This work was supported by grants from CONACyT-SEP (SEP-2008-84582; CB-2011-01-168497) and Promep-SEP for R.A.G.; P.H. received a scholarship from CONACyT (447442).

1. HFF Cultivo Celular y Ad-infección <ol><li> Propagar virus Ad5 WT en monocapas de células HEK-293 y título como unidades formadoras de fluorescentes (FFU) sobre las células HFF tal como se describe anteriormente 8. </li><li> Crecer fibroblastos de prepucio humano (HFF) en 10 ml de DMEM / 10% suero bovino fetal (FBS) en placas estériles de cultivo de 100 mm a 37 ºC y 5% de CO 2 en un incubador humidificado. Determinar el número de células usando una cámara de Neubauer contando las células en los cuatro conjuntos de 16 cuadrados. El número de células por ml se obtiene mediante el cálculo del número medio de células en los cuatro conjuntos de 16 cuadrados y multiplicando este número por 10 4. Para cada tiempo después de la infección incluido en el paso 1.3, use 1 x 10 7 células HFF. </li><li> Mock-infectar o infectar células HFF con adenovirus tipo 5 (Ad5) de tipo salvaje (WT) (H5pg4100 8) en 100 mm platos de cultivo de tejidos utilizando 1 ml de Ad5 en DMEM por plato en una MOI de 30 Focus Forming Unidad o FFU , por célula. Incubar durante 2 horas en ahumidified incubadora de cultivo celular a 37 ºC y 5% de CO 2, meciéndose cuidadosamente los platos cada 15 minutos para asegurar la distribución homogénea del inóculo del virus sobre las células. Después de este tiempo, retirar el medio y añadir DMEM suplementado con 10% de SFB y se incuba durante 16, 24 o 36 horas en una incubadora de cultivo celular humidificado a 37 º C y 5% de CO 2. Continúe con el paso 2.1. </li></ol> 2. Preparación de las fracciones Sub-nuclear Enriquecido con adenovirus RC <ol><li> Infectados Ad5-cosecha o células HFF falsamente infectadas con un raspador de células y recoger las células en tubos de centrífuga estériles. Determinar el número de células como en el paso 1.2. Utilice 1 x 10 7 células por cada vez que después de la infección se especifica en el paso 1.3. </li><li> Centrifugar las células a 220 xg, 4 ° C durante 5 min. </li><li> Resuspender el sedimento celular en PBS enfriado con hielo (NaCl 137 mM, 2,7 mM KCl, 10 mM Na 2 HPO 4 y 1,8 mM KH 2 PO 4). Sedimento celular Washs 3 veces con 5 ml de helado de PBS por lavado. Para ello, centrifugar las células a 220 xg, 4 ° C durante 5 minutos, decantar y desechar el sobrenadante (SN), y volver a suspender el sedimento celular por pipeteo suave. </li><li> Para interrumpir la membrana plasmática, resuspender el sedimento celular en 700 mu l de tampón hipotónico enfriado con hielo (10 mM HEPES pH 7,9, 10 mM KCl, 1,5 mM de MgCl 2, DTT 0,5 mM, 20 μ g / ml fluoruro de fenilmetilsulfonilo (PMSF) , una mezcla de cisteína, serina, treonina y los inhibidores de la aspartil proteasa incluyendo 10 μ g / ml de inhibidor de tripsina pancreática bovina, 10 μ g / ml de pepstatina A y 10 μ g / ml N acetil-L-leucil-L-leucil-L -argininal) y dejar que las células se hinchan en hielo durante 3 horas. </li><li> Lyse las células usando un homogeneizador con una mano de mortero tipo teflón holgada. Realizar 80 Dounce golpes y muestras del monitor cada 20 golpes por microscopía de campo claro para garantizar que todas las células se han lisado, pero que los núcleos tienen not sido dañado o roto. </li><li> Centrifugar el homogeneizado celular a 300 xg, 4 ° C durante 5 min. Almacenar el SN como la fracción citoplasmática a -20 ºC en un tubo de centrífuga. </li><li> Para eliminar los desechos celulares a partir de núcleos, resuspender el precipitado en 750 μ l de solución 1 (S1) (0,25 M de sacarosa, 10 mM de MgCl 2 20 mu g / ml PMSF, una mezcla de cisteína, serina, inhibidores de la treonina y la aspartil proteasa incluyendo 10 μ g / ml de inhibidor de tripsina pancreática bovina, 10 μ g / ml de pepstatina A y 10 μ g / ml N acetil-L-leucil-L-leucil-L-argininal) y la capa sobre un volumen igual de solución de 2 (S2) (0,35 M de sacarosa, 0,5 mM de MgCl 2, 20 μ g / ml PMSF, una mezcla de cisteína, serina, inhibidores de la treonina y la aspartil proteasa incluyendo 10 μ g / ml de inhibidor de tripsina pancreática bovina, 10 μ g / ml de pepstatina A y 10 μ g / ml N acetil-L-leucil-L-leucil-L-argininal). Centrifuge a 1.400 xg, 4 ° C durante 5 min. </li><li> Deseche el SN utilizando una micropipeta. Evite perturbar el sedimento. </li><li> Resuspender el sedimento que contiene núcleos aislados en 750 μ l de S2. </li><li> Para aislar fracciones subnucleares enriquecidos con adenovirus RC (RCF), sonicado se volvieron a suspender los núcleos con un baño de ultrasonidos, utilizando dos pulsos 5 min, o hasta que todos los núcleos son lisadas como se observa por microscopía de campo claro. Utilice hielo en baño ultrasónico, según sea necesario para mantener las muestras en o por debajo de 4 ° C. </li><li> Capa de los núcleos sonicadas sobre un volumen igual de solución de 3 (S3) (0,88 M de sacarosa, 0,5 mM de MgCl 2) y centrifugar a 3000 xg, 4 ° C durante 10 min. Guarde el 1,5 ml de sobrenadante como la fracción nucleoplasmic (NPL) a -70 ºC. Resuspender el precipitado en 700 μ l de S2 y tienda como RCF a -70 ºC. </li></ol> 3. Los análisis Western Blot de RCF NOTA: Para el análisis Western Blot de morosidad y RCF fracciones set lado 640 mu l para Npl y 300 μ l de RCF a partir del volumen total obtenido en el paso 2.11. <ol><li> Mezclar 15 μ l de cada fracción subnuclear en 2x tampón de Laemmli (4% SDS, 20% de glicerol, 10% de 2-mercaptoetanol, 0,004% de azul de bromofenol, 0,125 M Tris HCl pH 6,8) y se deja hervir a 95 ºC durante 5 min. Cargar las muestras en una electroforesis en 10% de sodio dodecil sulfato-poliacrilamida gel (SDS-PAGE) gel desnaturalizante y las proteínas separadas durante 1,5 h, a 20 miliamperios (mA). </li><li> Transferencia de proteínas por electrotransferencia durante 1,5 horas a 400 mA en difluoruro de polivinilideno (PVDF) membranas. </li><li> Bloquear la membrana durante 2 horas a RT utilizando leche seca sin grasa 3% en PBS. </li><li> Incubar O / N a 4 ºC con el anticuerpo primario contra la proteína viral de unión al ADN E2A (B6-8 9) a una dilución 1: 500 en leche en polvo PBS / 0,3% sin grasa. </li><li> Membrana Lavar 3 veces con PBS / Tween 20 0,1% durante 10 min. </li><li> Incubar la membrana con un ratón anti IgG secundariatibody acoplado a peroxidasa de rábano picante (HRP) a una dilución 1: 10.000 en PBS durante 2 horas a RT. </li><li> Lavar la membrana 3 veces con PBS / Tween 20 0,1% durante 10 min. </li><li> Desarrollar la membrana mediante un aumento de quimioluminiscencia y películas de rayos X. </li></ol> 4. Viral Detección de ADN en el marco de cooperación regional NOTA: Para el aislamiento de ADN de ambas fracciones de morosidad y RCF, utilice 210 μ l para Npl y 100 μ l de RCF del volumen total obtenido en el paso 2.11. <ol><li> Incubar fracciones sub-nucleares durante 1 hora a 55 ºC con 1 mg / ml de proteinasa K y 0,5% de Tween 20. </li><li> Inactivar proteinasa K mediante incubación de las muestras durante 10 min a 95 ° C. </li><li> Centrifugar las muestras a 20.000 xg, a temperatura ambiente durante 2 min. </li><li> Recoger el SN. Precipitar el DNA con 1/10 de volumen de acetato de sodio 3M y un volumen de isopropanol, O / N a 4 ° C. </li><li> Centrifugar las muestras a 20.000 xg, a temperatura ambiente durante 10 min. </li><li> Deseche la u SNcantar una micropipeta. Lavar el sedimento con etanol al 70% y centrifugar a 20.000 xg, 4 ° C durante 5 min. </li><li> Resuspender el ADN en 10 μ l de 10 mM Tris-HCl pH 7,4 </li><li> Cuantificar el ADN usando un espectrofotómetro mediante la medición de la densidad óptica (DO) a 260 nm. </li><li> Para amplificar el ADN viral, utilice 100 ng de ADN de cada fracción subnuclear en una reacción de PCR estándar usando ADN polimerasa Taq en 25 μ l de volumen de reacción con los cebadores que permiten la amplificación de una región dentro de la unidad de transcripción tardía Major, desde el nucleótido 7273 a nucleótido 7353 (81 pb) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Use las siguientes condiciones de ciclo: desnaturalización inicial de 3 min a 95 ºC, seguido de 20 ciclos de amplificación (1 min a 95 ºC, recocido durante 1 min a 62 ºC y extensión durante 30 segundos a 72 ºC) y una etapa de extensión final de 3 min a 72 ºC. </li><li> Ejecute el producto de PCR en geles de agarosa al 2%, a 90 V. manchas con etidiobromuro de 0,5 μ g / ml concentración final y visualizar el ADN para corroborar el enriquecimiento de ADN viral en el marco de cooperación regional. Maneje bromuro de etidio con extrema precaución y siempre asegúrese de usar guantes, ya que este compuesto es un mutágeno potente. Deseche bromuro de etidio de acuerdo con las directrices institucionales. </li></ol> 5. Late Viral Detección de mRNA en RCF NOTA: Para el aislamiento de ARN de las dos fracciones de morosidad y RCF, utilice 640 μ l para Npl y 300 μ l de RCF a partir del volumen total obtenido en el paso 2.11. <ol><li> Aislar el ARN a partir de fracciones subnuclear utilizando Trizol de acuerdo con las instrucciones del fabricante. Resuspender el ARN en 50 μ l de DEPC (diethilpyrocarbonate) de agua tratada. </li><li> Cuantificar el ARN utilizando un espectrofotómetro para medir la DO a 260 nm (se obtienen aproximadamente 3 μ g). Guarde el ARN en 50 ng / mu l alícuotas a -70 ºC. </li><li> Compruebe ARN purificadopor la ausencia de contaminación de ADN mediante la realización de una reacción de PCR de control en ausencia de transcriptasa inversa (RT), usando 5 ng de ARN total y las condiciones de ciclo descrito en el paso 4.9. <ol><li> Si la contaminación de ADN está ausente no amplicón debe ser producido. Si la contaminación de ADN está presente, incubar las muestras con 10 U de DNasa I, 10 U de inhibidor de RNasa, 0,1 M Tris-HCl pH 8,3, 0,5 M KCl y 15 mM de MgCl 2 durante 30 min a 37 ºC. Proceda para volver a aislar el ARN como en el paso 5.1. </li></ol></li><li> Para analizar mRNA viral asociado al RCF, amplificar 100 ng de RNA de cada fracción subnuclear por RT-PCR usando cebadores diseñados para detectar mRNA tarde adenoviral de diferentes familias de genes (Tabla 1). <ol><li> Para la transcripción inversa (RT), utilice 100 ng de ARN, de cada fracción subnuclear en una reacción estándar utilizando la enzima RT M-MuLV RT en 20 μ l de volumen de reacción durante 1 hora a 42 ºC y 10 min a 70 ºC. </li><li> Para la amplificación, utilizar 1μ l del cDNA en las reacciones de PCR, como en el paso 4.9. Use las siguientes condiciones de ciclo: desnaturalización inicial de 3 min a 95 ºC, seguido de 25 ciclos de amplificación (1 min a 95 ºC, recocido durante 1 min a la temperatura especificada en la Tabla 1 y la extensión durante 30 segundos a 72 ºC) y una paso de extensión final durante 3 minutos a 72 ºC. </li></ol></li><li> Ejecute los productos de RT-PCR en geles de agarosa al 2%, en 90 geles V. mancha con bromuro de etidio a 0,5 μ g / ml concentración final y visualizar corroborar viral asociación finales ARNm al RCF. Maneje bromuro de etidio como se indica en el paso 4.10. </li></ol> 6. La inmunofluorescencia Visualización de RCF NOTA: El equipaje de este procedimiento bajo una campana de flujo laminar para evitar la contaminación de las muestras con las partículas de polvo, y filtrar todas las soluciones antes de su uso. <ol><li> Spot 5 mu l de la fracción RCF obtenido en el paso 2.10 gravectly en un portaobjetos recubiertos con silano. </li><li> Deje que el punto seco durante aproximadamente 5 minutos a temperatura ambiente. </li><li> Re-hidratar lentamente e indirectamente pipetear 500 μ l de PBS en una gota al lado del punto de RCF y dejar que fluya por la inclinación del tobogán. Escurrir el exceso de PBS desde el lado. </li><li> Bloquear cubriendo la muestra con 500 μ l de PBS / 5% de albúmina de suero bovino (BSA) durante 2 horas a RT. </li><li> Lave la diapositiva 3 veces suavemente e indirectamente pipetear 500 l μ de PBS sobre la muestra. Incline la diapositiva para drenar el exceso de PBS. </li><li> Incubar la muestra con el anticuerpo primario contra la proteína de unión al ADN viral E2A (B6-8 9) a una dilución 1: 500 en PBS durante 2 horas a RT. Cubrir la muestra manchada con 20 μ l de la solución de anticuerpo y se incuba en una cámara húmeda para evitar el secado. </li><li> Lavar la muestra 3 veces con PBS / 0,02% de Tween 20 por suavemente e indirectamente pipeteando 500 μ l de PBS sobre la muestra. Incline la diapositiva para drenar el exsolución de lavado proceso. </li><li> Se incuban las muestras con el ratón anti anticuerpo secundario IgG acoplado a un fluoróforo que se excita a 488 nm en una dilución 1: 2000 en PBS, durante 1 hora a 4 ºC. Cubrir la muestra manchada con 20 μ l de la solución de anticuerpo y se incuba en una cámara húmeda para evitar el secado. </li><li> Lavar la muestra 3 veces con PBS / 0,02% de Tween 20 por suavemente e indirectamente pipeteando 500 μ l de PBS sobre la muestra. Incline la diapositiva para drenar el exceso de solución de lavado. </li><li> Cubrir la muestra manchada sobre el portaobjetos con un cubreobjetos usando 2 μ l de PBS / 10% de glicerol como medio de montaje. Selle con esmalte de uñas transparente y almacenar al -20 ºC. </li><li> Analizar las muestras usando un microscopio de fluorescencia, con un objetivo 63x y un 1,4 Apertura numérica (NA) a una longitud de onda de 488 nm. </li></ol>

<ol>
	<li>Doucas, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+replication+is+coupled+with+the+dynamic+properties+of+the+PML+nuclear+structure.">Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.</a> Genes &#38; Dev. 10, 196-207 (1996).</li><li>Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+virus+replication+compartments.">DNA virus replication compartments.</a> J. Virol. 88, 1404-1420 (2014).</li><li>Boon, J. A., Diaz, A., Ahlquist, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+viral+replication+complexes.">Cytoplasmic viral replication complexes.</a> Cell host microbe. 8, 77-85 (2010).</li><li>Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+and+biochemical+characterization+of+the+membranous+hepatitis+C+virus+replication+compartment.">Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.</a> J. Virol. 87, 10612-10627 (2013).</li><li>Busch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Nucleoli.">Isolation of Nucleoli.</a> Exp Cell Res. 24, 150-163 (1963).</li><li>Lam, Y. W., Lyon, C. E., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+isolation+of+Cajal+bodies+from+HeLa+cells.">Large-scale isolation of Cajal bodies from HeLa cells.</a> Mol. Biol. Cell. 13, 2461-2473 (2002).</li><li>Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+nucleolus.">The nucleolus.</a> J Cell Sci. 118, 1335-1337 (2005).</li><li>Groitl, P., Dobner, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+adenovirus+type+5+early+region+1+and+4+virus+mutants.">Construction of adenovirus type 5 early region 1 and 4 virus mutants.</a> Methods Mol Med. 130, 29-39 (2007).</li><li>Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+which+recognize+native+and+denatured+forms+of+the+adenovirus+DNA-binding+protein.">Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein.</a> Virology. 128, 480-484 (1983).</li><li>Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+effects+on+adenovirus+late+gene+expression+of+deleting+the+E1b+55K+protein.">Selective effects on adenovirus late gene expression of deleting the E1b 55K protein.</a> J Gen Virol. 74 (Pt 4), 575-582 (1993).</li><li>Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+E1B+55-kilodalton+protein+is+required+for+both+regulation+of+mRNA+export+and+efficient+entry+into+the+late+phase+of+infection+in+normal+human+fibroblasts.">Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts.</a> J. Virol. 80, 964-974 (2006).</li><li>Castillo-Villanueva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mre11+Cellular+Protein+Is+Modified+by+Conjugation+of+Both+SUMO-1+and+SUMO-2/3+during+Adenovirus+Infection.">The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection.</a> ISRN Virology. 2014, 14 (2014).</li><li>Morris, S. J., Scott, G. E., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+late-phase+infection+is+controlled+by+a+novel+L4+promoter.">Adenovirus late-phase infection is controlled by a novel L4 promoter.</a> J. Virol. 84, 7096-7104 (2010).</li><li>Wright, J., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+adenovirus+5+L4+promoter+is+activated+by+cellular+stress+response+protein+p53.">The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53.</a> J. Virol. 87, 11617-11625 (2013).</li></ol>

The authors have nothing to disclose.

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of th...

Los adenovirus contienen un genoma de doble cadena de ADN que se replica en el núcleo de la célula infectada. Cuando el ADN viral entra en el núcleo, se localiza adyacente a cuerpos nucleares de PML 1. Después de la expresión génica viral temprana, la arquitectura nuclear se reorganiza de manera espectacular, inducir la formación de microambientes virales, denominado compartimentos de replicación viral (RC) 2. Desde adenovirus (Ad) RC son sitios donde la replicación del genoma viral y la expresión de genes tardíos virales tienen lugar, que proporcionan un entorno para el reclutamiento de todos los factores virales y celulares necesarias que participan en estos procesos. Curiosamente, una variedad de proteínas celulares responsables de la respuesta antiviral celular, tales como la respuesta al daño del ADN, la respuesta inmune innata y la supresión de tumores son cooptados a estos sitios virales 2. Hubs reguladoras Por lo tanto, Ad RC se puede considerar que promueven la replicación viral eficaz, mientras que de forma concomitante la regulación de larespuesta antiviral celular, lo que indica que estas estructuras son la clave para la comprensión de las interacciones de células virus-huésped. Sin embargo, los mecanismos moleculares de la formación de RC, su composición y actividades asociadas, son poco conocidos. Adenoviral RC, así como RC de otros virus de ADN que se replican en el núcleo no están asociados a las membranas, en contraste con RC citoplasmática 3. Por otra parte, estas estructuras inducidas por virus son susceptibles de ser compuesto en su totalidad de proteínas y ácidos nucleicos. RC formado en las células infectadas con los virus de ARN (generalmente denominado fábricas víricas) han sido aislados, tomando ventaja de su localización citoplasmática y el estado unido a la membrana, que ha facilitado su morfológica detallada, caracterización funcional y bioquímico 4. Para nuestro conocimiento, nuclear viral RC no se han aislado, tal vez debido a la complejidad de la arquitectura nuclear y la ausencia de m intranuclearembranes que facilitarían su aislamiento. Su estudio se ha basado más bien en microscopía de inmunofluorescencia, FISH y microscopía electrónica de transmisión. Sin embargo, a pesar de las complicaciones inherentes a aislar estructuras subnuclear, otros ámbitos nucleares como nucleolos y Cuerpos de Cajal se han aislado antes de 5,6. Desde nucleolos y RC están ambas compuestas de proteínas y ácidos nucleicos, y tienen un diámetro entre 0.5 - 5 micras, la hipótesis de que RC también debe ser susceptible de aislamiento. Por lo tanto, con el fin de caracterizar con más precisión la composición molecular y funciones asociadas a RC, establecimos un nuevo método para aislar fracciones enriquecidas con subnuclear RC. Con este fin, hemos preparado fracciones sub-nuclear utilizando gradientes de velocidad y cojines de sacarosa similares a los procedimientos utilizados para aislar nucleolos 7 u otros dominios nucleares 6 y establecimos un sistema libre de células que permite el estudio de la composición molecular y actividades asociadas deRC. Por tanto, esta técnica debe avanzar en la comprensión de las interacciones celulares virus-huésped y representa una poderosa herramienta que también debe facilitar el análisis detallado de RC de otros virus que se replican en el núcleo e inducir la formación de compartimentos de replicación de dimensiones similares a las formadas en adenovirus las células infectadas, como, herpesvirus, papilomavirus o poliomavirus.

<table border="0">
	<tbody>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>12100-046</td>
			<td>Warm in 37 &#186;C water bath before use</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Gibco</td>
			<td>12484-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose, Ultra Pure</td>
			<td>Research Organics</td>
			<td>0928S</td>
			<td>Prepare a 2.55 M stock solution and store at 4 &#186;C</td>
		</tr>
		<tr>
			<td>Dounce homogenizer</td>
			<td>Kontess Glass Company</td>
			<td>884900-0000</td>
			<td></td>
		</tr>
		<tr>
			<td>Branson 1800 Ultrasonic Bath</td>
			<td>Branson</td>
			<td>Z769533&#160;SIGMA</td>
			<td>Turn on 15 min before use.</td>
		</tr>
		<tr>
			<td>Peroxidase AffiniPure F(ab&#39;)&#8322; Fragment Goat Anti-Mouse IgG (H+L)</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-036-003</td>
			<td>Use at a 1:10,000 dilution in PBS/0.03% non-fat milk</td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate</td>
			<td>Life Technologies</td>
			<td>A-21121</td>
			<td>Use at a 1:2,000 dilution in PBS</td>
		</tr>
		<tr>
			<td>Silane-Prep Slides</td>
			<td>Sigma</td>
			<td>S4651-72EA</td>
			<td>Open in a laminar flow cabinet</td>
		</tr>
		<tr>
			<td>SuperSignal West Pico Chemiluminescent Substrate</td>
			<td>Pierce ThermoScientific</td>
			<td>34080</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of viral replication compartment-enriched sub-nuclear fractions from adenovirus-infected normal human cells

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

Puesto que los compartimentos de replicación viral (RC) son estructuras inducidas por virus subnuclear compuestas de proteínas y ácidos nucleicos, similar a otros dominios nucleares, que resultó ser susceptible de aislamiento mediante gradientes de velocidad en base a características bioquímicas. Los pasos críticos en el protocolo de fraccionamiento se ilustran en la figura 1. En cada paso las muestras deben ser supervisados ​​por microscopía de campo claro para garantizar la integridad de l...

Watch this Scientific Journal Video about Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells at JoVE.com

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

Aislamiento de fracciones Sub-nuclear enriquecido compartimentos viral de replicación de infectados por adenovirus células normales Humanos

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments ...

isolation-viral-replication-compartment-enriched-sub-nuclear

Research

JoVE Journal

Immunology and Infection

8.7K vistas.  Universidad Autónoma del Estado de Morelos. We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC. 

Video: Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

El aislamiento de las variantes de los virus de ARN de fidelidad y caracterización de la frecuencia de mutación de virus

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Investigación

Inmunología e Infección

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Preparación de ADN viral de nucleocápside

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

El establecimiento de un cultivo líquido cubierto de las vías respiratorias humanas epiteliales polarizadas Calu-3 células para estudiar la respuesta del huésped celular a patógenos respiratorios<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Isolation of Myeloid Dendritic Cells and Epithelial Cells from Human Thymus

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen presenting cell (APC) types found in a normal thymus and it is well established that they play distinct roles during thymic selection. These cells are localized in distinct microenvironments in the thymus and each APC type makes up only a minor population of cells. To further understand the biology of these cell types, characterization of these cell populations is highly desirable but due to their low frequency, isolation of any of these cell types requires an efficient and reproducible procedure. This protocol details a method to obtain cells suitable for characterization of diverse cellular properties. Thymic tissue is mechanically disrupted and after different steps of enzymatic digestion, the resulting cell suspension is enriched using a Percoll density centrifugation step. For isolation of myeloid DC (CD11c+), cells from the low-density fraction (LDF) are immunoselected by magnetic cell sorting. Enrichment of TEC populations (mTEC, cTEC) is achieved by depletion of hematopoietic (CD45hi) cells from the low-density Percoll cell fraction allowing their subsequent isolation via fluorescence activated cell sorting (FACS) using specific cell markers. The isolated cells can be used for different downstream applications.

This protocol details a method to isolate antigen presenting cells from human thymus via different steps of enzymatic digestion of the tissue followed by density centrifugation of the single cell suspension and finally magnetic and/or FACS sorting of the cell populations of interest.

Aislamiento de células dendríticas mieloides y células epiteliales de timo humano

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these glycoprotein &#8216;spikes&#8217; is often technically challenging but important for understanding viral pathogenesis and in drug design. Here, a protocol is presented for viral spike structure determination through computational averaging of electron cryo-tomography data. Electron cryo-tomography is a technique in electron microscopy used to derive three-dimensional tomographic volume reconstructions, or tomograms, of pleomorphic biological specimens such as membrane viruses in a near-native, frozen-hydrated state. These tomograms reveal structures of interest in three dimensions, albeit at low resolution. Computational averaging of sub-volumes, or sub-tomograms, is necessary to obtain higher resolution detail of repeating structural motifs, such as viral glycoprotein spikes. A detailed computational approach for aligning and averaging sub-tomograms using the Jsubtomo software package is outlined. This approach enables visualization of the structure of viral glycoprotein spikes to a resolution in the range of 20-40 &#197; and study of the study of higher order spike-to-spike interactions on the virion membrane. Typical results are presented for Bunyamwera virus, an enveloped virus from the family Bunyaviridae. This family is a structurally diverse group of pathogens posing a threat to human and animal health.

An approach is presented for determining structures of viral membrane glycoprotein complexes using a combination of electron cryo-tomography and sub-tomogram averaging with the computational package Jsubtomo.

Un promedio de glicoproteína de la envoltura viral Espigas de Electron cryotomography reconstrucciones utilizando Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Isolation of Leukocytes from the Human Maternal-fetal Interface

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua parietalis). This interface is the anatomical site of contact between maternal and fetal tissues; therefore, it is an immunological site of action during pregnancy. Infiltrating leukocytes at the maternal-fetal interface play a central role in implantation, pregnancy maintenance, and timing of delivery. Therefore, phenotypic and functional characterizations of these leukocytes will provide insight into the mechanisms that lead to&#160;pregnancy disorders. Several protocols have been described in order to isolate infiltrating leukocytes from the decidua basalis and decidua parietalis; however, the lack of consistency in the reagents, enzymes, and times of incubation makes it difficult to compare these results. Described herein is&#160;a novel approach that combines the use of gentle mechanical and enzymatic dissociation techniques to preserve the viability and integrity of extracellular and intracellular markers in leukocytes isolated from the human tissues at the maternal-fetal interface. Aside from immunophenotyping, cell culture, and cell sorting, the future applications of this protocol are numerous and varied. Following this protocol, the isolated leukocytes can be used to determine DNA methylation, expression of target genes, in vitro leukocyte functionality (i.e., phagocytosis, cytotoxicity, T-cell proliferation, and plasticity, etc.), and the production of reactive oxygen species at the maternal-fetal interface. Additionally, using the described protocol, this laboratory has been able to describe new and rare leukocytes at the maternal-fetal interface.

Described herein is a protocol to isolate and further study the infiltrating leukocytes of the decidua basalis and decidua parietalis - the human maternal-fetal interface. This protocol maintains the integrity of cell surface markers and yields enough viable cells for downstream applications as proven by flow cytometry analysis.

Aislamiento de leucocitos de la interfaz humana Materno-fetal

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua ...

Isolation of Sertoli Cells and Peritubular Cells from Rat Testes

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of puberty - more than ten years after the establishment of systemic immune tolerance. Spermatogenic cells express a number of proteins that may be seen as non-self by the immune system. The testis must then be able to establish tolerance to these neo-antigens on the one hand but still be able to protect itself from infections and tumor development on the other hand. Therefore the testis is one of a few immune privileged sites in the body that tolerate foreign antigens without evoking a detrimental inflammatory immune response. Sertoli cells play a key role for the maintenance of this immune privileged environment of the testis and also prolong survival of cotransplanted cells in a foreign environment. Therefore primary Sertoli cells are an important tool for studying the immune privilege of the testis that cannot be easily replaced by established cell lines or other cellular models. Here we present a detailed and comprehensive protocol for the isolation of Sertoli cells - and peritubular cells if desired - from rat testes within a single day.

Primary Sertoli cells are required for studying testis-immune privilege, signal transduction during inflammation or infection, and utilization of their immunoprotective properties. Here we describe an enzyme-based protocol for the isolation of highly purified primary Sertoli cells and peritubular cells from rat testes.

Aislamiento de células de Sertoli y peritubulares Las células de testículos de ratas

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the person-to-person route or indirectly through environmental surfaces or food, contaminated fomites and inanimate surfaces are important vehicles for the spread of the virus during norovirus outbreaks.
We developed and evaluated a protocol using macrofoam swabs for the detection and typing of human noroviruses from hard surfaces. Compared with fiber-tipped swabs or antistatic wipes, macrofoam swabs allow virus recovery (range 1.2-33.6%) from toilet seat surfaces of up to 700 cm2. The protocol includes steps for the extraction of the virus from the swabs and further concentration of the viral RNA using spin columns. In total, 127 (58.5%) of 217 swab samples that had been collected from surfaces in cruise ships and long-term care facilities where norovirus gastroenteritis had been reported tested positive for GII norovirus by RT-qPCR. Of these 29 (22.8%) could be successfully genotyped. In conclusion, detection of norovirus on environmental surfaces using the protocol we developed may assist in determining the level of environmental contamination during outbreaks as well as detection of virus when clinical samples are not available; it may also facilitate monitoring of effectiveness of remediation strategies.

A macrofoam based sampling methodology was developed and evaluated for the detection and quantification of norovirus on environmental hard surfaces.

Método de muestreo hisopo para la Detección de norovirus humano en superficies

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

Isolation of Dendritic Cells from the Human Female Reproductive Tract for Phenotypical and Functional Studies

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low numbers of DCs present per tissue. Yet, as the phenotype and function of DCs is modified by the tissue environment, it is necessary to analyze tissue resident DC populations, since blood derived DCs incompletely reflect the complexities of DCs in tissues. Here we present a protocol to isolate DCs from the human female reproductive tract (FRT) using hysterectomy specimens that allows both phenotypical and functional analyses. The protocol consists of tissue digestion to generate a single cell mixed cell suspension, followed by positive magnetic bead selection. Our tissue digestion protocol does not cleave surface markers, which allows phenotypical and functional analysis of DCs in the steady state, without overnight incubation or cell activation. This protocol can be adapted for the isolation of other immune cell types or isolation of DCs from other tissues.

We describe here a method to isolate and purify dendritic cells from different anatomical compartments in the human female reproductive tract for the evaluation of their phenotypical and functional characteristics. This method can be adapted to isolate other immune cells or dendritic cells from other mucosal tissues.

Aislamiento de las células dendríticas del tracto reproductivo femenino humano estudios fenotípica y funcional

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor response to insulin, local hypoxia, and inflammation. By stimulating the differentiation of functional white adipocytes from progenitors, radical hypertrophy of the adipocyte population can be prevented and, consequently, the metabolic health of adipose tissue can be improved along with a reduction of inflammation. Also, by stimulating a differentiation of beige/brown adipocytes, the total body energy expenditure can be increased, resulting in weight loss. This approach could prevent the development of obesity co-morbidities such as type 2 diabetes and cardiovascular disease.
This paper describes the isolation, expansion, and differentiation of white and beige adipocytes from a subset of human adipose tissue endothelial cells that co-express the CD31 and CD34 markers. The method is relatively cheap and is not labor-intensive. It requires access to human adipose tissue and the subcutaneous depot is suitable for sampling. For this protocol, fresh adipose tissue samples from morbidly obese subjects [body mass index (BMI) &#62;35] are collected during bariatric surgery procedures. Using a sequential immunoseparation from the stromal vascular fraction, enough cells are produced from as little as 2&#8211;3 g of fat. These cells can be expanded in culture over 10&#8211;14 days, can be cryopreserved, and retain their adipogenic properties with passaging up to passage 5&#8211;6. The cells are treated for 14 days with an adipogenic cocktail using a combination of human insulin and the PPAR&#947; agonist-rosiglitazone.
This methodology can be used for obtaining proof of concept experiments on molecular mechanisms that drive adipogenic responses in adipose endothelial cells, or for screening new drugs that can enhance the adipogenic response directed either towards white or beige/brown adipocyte differentiation. Using small subcutaneous biopsies, this methodology can be used to screen out non-responder subjects for clinical trials aimed to stimulate beige/brown and white adipocytes for the treatment of obesity and co-morbidities.

The differentiation of white and beige adipocytes from adipose tissue vascular progenitors bears potential for metabolic improvement in obesity. We describe protocols for a CD34+CD31+ endothelial cell isolation from human fat and for a subsequent in vitro expansion and differentiation into white and beige adipocytes. Several downstream applications are discussed.

Aislamiento, expansión y Adipogenic inducción de CD31 + CD34 + células endoteliales del humano omentales y subcutáneos de tejido adiposo

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...