397</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EQUIPMENT:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Material Name</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments (optional)</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">LSRII Flow Cyometer&#160;</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">Various Models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="103">
			<td height="103" style="height:103px;width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">Software for analyzing .FCS files from flow cytometry experiments</td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">R</td>
			<td style="width:88px;">Open Source</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">For analyzing growth-rate data from plate reader.&#160;</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Falcon Tubes</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">352052</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="52">
			<td height="52" style="height:52px;width:88px;">1.7 ml Eppendorf&#160; Tubes</td>
			<td style="width:88px;">GeneMate</td>
			<td style="width:88px;">C3262-1</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">250 ml Shake Flasks</td>
			<td style="width:88px;">Corning</td>
			<td style="width:88px;">4446-250</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">96-well, flat-bottom plates</td>
			<td style="width:88px;">Costar</td>
			<td style="width:88px;">3635</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plate Reader (Synergy H1 Multi-Mode Plate Reader)</td>
			<td style="width:88px;">BioTek</td>
			<td style="width:88px;">H1MG</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Breathe-Easy Membranes</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">Z380059-1PAK</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Thermocycler</td>
			<td style="width:88px;">various companies</td>
			<td style="width:88px;">Various models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">SC-Ura powder</td>
			<td style="width:88px;">MP Biomedicals</td>
			<td style="width:88px;">114410622</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">5-FOA</td>
			<td style="width:88px;">Zymo Research</td>
			<td style="width:88px;">F9001-1</td>
			<td style="width:88px;"></td>
		</tr>
	</tbody>
</table>

rapid synthesis and screening of chemically activated transcription factors with gfp-based reporters

La biología sintética tiene como objetivo diseñar racionalmente y construir circuitos sintéticos con propiedades cuantitativas deseadas, así como proporcionar herramientas para interrogar la estructura de circuitos de control nativas. En ambos casos, la capacidad de programar la expresión génica de una manera rápida y sintonizable, sin efectos fuera de objetivo, puede ser útil. Hemos construido cepas de levadura que contienen el ACT1 promotor aguas arriba de un casete URA3 seguido por el dominio de unión a ligando del receptor de estrógeno humano y VP16. Mediante la transformación de esta cepa con un producto de la PCR lineal que contiene un dominio de unión de ADN y la selección en contra de la presencia de URA3, un factor de transcripción artificial expresado constitutivamente (ATF) puede ser generado por recombinación homóloga. ATF diseñados de esta manera se puede activar un gen diana única en presencia de inductor, eliminando así tanto la activación fuera del objetivo y las condiciones de crecimiento no fisiológicas encontradas con conditi comúnmente utilizadoonal sistemas de expresión de genes. También se proporciona un método simple para la rápida construcción de plásmidos indicadores de GFP que responden específicamente a un factor de transcripción nativo o artificial de interés.

<html> La Figura 5 muestra la inducción de la GFP por Z 3 EV, Z 4 EV, o GEV con el tiempo. Tenga en cuenta el aumento de la producción de GFP en respuesta a los ATF que contienen dominios de unión a ADN nonyeast. Recientemente hemos especulado que esto resulta de estos factores que han alcanzado la especificidad de un solo gen en el genoma de la levadura 1. Inducción GEV solo conduce a la activación / represión de cientos de genes, mientras que Z y Z 3 EV 4 EV sólo activar la expresión de un gen diana colocado aguas abajo de un promotor sintético que contiene sitios de unión apropiados (5&#39;-GCGTGGGCG-3 &#39;y 5&#39;- GCGGCGGAGGAG, 3 &#39;, respectivamente) 1. Figura 7 demuestra la estrecha regulación del sistema (no hay resultados inductor en ninguna de GFP detectable) y se que todas las células se inducen en respuesta a inductor La capacidad de Z 3 EV para inducir GFP a través de una gama de concentraciones de β-estradiol se muestran en la Figura 8. <html> ent &quot;fo: keep-together.within-page =&quot; always &quot;&gt; <img alt="Figura 1" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig1highres.jpg" src="/files/ftp_upload/51153/51153fig1.jpg" /> Figura 1. Factores de transcripción artificiales interactúan con Hsp90 en ausencia de β-estradiol. Cuando β-estradiol se une a la ATF, la Hsp90 se disocia, permitiendo que el ATF para entrar en el núcleo y activar la expresión del reportero plásmido. <img alt="Figura 2" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig2highres.jpg" src="/files/ftp_upload/51153/51153fig2.jpg" /> Figura 2. Esquema del protocolo para las cepas de ingeniería que contienen factores de transcripción artificiales y construcción / prueba GFP reporteros afines. load/51153/51153fig3highres.jpg &quot;src =&quot; / files/ftp_upload/51153/51153fig3.jpg &quot;/&gt; Figura 3. La secuencia ACT1pr-URA3-EV en la cepa yMN15 en el locus LEU2. <img alt="Figura 4" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig4highres.jpg" src="/files/ftp_upload/51153/51153fig4.jpg" /> Figura 4. Diseño de cebadores de PCR para la amplificación de un dominio de unión de ADN de interés con una homología de secuencia adicional para generar una nueva proteína de fusión cuando transformado con éxito en yMN15. <img alt="La figura 5" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig5highres.jpg" src="/files/ftp_upload/51153/51153fig5.jpg" /> Figura 5. Inducción GFP por tres diferentes pares de ATF-promotor en respuesta a 1 mM β-estradiol. &lt;/ P&gt; <img alt="La figura 6" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig6highres.jpg" src="/files/ftp_upload/51153/51153fig6.jpg" /> Figura 6. Una secuencia de comandos de MATLAB para el flujo de procesamiento de datos de citometría. Este guión fue adaptado de <a href="http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data">http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data</a> . <img alt="La figura 7" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig7highres.jpg" src="/files/ftp_upload/51153/51153fig7.jpg" /> Figura 7. Inducción de GFP por Z 3 EV en respuesta a 0 μ M β-estradiol y 1 mM β-estradiol siguientes 18 h de inducción. Fluorescencia era también MEASured de células que carecen de buenas prácticas agrarias para ilustrar la regulación estricta del sistema EV Z 3. Esta cifra se ha generado utilizando el código de la figura 6. <img alt="Figura 8" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig8highres.jpg" src="/files/ftp_upload/51153/51153fig8.jpg" /> Figura 8. La relación entre la concentración de inductor y de salida expresión se clasifica con un coeficiente de Hill de ~ 1. (A) Distribución de la expresión de GFP como una función de la concentración de β-estradiol. (B) La fluorescencia media de las distribuciones de (A). Los datos se ajustaron a la función G (D) = G + min (G max-G min) D n / (n + D K n), donde D es la dosis-β estradiol, G y G min max son los valores mínimo y máximos valores de las buenas prácticas agrarias, respectivamente, n es el coeficiente de Hill, y K es la dosis-β estradiol que produce ½ (G máx + G min). <table border="0" cellpadding="0" cellspacing="0" fo:keep-together.within-page="always" width="176"><tbody><tr><td> Secuencia de oligonucleótidos </td><td> Nombre </td></tr><tr><td> 5&#39;-TTGAAACCA AACTCGCCTCT-3 &#39; </td><td> DBD Compruebe Forward </td></tr><tr><td> 5&#39;-tccagagac ttcagggtgct-3 &#39; </td><td> DBD descubre la inversa </td></tr></tbody></table> Tabla 1. Los cebadores para confirmar la correcta fusión de DBD de interés para el receptor de estrógeno. El cebador directo es homóloga del promotor ACT1 y el cebador inverso es homóloga al receptor de estrógeno. Para DBDs típicos (~ 300 pb), el producto de la PCR es &lt;1,5 kb. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Secuencia de oligonucleótidos </td><td> Nombre </td></tr><tr><td> 5&#39;-ggccgc ... DBD sitio atracones ... t-3 &#39; </td><td> Top oligo </td></tr><tr><td> 5&#39;-ctaga ... ADN sitio de unión revertir ... gc-3 &#39; </td><td> Oligo Bottom </td></tr><tr><td> 5&#39;-gcc gcGTGGGCG T GCGTGGGCG G G CGTGGGCG T GCGTGGGCG T GCGTG GGCG T GCGTGGGCG t-3 &#39; </td><td> Top oligo + 6x Zif268 Sitios de Unión </td></tr><tr><td> 5&#39;-ctagaCGCCCACGCACGCCCACGCC CGCCCACGCACGCCCACGCCCGCC CACGCACGCCCACgc-3 &#39; </td><td> Oligo Bottom + 6x Zif268 Sitios de Unión </td></tr></tbody></table> Tabla 2. S tructura de cebadores para la creación de ADN de doble cadena que contiene los sitios de unión de intereses. Para crear el Z3 promotor-EV sensible, + 6x Zif268 se utilizaron los oligonucleótidos Binding Top oligo + 6x Zif268 sitios de unión y oligo Bottom.Secuencias para la creación de los voladizos de ADN correctas son en minúsculas. El sitio de unión consenso Zif268, GCGTGGGCG, se subraya en el oligo superior. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Reactivo </td><td> Cantidad </td></tr><tr><td> T4 polinucleótido quinasa de búfer </td><td> 5 l </td></tr><tr><td> T4 polinucleótido quinasa (@ 10 000 unidades / ml) </td><td> 1 l </td></tr><tr><td> Top oligo (100 M) </td><td> 1.5 l </td></tr><tr><td> Oligo Bottom (100 M) </td><td> 1.5 l </td></tr><tr><td> Agua </td><td> 41 l </td></tr></tbody></table> Tabla 3. Fosforilar y cebadores de recocido en un termociclador con 50 l de reacción descrita anteriormente. Hay dos pasos del termociclador. Paso 1: 37 º C 30 min (fosforilar), y el paso 2: 95 º C 30 seg (dimitir 1 ° C cada 30 segundos hasta que a 4 ° C; Recocido). <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Reactivo </td><td> Cantidad </td></tr><tr><td> XbaI </td><td> 1 l </td></tr><tr><td> NotI-HF </td><td> 1 l </td></tr><tr><td> El ADN del plásmido </td><td> 5 l (2.1 microgramos) </td></tr><tr><td> 10x Cut inteligente Buffer </td><td> 5 l </td></tr><tr><td> Agua </td><td> 38 l </td></tr></tbody></table> Tabla 4. Digestión de restricción del plásmido pMN8 con XbaI y NotI. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr height="22" style="height:16.5pt"><td class="xl65" height="22" style="height:16.5pt;width:66pt" width="88"> Reactivo </td><td class="xl66" style="width:66pt" width="88"> Cantidad </td></tr><tr height="43" style="height:32.25pt"><td> Ligasa T4 Buffer </td><td> 2 l </td></tr><tr height="22" style="height:16.5pt"><td> Ligasa T4 </td><td> 0.2 l </td></tr><tr height="43" style="height:32.25pt"><td> Backbone @ 10 ng / l </td><td> 1 l </td></tr><tr height="106" style="height:79.5pt"><td> Secuencias de unión @ 5x concentración molar / l </td><td> 1 l </td></tr><tr height="22" style="height:16.5pt"><td> Agua </td><td> 15,8 l </td></tr></tbody></table> Tabla 5. Ligar sitios de unión en el ADN plásmido. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Cartilla </td><td> Descripción </td></tr><tr><td> ~ 40 pb aguas arriba del ATG + CGCACTTAACTTCGCATCTG-3 &#39; </td><td> Cebador directo para amplificar KanMX-Promotor </td></tr><tr><td> 5&#39;-inverso del complemento (ATG + ~ 37bp) + TATAGTTTTTTCTCCTTGACG-3 &#39; </td><td> Pri inversamer para amplificar KanMX-Promotor </td></tr><tr><td> 5&#39;-caatttgtctgctcaagaaaataaa ttaaatacaaataaaCGCAC TTAACTTCGCATCTG-3 &#39; </td><td> Cebador directo para hacer intercambio promotor GCN4. </td></tr><tr><td> 5&#39;-tggatttaaagcaaataaacttgg ctgatattcggacatTATAGTT TTTTCTCCTTGACG-3 &#39; </td><td> Cebador inverso para hacer intercambio promotor GCN4. </td></tr></tbody></table> Tabla 6. Amplificar por PCR KanMX-Promotora para hacer alelo titratible.

Watch this Scientific Journal Video about Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters at JoVE.com

Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Este protocolo describe un procedimiento experimental para la construcción rápida de factores de transcripción artificiales (ATFS) con GFP reporteros afines y cuantificación de la capacidad de los ATF para estimular la expresión de GFP mediante citometría de flujo.

Síntesis rápida y Detección de factores de transcripción activados químicamente con los periodistas basados ​​en las buenas prácticas agrarias

Synthetic biology aims to rationally design and build synthetic circuits with desired quantitative properties, as well as provide tools to interrogate the ...

rapid-synthesis-screening-chemically-activated-transcription-factors

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 1

Transcription: DNA to RNA

SCIENTISTS IN ACTION

14.4K vistas.  Princeton University.  Este protocolo describe un procedimiento experimental para la construcción rápida de factores de transcripción artificiales (ATFS) con GFP reporteros afines y cuantificación de la capacidad de los ATF para estimular la expresión de GFP mediante citometría de flujo. 

Video: Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Generation of Human CD40-activated B cells

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer immunotherapy 1-3. Compared to Dendritic cells (DCs), the best characterized APC, CD40-B cells have several distinct biological and technical properties. Similar to DCs, B cells show an increased expression of MHC and co-stimulatory molecules (Fig.1b), exhibit a strong migratory capacity and present antigen presentation efficiently to T cells, after stimulation with interleukin-4 and CD40 ligand (CD40L). However, in contrast to immature or mature DCs, CD40-B cells express the full lymph node homing triad consisting of CD62L, CCR7/CXCR4, and leukocyte function antigen-1 (LFA1, CD11a/CD18), necessary for homing to secondary lymphoid organs (Fig.1a) 3. CD40-B cells can be generated without difficulties from very small amounts of peripheral blood which can be further expanded in vitro to very large amounts of highly-pure CD40-B cells (&gt;109 cells per patient) from healthy donors as well as cancer patients (Fig.1c,d) 1,4. 
In this protocol we demonstrate how to obtain fully activated CD40-B cells from human PBMC. Key molecules for the cell culture are CD40 ligand, interleukin-4 (IL-4) and cyclosporin A (CsA), which are replenished in a 3-4 day culture cycle. For laboratory purposes CD40-stimulation is provided by NIH/3T3 cells expressing recombinant human CD40 ligand (tCD40L NIH/3T3) 5. To avoid contamination with non-transfected cells, expression of the human CD40 ligand on the transfectants has to be checked regularly (Fig.2). 
After 14 days CD40-B cell cultures consist of more than 95% pure B cells and an expansion of CD40-B cells over 65 days is frequently possible without any loss of function 1, 4. CD40-B cells efficiently take up, process and present antigens to T cells 6. They do not only prime na&#970;ve, but also expand memory T cells 7,8. CD40-activated B cells can be used to study B-cell activation, differentiation and function. Moreover, they represent a promising tool for therapeutic or preventive vaccination against tumors 9.

In this video we present the ex vivo generation and expansion of human CD40-activated B cells (CD40-B) from peripheral blood mononuclear cells (PBMC) by stimulation with CD40 ligand and interleukin-4.

Generación de humanos CD40 activado por células B

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer ...

Investigación

Biología

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

Fluorescencia de células activadas por la clasificación de los protoplastos de la planta

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes. However, many compounds identified in screens using cell culture models are often found to be toxic or pharmacologically inactive in vivo1-2. Screening in whole animal models can help avoid these pitfalls and streamline the path to drug development.
C. elegans is a multicellular model organism well suited for HTS. It is small (&lt;1 mm) and can be economically cultured and dispensed in liquids. C. elegans is also one of the most experimentally tractable animal models permitting rapid and detailed identification of drug mode-of-action3.
We describe a protocol for culturing and dispensing fluorescent strains of C. elegans for high-throughput screening of chemical libraries or detection of environmental contaminants that alter the expression of a specific gene. Large numbers of developmentally synchronized worms are grown in liquid culture, harvested, washed, and suspended at a defined density. Worms are then added to black, flat-bottomed 384-well plates using a peristaltic liquid dispenser. Small molecules from a chemical library or test samples (e.g., water, food, or soil) can be added to wells with worms. In vivo, real-time fluorescence intensity is measured with a fluorescence microplate reader. This method can be adapted to any inducible gene in C. elegans for which a suitable reporter is available. Many inducible stress and developmental transcriptional pathways are well defined in C. elegans and GFP transgenic reporter strains already exist for many of them4. When combined with the appropriate transgenic reporters, our method can be used to screen for pathway modulators or to develop robust biosensor assays for environmental contaminants. 
We demonstrate our C. elegans culture and dispensing protocol with an HTS assay we developed to monitor the C. elegans cap &#x2018;n&#x2019; collar transcription factor SKN-1. SKN-1 and its mammalian homologue Nrf2 activate cytoprotective genes during oxidative and xenobiotic stress5-10. Nrf2 protects mammals from numerous age-related disorders such as cancer, neurodegeneration, and chronic inflammation and has become a major chemotherapeutic target11-13.Our assay is based on a GFP transgenic reporter for the SKN-1 target gene gst-414, which encodes a glutathione-s transferase6. The gst-4 reporter is also a biosensor for xenobiotic and oxidative chemicals that activate SKN-1 and can be used to detect low levels of contaminants such as acrylamide and methyl-mercury15-16.

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

A procedure for liquid-based culturing and dispensing of C. elegans strains expressing fluorescent reporter proteins is described that does not require expensive sorting equipment. This approach can be applied to numerous inducible C. elegans genes for drug discovery or biosensing of contaminants.

Selección de alto rendimiento y biosensores fluorescentes con C. elegans Las cepas

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron (dgn)-destabilized Green Fluorescent Protein (GFP)-based Reporter Protein

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. Maintenance of proteasome activity was implicated in many key cellular processes, like cell's stress response 3, cell cycle regulation and cellular differentiation 4 or in immune system response 5. The dysfunction of the ubiquitin-proteasome system has been related to the development of tumors and neurodegenerative diseases 4, 6. Additionally, a decrease in proteasome activity was found as a feature of cellular senescence and organismal aging 7, 8, 9, 10. Here, we present a method to measure ubiquitin-proteasome activity in living cells using a GFP-dgn fusion protein. To be able to monitor ubiquitin-proteasome activity in living primary cells, complementary DNA constructs coding for a green fluorescent protein (GFP)&#x2013;dgn fusion protein (GFP&#x2013;dgn, unstable) and a variant carrying a frameshift mutation (GFP&#x2013;dgnFS, stable 11) are inserted in lentiviral expression vectors. We prefer this technique over traditional transfection techniques because it guarantees a very high transfection efficiency independent of the cell type or the age of the donor. The difference between fluorescence displayed by the GFP&#x2013;dgnFS (stable) protein and the destabilized protein (GFP-dgn) in the absence or presence of proteasome inhibitor can be used to estimate ubiquitin-proteasome activity in each particular cell strain. These differences can be monitored by epifluorescence microscopy or can be measured by flow cytometry.

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron dgn-destabilized Green Fluorescent Protein GFP-based Reporter Protein

A method to monitor ubiquitin-proteasome activity in living cells is described. A degron-destabilized GFP- (GFP-dgn) and a stable GFP-dgnFS fusion protein are generated and transduced into the cell using a lentiviral expression vector. This technique allows to generate a stable GFP-dgn/GFP-dgnFS expressing cell line in which ubiquitin-proteasome activity can be easily assessed using epifluorescence or flow cytometry.

Control de la ubiquitina-proteasoma actividad en las células vivas utilizando un degron (dgn)-desestabilizado la proteína verde fluorescente (GFP)-basada en proteína indicadora

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. ...

Synthesis of Nine-atom Deltahedral Zintl Ions of Germanium and their Functionalization with Organic Groups

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 Their redox chemistry is even younger, just about ten years old, but despite this short history these deltahedral clusters ions E9n- (E = Si, Ge, Sn, Pb; n = 2, 3, 4) have already shown interesting and diverse reactivity and have been at the forefront of rapidly developing and exciting new chemistry.3-6 Notable milestones are the oxidative coupling of Ge94- clusters to oligomers and infinite chains,7-19 their metallation,14-16,20-25 capping by transition-metal organometallic fragments,26-34 insertion of a transition-metal atom at the center of the cluster which is sometimes combined with capping and oligomerization,35-47 addition of main-group organometallic fragments as exo-bonded substituents,48-50 and functionalization with various organic residues by reactions with organic halides and alkynes.51-58 
This latter development of attaching organic fragments directly to the clusters has opened up a new field, namely organo-Zintl chemistry, that is potentially fertile for further synthetic explorations, and it is the step-by-step procedure for the synthesis of germanium-divinyl clusters described herein. The initial steps outline the synthesis of an intermetallic precursor of K4Ge9 from which the Ge94- clusters are extracted later in solution. This involves fused-silica glass blowing, arc-welding of niobium containers, and handling of highly air-sensitive materials in a glove box. The air-sensitive K4Ge9 is then dissolved in ethylenediamine in the box and then alkenylated by a reaction with Me3SiC&equiv;CSiMe3. The reaction is followed by electrospray mass spectrometry while the resulting solution is used for obtaining single crystals containing the functionalized clusters [H2C=CH-Ge9-CH=CH2]2-. For this purpose the solution is centrifuged, filtered, and carefully layered with a toluene solution of 18-crown-6. Left undisturbed for a few days, the so-layered solutions produced orange crystalline blocks of [K(18-crown-6)]2[Ge9(HCCH2)2]&bull;en which were characterized by single-crystal X-ray diffraction. 
The process highlights standard reaction techniques, work-up, and analysis towards functionalized deltahedral Zintl clusters. It is hoped that it will help towards further development and understanding of these compounds in the community at large.

We present the high-temperature synthesis of intermetallic precursors K4Ge9, their dissolution in ethylenediamine to form Ge94- deltahedral Zintl ions, and the reaction of the clusters with alkynes to form organo-Zintl ions. The latter are characterized by electrospray mass spectrometry in solutions and by single-crystal X-ray diffraction in the solid state.

Síntesis de Deltahedral de nueve átomos de germanio Zintl iones y su funcionalización con grupos orgánicos

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such architectures are not random and involve interactions between gene promoters and regulatory elements 13. The binding of transcription factors to specific regulatory sequences brings about a network of transcription regulation and coordination 1, 14. 
Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) was developed to identify these higher-order chromatin structures 5,6. Cells are fixed and interacting loci are captured by covalent DNA-protein cross-links. To minimize non-specific noise and reduce complexity, as well as to increase the specificity of the chromatin interaction analysis, chromatin immunoprecipitation (ChIP) is used against specific protein factors to enrich chromatin fragments of interest before proximity ligation. Ligation involving half-linkers subsequently forms covalent links between pairs of DNA fragments tethered together within individual chromatin complexes. The flanking MmeI restriction enzyme sites in the half-linkers allow extraction of paired end tag-linker-tag constructs (PETs) upon MmeI digestion. As the half-linkers are biotinylated, these PET constructs are purified using streptavidin-magnetic beads. The purified PETs are ligated with next-generation sequencing adaptors and a catalog of interacting fragments is generated via next-generation sequencers such as the Illumina Genome Analyzer. Mapping and bioinformatics analysis is then performed to identify ChIP-enriched binding sites and ChIP-enriched chromatin interactions 8. 
We have produced a video to demonstrate critical aspects of the ChIA-PET protocol, especially the preparation of ChIP as the quality of ChIP plays a major role in the outcome of a ChIA-PET library. As the protocols are very long, only the critical steps are shown in the video.

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) is a method for de novo detection of chromatin interactions, for better understanding of transcriptional control.

La cromatina Análisis de Interacción con la etiqueta de secuenciación pareadas final (Chia-PET) para el mapeo de la cromatina y la comprensión de las interacciones Reglamento Transcripción

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

Using Coculture to Detect Chemically Mediated Interspecies Interactions

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by secreting metabolites. These metabolites have the potential to modulate the physiology and differentiation of their microbial neighbors and are likely important factors in the establishment and maintenance of complex microbial communities. We have developed a fluorescence-based coculture screen to identify such chemically mediated microbial interactions. The screen involves combining a fluorescent transcriptional reporter strain with environmental microbes on solid media and allowing the colonies to grow in coculture. The fluorescent transcriptional reporter is designed so that the chosen bacterial strain fluoresces when it is expressing a particular phenotype of interest (i.e. biofilm formation, sporulation, virulence factor production, etc.) Screening is performed under growth conditions where this phenotype is not expressed (and therefore the reporter strain is typically nonfluorescent). When an environmental microbe secretes a metabolite that activates this phenotype, it diffuses through the agar and activates the fluorescent reporter construct. This allows the inducing-metabolite-producing microbe to be detected: they are the nonfluorescent colonies most proximal to the fluorescent colonies. Thus, this screen allows the identification of environmental microbes that produce diffusible metabolites that activate a particular physiological response in a reporter strain. This publication discusses how to: a) select appropriate coculture screening conditions, b) prepare the reporter and environmental microbes for screening, c) perform the coculture screen, d) isolate putative inducing organisms, and e) confirm their activity in a secondary screen. We developed this method to screen for soil organisms that activate biofilm matrix-production in Bacillus subtilis; however, we also discuss considerations for applying this approach to other genetically tractable bacteria.

Bacteria produce secreted compounds that have the potential to affect the physiology of their microbial neighbors. Here we describe a coculture screen that allows detection of such chemically mediated interspecies interactions by mixing soil microbes with fluorescent transcriptional reporter strains of Bacillus subtilis on solid media.

Usando Coculture detectar químicamente mediadas por interacciones interespecíficas

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

Rápido y Eficiente de pez cebra Genotipado Utilizando PCR con análisis del derretimiento de alta resolución

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Selección de alto rendimiento para moduladores químicos de genes post-transcripcionalmente regulados

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder (ALLIGATOR)

Luciferase-based reporters of cellular gene expression are in widespread use for both longitudinal and end-point assays of biological activity. In circadian rhythms research, for example, clock gene fusions with firefly luciferase give rise to robust rhythms in cellular bioluminescence that persist over many days. Technical limitations associated with photomultiplier tubes (PMT) or conventional microscopy-based methods for bioluminescence quantification have typically demanded that cells and tissues be maintained under quite non-physiological conditions during recording, with a trade-off between sensitivity and throughput. Here, we report a refinement of prior methods that allows long-term bioluminescence imaging with high sensitivity and throughput which supports a broad range of culture conditions, including variable gas and humidity control, and that accepts many different tissue culture plates and dishes. This automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) also allows the observation of spatial variations in luciferase expression across a cell monolayer or tissue, which cannot readily be observed by traditional methods. We highlight how the ALLIGATOR provides vastly increased flexibility for the detection of luciferase activity when compared with existing methods.

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder ALLIGATOR

Genetically encoded luciferase is a popular non-invasive reporter of gene expression. Use of an automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) enables longitudinal recording from bioluminescent cells under a wide range of conditions. Here we show how ALLIGATOR may be used in the context of circadian rhythms research.

Medida flexible de reporteros bioluminiscentes con un automatizado Luciferase Longitudinal imagen optimizada de Gas y temperatura grabadora (cocodrilo)

Síntesis rápida y Detección de factores de transcripción activados químicamente con los periodistas basados ​​en las buenas prácticas agrarias

Síntesis rápida y Detección de factores de transcripción activados químicamente con los periodistas basados en las buenas prácticas agrarias