This work was supported by grants from CONACyT-SEP (SEP-2008-84582; CB-2011-01-168497) and Promep-SEP for R.A.G.; P.H. received a scholarship from CONACyT (447442).

תרבית תאי 1. HFF ומודעות-זיהום <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הפץ וירוס Ad5 WT בmonolayers של HEK-293 תאים וכיילו כיחידות ניאון יוצרים (FFU) בתאי HFF כפי שתואר לעיל 8. </li><li style=";text-align:right;direction:rtl"> לגדול fibroblasts העורלה האדם (HFF) ב 10 מיליליטר של DMEM 10% שור עוברי סרום (FBS) במנות מ&quot;מ סטרילי תרבות 100 על 37 מעלות צלזיוס, 5% CO / 2 בחממה humidified. לקבוע את המספר הסלולרי באמצעות תא נויבאואר על ידי ספירת תאים בארבעת סטים של 16 מ&quot;ר. מספר התאים למ&quot;ל מתקבל על ידי חישוב מספר התאים הממוצע בארבעת סטים של 16 מ&quot;ר והכפלת מספר זה ב -10 4. עבור כל זיהום שלאחר זמן הכלול בשלב 1.3, להשתמש 1 x 10 7 תאי HFF. </li><li style=";text-align:right;direction:rtl"> מוק להדביק או להדביק תאי HFF עם סוג אדנווירוס 5 (Ad5) wild-type (WT) (H5pg4100 8) במנות בתרבית רקמת 100 מ&quot;מ באמצעות 1 מיליליטר של Ad5 בDMEM לכל צלחת במשרד פנים של 30 פוקוס יצירת יחידה, או FFU , לכל תא. דגירה עבור שעה 2 באהחממת umidified תרבית תאים על 37 מעלות צלזיוס, 5% CO 2, נדנדה בזהירות את המנות בכל 15 דקות על מנת להבטיח הפצה הומוגנית של הבידוד הווירוס על התאים. לאחר פרק זמן זה, להסיר את המדיום ולהוסיף DMEM הטרי בתוספת 10% FBS ו דגירה של 16, 24 או 36 שעות בתרבית תאי חממת humidified על 37 מעלות צלזיוס, 5% CO 2. המשך לשלב 2.1. </li></ol> 2. הכנת שברים תת-גרעיניים מועשר בAdenovirus RC <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> נגוע Ad5 הקציר או תאי HFF נגועים מדומים עם scrapper תא ולאסוף את התאים בצינורות צנטריפוגות סטרילי. לקבוע את המספר הסלולרי כמו בשלב 1.2. להשתמש 1 x 10 7 תאים לכל זיהום שלאחר זמן מסוים בשלב 1.3. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה התאים ב 220 XG, 4 מעלות צלזיוס למשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> Resuspend התא גלולה בPBS קר כקרח (137 מ&quot;מ NaCl, 2.7 מ&quot;מ KCl, 10 מ&quot;מ Na 2 4 HPO ו -1.8 מ&quot;מ KH 2 PO 4). תא גלולה לשטוףשל 3 פעמים באמצעות 5 מיליליטר של PBS קר כקרח לכל לשטוף. לצורך כך, צנטריפוגה התאים ב 220 XG, 4 מעלות צלזיוס למשך 5 דקות, למזוג וזורקים supernatant (SN), וresuspend התא גלולה על ידי pipetting העדין. </li><li style=";text-align:right;direction:rtl"> לשבש את קרום הפלזמה, resuspend התא גלולה ב700 μ l של חיץ hypotonic קר כקרח (10 מ&quot;מ HEPES pH 7.9, 10 מ&quot;מ KCl, 1.5 מ&quot;מ MgCl 2, 0.5 מ&quot;מ DTT, 20 μ g / ml phenylmethylsulfonyl פלואוריד (PMSF) , תערובת של ציסטאין, סרין, תראונין מעכבי פרוטאז וaspartyl כולל 10 גרם / מיליליטר מעכבי טריפסין לבלב שור, 10 גר &#39;/ מיליליטר pepstatin μ μ ו -10 גר&#39; / מיליליטר -acetyl-L-leucyl-L-leucyl-L N μ -argininal) ולתת לתאים להתנפח על קרח 3 שעות. </li><li style=";text-align:right;direction:rtl"> Lyse התאים באמצעות homogenizer עם העלי טפלון סוג רפוי. בצע 80 dounce שבץ ודגימות צג כל 20 משיכות על ידי מיקרוסקופ שדה הבהיר כדי להבטיח שכל התאים כבר lysed, אבל שיש לי הגרעינים nםוריה נפגע או מקרע. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה homogenate התא ב 300 XG, 4 מעלות צלזיוס למשך 5 דקות. אחסן את SN כחלק cytoplasmic ב -20 מעלות צלזיוס בצינור צנטריפוגות. </li><li style=";text-align:right;direction:rtl"> כדי להסיר סלולרית פסולת מגרעינים, resuspend גלולה ב750 μ l של פתרון 1 (S1) (0.25 מ &#39;סוכרוז, 10 מ&quot;מ MgCl 2 20 μ g מעכבים / מיליליטר PMSF, תערובת של ציסטאין, סרין, תראונין ופרוטאז aspartyl כולל 10 μ g / ml מעכב שור לבלב טריפסין, 10 μ g מיליליטר pepstatin / 10 וμ g / ml N -acetyl-L-leucyl-L-leucyl-L-argininal) ושכבה מעל נפח שווה של פתרון 2 (S2) (0.35 מ &#39;סוכרוז, 0.5 מ&quot;מ MgCl 2, 20 μ g / ml PMSF, תערובת של ציסטאין, סרין, תראונין מעכבי פרוטאז וaspartyl כוללים 10 μ g / מיליליטר מעכבי טריפסין לבלב שור, 10 μ g / ml pepstatin ו -10 μ g / ml N -acetyl-L-leucyl-L-leucyl-L-argininal). Centrifuge ב1,400 XG, 4 מעלות צלזיוס למשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> מחק את SN באמצעות micropipette. הימנע להפריע גלולה. </li><li style=";text-align:right;direction:rtl"> Resuspend גלולה המכילה גרעינים מבודדים ב750 μ l של S2. </li><li style=";text-align:right;direction:rtl"> כדי לבודד שברים subnuclear מועשרים באדנווירוס RC (RCF), sonicate resuspended גרעינים עם אמבטיה קולית, באמצעות שתי פעימות 5 דקות, או עד שכל הגרעינים lysed כפי שנצפו על ידי מיקרוסקופ שדה הבהיר. השתמש בקרח באמבטיה קולית לפי צורך כדי לשמור על דגימות באו מתחת ל -4 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> שכבת גרעיני sonicated על נפח שווה של פתרון 3 (S3) (0.88 M סוכרוז, 0.5 מ&quot;מ MgCl 2) ו צנטריפוגות ב3,000 XG, 4 מעלות צלזיוס במשך 10 דקות. אחסן את supernatant 1.5 מיליליטר כחלק nucleoplasmic (NPL) ב -70 מעלות צלזיוס. Resuspend גלולה ב700 μ l של S2 וחנות כRCF ב -70 מעלות צלזיוס. </li></ol> 3. ניתוח המערבי כתם של RCF הערה: לניתוח המערבי כתם של שברים של NPL וRCFet הצידה 640 μ l לNPL ו -300 μ l לRCF מהנפח הכולל שהושג בשלב 2.11. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מערבבים 15 μ l של כל חלק subnuclear ב2x Laemmli חיץ (4% SDS, גליצרול 20%, 10% 2-mercaptoethanol, bromophenol 0.004% כחולים, 0.125 M טריס HCl pH 6.8) ורתיחה ב 95 מעלות צלזיוס למשך 5 דקות. טען את הדגימות באלקטרופורזה נתרן 10% dodecyl סולפט-polyacrylamide ג&#39;ל (SDS-PAGE) denaturing ג&#39;ל וחלבונים נפרדים עבור 1.5 שעות, בטמפרטורה של 20 milliamperes (MA). </li><li style=";text-align:right;direction:rtl"> העבר את החלבונים על ידי electroblotting תמורת 1.5 שעות ב 400 מילי-אמפר על difluoride polyvinylidene ממברנות (PVDF). </li><li style=";text-align:right;direction:rtl"> לחסום קרום לשעה 2 ב RT באמצעות חלב יבש ללא שומן 3% ב- PBS. </li><li style=";text-align:right;direction:rtl"> דגירה O / N במעלות צלזיוס 4 עם נוגדן ראשוני נגד חלבון נגיפי E2A מחייב DNA (B6-8 9) בדילול 1: 500 בחלב ללא שומן יבש / 0.3% PBS. </li><li style=";text-align:right;direction:rtl"> קרום לשטוף 3 פעמים עם PBS / 0.1% Tween 20 במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> דגירה הממברנה עם IgG נגד עכבר המשניtibody מצמידים peroxidase סוס-צנון (HRP) בדילול 1: 10,000 ב PBS עבור שעה 2 ב RT. </li><li style=";text-align:right;direction:rtl"> שטוף את הקרום 3 פעמים עם PBS / 0.1% Tween 20 במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> לפתח הקרום באמצעות chemiluminescence משופרת וצילומי רנטגן. </li></ol> 4. ויראלי DNA איתור בRCF הערה: לבידוד DNA משני השברים NPL וRCF, להשתמש 210 μ l לNPL וμ 100 ליטר לRCF מהנפח הכולל שהושג בשלב 2.11. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> דגירה שברים תת-גרעיניים עבור שעה 1 ב 55 מעלות צלזיוס עם 1 מ&quot;ג / מיליליטר של proteinase K ו 0.5% Tween 20. </li><li style=";text-align:right;direction:rtl"> להשבית K proteinase ידי דוגרים הדגימות במשך 10 דקות על 95 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה דגימות ב20,000 XG, ב RT למשך 2 דקות. </li><li style=";text-align:right;direction:rtl"> לאסוף SN. להאיץ את ה- DNA עם 1/10 נפח של נתרן אצטט 3M ונפח אחד של isopropanol, O / N ב 4 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה דגימות ב20,000 XG, ב RT במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> מחק את u SNלשיר micropipette. שטוף את הכדור עם 70% אתנול ו צנטריפוגות ב 20,000 XG, 4 מעלות צלזיוס למשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> Resuspend DNA ב 10 μ l 10 מ&quot;מ טריס-HCl pH 7.4 </li><li style=";text-align:right;direction:rtl"> לכמת DNA באמצעות ספקטרופוטומטר על ידי מדידת הצפיפות האופטית (OD) ב 260 ננומטר. </li><li style=";text-align:right;direction:rtl"> כדי להגביר DNA הנגיפי, להשתמש של DNA 100 ng כל חלק מן subnuclear בתגובת PCR סטנדרטית באמצעות פולימראז תקי DNA ב -25 μ l של נפח תגובה עם פריימרים המאפשרים ההגברה של אזור בתוך יחידת השעתוק המאוחר סרן, מנוקלאוטיד 7273 ל נוקלאוטיד 7353 (81 נ&quot;ב) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). השתמש בתנאים הבאים המחזור: denaturation הראשוני 3 דקות ב 95 מעלות צלזיוס, ואחריו 20 מחזורים של הגברה (1 דקות ב 95 מעלות צלזיוס, חישול 1 דקות במעלות צלזיוס 62 והארכה למשך 30 שניות על 72 מעלות צלזיוס) וצעד ארכה סופי ל 3 דקות ב 72 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> הפעל את מוצר ה- PCR בג&#39;ל agarose 2%, ב -90 V. כתם עם ethidiumרומיד ברמה של 0.5 μ / מיליליטר ריכוז סופי גרם ולדמיין DNA כדי לאשש העשרת ה- DNA נגיפית בRCF. ידית ברומיד בזהירות רבה ותמיד לוודא ללבוש כפפות, כמתחם הזה הוא mutagen חזק. השלך ברומיד על פי הנחיות מוסדיות. </li></ol> 5. ויראלי המאוחר mRNA איתור בRCF הערה: לבידוד RNA משני השברים NPL וRCF, להשתמש 640 μ l לNPL ו -300 μ l לRCF מהנפח הכולל שהושג בשלב 2.11. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לבודד RNA משברי subnuclear באמצעות Trizol פי עם הוראות היצרן. Resuspend RNA ב -50 μ l של DEPC מים -treated (diethilpyrocarbonate). </li><li style=";text-align:right;direction:rtl"> לכמת את RNA באמצעות ספקטרופוטומטר למדוד את OD ב 260 ננומטר (ז כ 3 μ מתקבל). אחסן את RNA ב -50 ng / μ aliquots l ב -70 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> בדוק RNA המטוהרעל היעדריו של זיהום הדנ&quot;א על ​​ידי ביצוע תגובת PCR שליטה בהעדר טרנסקריפטאז (RT), באמצעות 5 ננוגרם של רנ&quot;א הכל ותנאי המחזור מתואר בשלב 4.9. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> אם זיהום הדנ&quot;א נעדר צריך להיות מיוצר לא amplicon. אם זיהום הדנ&quot;א הוא הווה, דגירה הדגימות עם 10 U DNase אני, 10 U של מעכב RNase, 0.1 מ &#39;טריס-HCl pH 8.3, 0.5 M KCl ו -15 מ&quot;מ MgCl 2 למשך 30 דקות ב 37 מעלות צלזיוס. המשך מחדש לבודד RNA כמו בשלב 5.1. </li></ol></li><li style=";text-align:right;direction:rtl"> כדי לנתח mRNA ויראלי הקשורים לRCF, להגביר של RNA 100 ng כל חלק מן subnuclear על ידי RT-PCR באמצעות פריימרים נועדו לזהות mRNA מאוחר adenoviral ממשפחות גנים שונים (טבלה 1). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לשעתוק לאחור (RT), להשתמש של RNA 100 ng, מכל חלק subnuclear בתגובת RT סטנדרטי באמצעות אנזים M-MuLV RT 20 μ l של נפח תגובה עבור שעה 1 ב 42 מעלות צלזיוס ו -10 דקות ב -70 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> להגברה, להשתמש 1l μ של cDNA בPCR תגובות, כמו בשלב 4.9. השתמש בתנאים הבאים המחזור: denaturation הראשוני 3 דקות ב 95 מעלות צלזיוס, ואחריו 25 מחזורים של הגברה (1 דקות ב 95 מעלות צלזיוס, חישול 1 דקות בטמפרטורה שצוינה בטבלה 1 והארכה למשך 30 שניות על 72 מעלות צלזיוס) ו צעד ארכה סופי 3 דקות ב 72 מעלות צלזיוס. </li></ol></li><li style=";text-align:right;direction:rtl"> הפעל את מוצרי RT-PCR בג&#39;ל agarose 2%, ב 90 ג &#39;ו&#39; כתם עם ברומיד ברמה של 0.5 μ / מיליליטר ריכוז סופי גרם ולדמיין לאשש עמותת mRNA מאוחר נגיפית לRCF. ידית ברומיד כפי שצוין בשלב 4.10. </li></ol> 6. ויזואליזציה Immunofluorescence של RCF הערה: לעסוק בהליך זה תחת הזרימה למינרית כדי למנוע זיהום של הדגימות עם כל חלקיקי אבק, ולסנן את כל הפתרונות לפני השימוש. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מקום 5 μ l של חלק RCF שהושג בשלב 2.10 חמוריםctly בשקופית מצופה silane. </li><li style=";text-align:right;direction:rtl"> בואו יבש מקום לכ -5 דקות ב RT. </li><li style=";text-align:right;direction:rtl"> Re-מימה ידי לאט ובעקיפין pipetting 500 ליטר μ של PBS בירידה ליד מקום RCF ולתת לה לזרום על ידי הטיית השקופיות. מסננים את PBS העודף מהצד. </li><li style=";text-align:right;direction:rtl"> בלוק על ידי כיסוי המדגם עם 500 μ l של / 5% אלבומין בסרום שור PBS (BSA) לשעה 2 ב RT. </li><li style=";text-align:right;direction:rtl"> לשטוף את השקופית 3 פעמים על ידי בעדינות ובעקיפין pipetting 500 ליטר μ של PBS על המדגם. הטה את השקופית כדי לנקז את PBS העודף. </li><li style=";text-align:right;direction:rtl"> דגירה המדגם עם נוגדן ראשוני נגד החלבון הנגיפי E2A מחייב DNA (B6-8 9) בדילול 1: 500 ב PBS עבור שעה 2 ב RT. מכסה את המדגם הבחין עם 20 μ l של פתרון נוגדן דגירה בתא לח כדי למנוע התייבשות. </li><li style=";text-align:right;direction:rtl"> לשטוף את המדגם 3 פעמים עם PBS Tween / 0.02% 20 על ידי בעדינות ובעקיפין pipetting 500 μ l של PBS על המדגם. הטה את השקופית כדי לנקז את לשעברפתרון לשטוף סס. </li><li style=";text-align:right;direction:rtl"> דגירה הדגימות עם נוגדן אנטי עכבר IgG המשני מצמידים את fluorophore שהלהיב ב 488 ננומטר בדילול 1: 2,000 ב PBS, עבור שעה 1 ב 4 מעלות צלזיוס. מכסה את המדגם הבחין עם 20 μ l של פתרון נוגדן דגירה בתא לח כדי למנוע התייבשות. </li><li style=";text-align:right;direction:rtl"> לשטוף את המדגם 3 פעמים עם PBS Tween / 0.02% 20 על ידי בעדינות ובעקיפין pipetting 500 μ l של PBS על המדגם. הטה את השקופית כדי לנקז את הפתרון לשטוף העודף. </li><li style=";text-align:right;direction:rtl"> מכסה את המדגם הבחין בשקופית עם coverslip באמצעות 2 μ l גליצרול / 10% PBS כהרכבה בינונית. חותם עם לק ברור וחנות אל -20 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> ניתוח הדגימות באמצעות מיקרוסקופ פלואורסצנטי, עם מטרת 63x ומספרי צמצם 1.4 (NA) באורך גל של 488 ננומטר. </li></ol>

<ol>
	<li>Doucas, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+replication+is+coupled+with+the+dynamic+properties+of+the+PML+nuclear+structure.">Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.</a> Genes &#38; Dev. 10, 196-207 (1996).</li><li>Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+virus+replication+compartments.">DNA virus replication compartments.</a> J. Virol. 88, 1404-1420 (2014).</li><li>Boon, J. A., Diaz, A., Ahlquist, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+viral+replication+complexes.">Cytoplasmic viral replication complexes.</a> Cell host microbe. 8, 77-85 (2010).</li><li>Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+and+biochemical+characterization+of+the+membranous+hepatitis+C+virus+replication+compartment.">Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.</a> J. Virol. 87, 10612-10627 (2013).</li><li>Busch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Nucleoli.">Isolation of Nucleoli.</a> Exp Cell Res. 24, 150-163 (1963).</li><li>Lam, Y. W., Lyon, C. E., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+isolation+of+Cajal+bodies+from+HeLa+cells.">Large-scale isolation of Cajal bodies from HeLa cells.</a> Mol. Biol. Cell. 13, 2461-2473 (2002).</li><li>Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+nucleolus.">The nucleolus.</a> J Cell Sci. 118, 1335-1337 (2005).</li><li>Groitl, P., Dobner, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+adenovirus+type+5+early+region+1+and+4+virus+mutants.">Construction of adenovirus type 5 early region 1 and 4 virus mutants.</a> Methods Mol Med. 130, 29-39 (2007).</li><li>Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+which+recognize+native+and+denatured+forms+of+the+adenovirus+DNA-binding+protein.">Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein.</a> Virology. 128, 480-484 (1983).</li><li>Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+effects+on+adenovirus+late+gene+expression+of+deleting+the+E1b+55K+protein.">Selective effects on adenovirus late gene expression of deleting the E1b 55K protein.</a> J Gen Virol. 74 (Pt 4), 575-582 (1993).</li><li>Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+E1B+55-kilodalton+protein+is+required+for+both+regulation+of+mRNA+export+and+efficient+entry+into+the+late+phase+of+infection+in+normal+human+fibroblasts.">Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts.</a> J. Virol. 80, 964-974 (2006).</li><li>Castillo-Villanueva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mre11+Cellular+Protein+Is+Modified+by+Conjugation+of+Both+SUMO-1+and+SUMO-2/3+during+Adenovirus+Infection.">The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection.</a> ISRN Virology. 2014, 14 (2014).</li><li>Morris, S. J., Scott, G. E., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+late-phase+infection+is+controlled+by+a+novel+L4+promoter.">Adenovirus late-phase infection is controlled by a novel L4 promoter.</a> J. Virol. 84, 7096-7104 (2010).</li><li>Wright, J., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+adenovirus+5+L4+promoter+is+activated+by+cellular+stress+response+protein+p53.">The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53.</a> J. Virol. 87, 11617-11625 (2013).</li></ol>

The authors have nothing to disclose.

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of the procedure that require standardization depending on the cell type used are: i) standardization of the times used for cell swelling to avoid disruption of nuclei; ii) formation of the sucrose gradients so that fractions can be properly separated; iii) constant monitoring of the samples throughout the procedure by bright field microscopy; iv) sonication time and intensity to ensure that all nuclei are lysed but RC are not disrupted; v) all fractionation steps should be carried out on ice to avoid disruption of nuclear structures. 
Limitations of the technique that can be encountered or can be anticipated are: i) that nucleoli and perhaps other subnuclear structures or domains that share similar dimensions and biochemical composition are coisolated in the RC fraction, making the relative abundance of replication compartments versus other similar nuclear bodies variable depending on the virus, cell type and time post-infection used for their isolation; ii) it is possible that just as the size and composition of RC changes as the replication cycle of the virus progresses, the compactness of the RC particles may also change, making it necessary to perform experiments designed to determine detailed ultrastructural changes of the RC particles at different times post-infection to evaluate not only changes in the particles composition and activities, but whether their stability may vary. While these issues may limit the characterization of RC composition and activities at various different times post-infection, as less stable RC obtained by this procedure may not recapitulate their counterpart in the infected cell nucleus, such limitations may be overcome by using higher multiplicities of infection or by determining the times post-infection at which viral RC have attained a minimum size and abundance in the infected cell nucleus. These potential limitations notwithstanding, the technique reported here provides several advantages over the analysis that has hitherto solely relied on microscopy; namely that the precise biochemical and functional analysis of RC can be performed using this novel approach. 
We show here that the RC-fractions (RCf) obtained are enriched with bona fide RC markers, such as the viral E2-72K DBP protein, viral DNA and RNA. Using biochemical analysis by immunoblotting and PCR, we have confirmed that this approach facilitates the detailed analysis of components and activities associated to RC and should help unravel molecular mechanisms that regulate virus-host cell interactions in the infected-cell nucleus. 
It is well established that DNA replication, transcription and post-transcriptional processing of viral late mRNA are closely associated to viral replication compartments, events that lead to viral progeny production2,11,12. In adenovirus-infected cells the onset of viral DNA replication marks the transition to the late phase of infection and results in the activation of the Major Late promoter, which directs the production of high quantities of viral late transcripts. However, the L4 genes are expressed through a novel promoter (L4P) that is independent from the MLP13,14. Besides this complex program of late promoter activation, the selection of 3&#8217; splice sites for longer introns is progressively favored as the late phase proceeds. In addition, production of these transcripts is regulated by their selective release from the site of synthesis and by selective export to the cytoplasm. 
However, regulation of the late promoters and molecular events that lead to the selective production of viral late mRNA is incompletely understood. Therefore, as a proof of concept for the procedure reported here, we demonstrate that viral DNA and viral late mRNA can be isolated in RCf, suggesting that these subnuclear fractions can be used to determine the pattern of synthesis and partitioning of different species of viral late mRNA, hence allowing the use of quantitative techniques and potentially advancing the detailed study of the complex pattern of viral late mRNA biogenesis. 
Furthermore, this technique can be used to study the molecular mechanisms that are responsible for the efficient replication of the viral genome, regulation of the complex program of viral gene transcription and cellular factors that are co-opted in RC, as well as morphological and ultrastructural studies of these viral induced structures. Moreover this system should be easily adapted to isolate RC from other nuclear replicating viruses, and should help unravel viral mechanisms that govern virus-cell interactions.

Adenoviruses מכיל הגנום גדילי דנ&quot;א כפול שמשכפל בגרעין התא הנגוע. כאשר ה- DNA הנגיפי נכנס לגרעין, זה localizes סמוך לגופים גרעיניים PML 1. בעקבות ביטוי גנים נגיפי מוקדם, הארכיטקטורה הגרעינית היא מחדש באופן דרמטי, וישכנע היווצרות של מייקרו-סביבות נגיפיות, המכונה תאים לנגיפיים שכפול (RC) 2. מאז אדנווירוס RC (מודעות) הם אתרים שבם שכפול הגנום נגיפי וביטוי של גנים נגיפיים מאוחר יתקיימו, הם מספקים סביבה לגיוס של כל הגורמים הנגיפיים וסלולריים הצורך המשתתפים בתהליכים אלה. מעניין, מגוון רחב של חלבונים תאיים אחראים לתגובה אנטי הסלולרית, כגון תגובת הנזק לדנ&quot;א, התגובה החיסונית המולדת ודיכוי גידול הם לאתרים הנגיפיים אלה 2 נבחרים. רכזות רגולציה מכאן, יכול להיחשב מודעות RC המקדמות שכפול נגיפי יעיל תוך הסדרה במקבילתגובה תאית אנטי, מצביעה על כך שהמבנים אלה הם מפתח להבנת אינטראקציות תא-מארח וירוס. עם זאת, המנגנונים המולקולריים של היווצרות RC, הרכבם והפעילויות נלוות הם הבינו היטב. Adenoviral RC, כמו גם RC מוירוסים DNA אחרים שלשכפל בגרעין אינם קשור לקרומים, בניגוד לRC cytoplasmic 3. יתר על כן, מבנים מושרה וירוס אלה עשויים להיות מורכבים כולו מחלבונים וחומצות גרעין. RC נוצר בתאים נגועים בווירוסי RNA (בדרך כלל מכונה מפעלים נגיפיים) היה מבודד, מנצל הלוקליזציה שלהם cytoplasmic ומעמד קרום הנכנס, אשר הקלה המורפולוגיות מפורטות שלהם, אפיון פונקציונלי ויוכימיים 4. למיטב ידיעתנו, RC הנגיפי גרעיני לא היה מבודד, אולי בשל המורכבות של הארכיטקטורה והיעדר הגרעיניים של מטר intranuclearembranes שיאפשר בידודם. מחקרם הסתמך במקום על מיקרוסקופיה immunofluorescence, דגים ומיקרוסקופים אלקטרונים הילוכים. עם זאת, למרות סיבוכים הגלומים לבידוד מבני subnuclear, תחומים גרעיניים אחרים כגון nucleoli וגופים קחל היו מבודדים לפני 5,6. מאז nucleoli וRC שניהם מורכבים מחלבונים וחומצות גרעין, ויש קוטר בין 0.5-5 מיקרומטר, שערנו כי RC צריך להיות גם נוח לבידוד. לכן, על מנת לאפיין את ההרכב המולקולרי ופונקציות הקשורות לRC מדויק יותר, הקמנו שיטה חדשה לבודד את השברים subnuclear מועשרים בRC. לשם כך, אנחנו מוכנים שברים תת-גרעיני באמצעות הדרגתיים מהירות וכריות סוכרוז דומה לנהלים המשמשים לבודד nucleoli 7 או תחומים גרעיניים אחרים 6 והקמנו מערכת תא ללא שמאפשרת הלימוד של ההרכב המולקולרי ופעילויות הקשורות לRC. טכניקה זו ולכן צריכה לקדם את ההבנה של אינטראקציות תא-מארח וירוס ומהווה כלי רב עוצמה שצריכה גם להקל על הניתוח מפורט של RC מוירוסים אחרים שלשכפל בגרעין ולגרום להיווצרות של תאי שכפול של ממדים דומים לאלה שנוצרו בadenovirus- נגועים בתאים, כגון, herpesviruses, papillomaviruses או polyomaviruses.

<table border="0">
	<tbody>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>12100-046</td>
			<td>Warm in 37 &#186;C water bath before use</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Gibco</td>
			<td>12484-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose, Ultra Pure</td>
			<td>Research Organics</td>
			<td>0928S</td>
			<td>Prepare a 2.55 M stock solution and store at 4 &#186;C</td>
		</tr>
		<tr>
			<td>Dounce homogenizer</td>
			<td>Kontess Glass Company</td>
			<td>884900-0000</td>
			<td></td>
		</tr>
		<tr>
			<td>Branson 1800 Ultrasonic Bath</td>
			<td>Branson</td>
			<td>Z769533&#160;SIGMA</td>
			<td>Turn on 15 min before use.</td>
		</tr>
		<tr>
			<td>Peroxidase AffiniPure F(ab&#39;)&#8322; Fragment Goat Anti-Mouse IgG (H+L)</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-036-003</td>
			<td>Use at a 1:10,000 dilution in PBS/0.03% non-fat milk</td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate</td>
			<td>Life Technologies</td>
			<td>A-21121</td>
			<td>Use at a 1:2,000 dilution in PBS</td>
		</tr>
		<tr>
			<td>Silane-Prep Slides</td>
			<td>Sigma</td>
			<td>S4651-72EA</td>
			<td>Open in a laminar flow cabinet</td>
		</tr>
		<tr>
			<td>SuperSignal West Pico Chemiluminescent Substrate</td>
			<td>Pierce ThermoScientific</td>
			<td>34080</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of viral replication compartment-enriched sub-nuclear fractions from adenovirus-infected normal human cells

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

מאז תאים נגיפיים שכפול (RC) הם מבנים הנוצרים על-נגיפיים subnuclear המורכב מחלבונים וחומצות גרעין, בדומה לתחומים אחרים גרעיניים, הם הוכיחו שניתנים לבידוד על ידי מילויים מהירות המבוססים על תכונות ביוכימיות. צעדים קריטיים בפרוטוקול חלוקה הם באיור 1. בכל שלב הדגימות צריכים להיות במעקב על ידי מיקרוסקופ שדה הבהיר כדי להבטיח את השלמות של שברי משנה הסלולר השונים. לדוגמא, כאשר נפיחות התאים, זמן דגירה במאגר hypotonic צריך להיות אחיד כדי להתנפח ציטופלסמה הימנעות נזק לגרעינים. לאחר הומוגניזציה תא, גרעינים שלמים, ללא רכיבים cytoplasmic כוללים ממברנות reticulum endoplasmic, צריך לקבל. כמו כן, זמן sonication צריך להיות אחיד כדי לקרוע את קרום הגרעין של כל התאים מבלי לשבש RC. לאחר קבלת השברים תת-גרעיניים, מפתחבקרות צריכה להיכלל כדי לקבוע את העמותה והעשרה של סמני RC בתום לב בRCF. Adenoviral RC הם דמיינו נפוצים בתאים נגועים על ידי immunofluorescence באמצעות נוגדנים נגד החלבון הנגיפי E2A-72K (DBP). DBP הוא חלבון נגיפי המשתתף ישירות בשכפול הגנום נגיפי; לכן, הנוכחות של DBP בחלקיקים המועשר בRCF מדגימה עמותה הישירה של חלבון נגיפי זה עם החלקיקים הבודדים, כפי שמוצגת באיור 1. יתר על כן, זיהוי של DBP בRCF ידי מערבי כתם מאשר את העמותה של חלבון זה לבודד RC. באיור 2 הוא הראה כי על ידי פעמים מאוחר לאחר זיהום (36 HPI), DBP מועשר בRCF לעומת חלק nucleoplasmic (NPL), הוכחה כי RC שהושג עם הליך זה בזמנים שונים לאחר ההדבקה משקפת צפויה זמנית דפוס של עמותת DBP לRC. מרכיב ויראלי חיוני של RC הוא itse DNA הנגיפיLF. בניסויים כמו שמוצגים באיור 3 אנו מראים כי כמויות גדלות והולכות של חבר ה- DNA הנגיפי עם RCF כמחזור השכפול של הנגיף מתקדם, המצביעים על כך, כפי שלDBP, הדפוס הזמני של שכפול הדנ&quot;א שבברים אלה יכולים להיות גם למד. חוץ מזה המכיל חלבונים נגיפיים והגנום הנגיפי, RC גם אתרים של ביטוי גנים נגיפי מאוחר. באיור 4 אנו מציגים תוצאות נציג של ניסויים שנועדו למדוד על ידי RT-PCR הרמה של מינים שונים של mRNA מאוחר הנגיפי וההפרדה ביניהם RCF וNPL ב 36 HPI. mRNA ויראלי מאוחר מסונתז בRC ועיבוד postranscriptional יוזם באתרים אלה; מאוחר יותר אלה mRNA ויראלי לנתק מRC, משוחררים לnucleoplasm, ולאחר מכן ייצא לציטופלסמה. הבריכה הכוללת של mRNA מאוחר הנגיפי הבוגר (ML mRNA) נמדדה באמצעות פריימרים שלהגביר צומת אקסון של המנהיג המשולש,רצף שמהווה 5 &#39;של כל mRNA מאוחר adenoviral (איור 4 א). צמתים אקסון בmRNA של תמלילים בוגרים ספציפיים של L2, משפחות L4 וL5 נמדדו גם. זה כבר נקבע כי כשלב המאוחר של מחזור השכפול הנגיפי מתקדם, כמויות גדלות והולכות של mRNA מאוחר הנגיפי מיוצאות לציטופלסמה; עם זאת, על ידי ייצור פעמים המאוחר של מיני L5 mRNA מגביר עוד יותר בהשוואה למשפחות mRNA מאוחר האחרות. בתוצאות הנציג נזרעו באיור 4 הבדל כ 2.5 פי בML mRNA הוא ציין בNPL לעומת RCF, כצפוי. מעניין כאשר אנו משווים mRNA ממשפחות ספציפיות, מופיעים שני L2 וL4 mRNA להיות מופצים ברמות דומות בין שני השברים subnuclear (איור 4 ו- C, בהתאמה), ואילו בניגוד לכך, ה- mRNA L5 הראה עלייה כמעט פי 2 בNPL בהשוואה לRCF. תוצאות אלו מצביעות על תבנית ההפרש בסאים<html> nthesis ושחרור של מיני mRNA מאוחר נגיפיים השונים מRC adenoviral (כפי שכבר הציע לפני 10). באופן משמעותי, תוצאות אלה גם מראים כי מדידות מדויקות של השלבים השונים בbiogenesis של mRNA ויראלי יכולות להתבצע באמצעות RC המבודד עם הליך הרומן הזה. <img alt="איור 1" src="/files/ftp_upload/53296/53296fig1.jpg" /> איור 1. מואר שדה מיקרוסקופית של שלבים שונים במהלך הליך הפלזמה. במהלך הבידוד של RC, הדגימות צריכים להיות במעקב על ידי מיקרוסקופ אופטי כדי להבטיח את השלמות של שברי משנה הסלולר. איור מציג את השלבים המשמשים בהליך לקבלת RCF, מהנפיחות של תאי HFF, להפרדת גרעינים ובידוד של RCF באמצעות כריות סוכרוז. 40x micrographs: סרגל קנה מידה 50 μ מ &#39;; 63x micrographs: סרגל קנה מידה 5 μ מ &#39;; DBP מוצג בירוק.תב&quot;ע: &quot;target =&quot; _ //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg blank &quot;&gt; לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 2" src="/files/ftp_upload/53296/53296fig2.jpg" /> איור 2. מערבי כתם נגד DBP. הדגימות מנותחות על ידי SDS-PAGE ומעובד לכתם מערבי נגד DBP, סמן תום לב של RC ויראלי. כדי לקבוע את ההעשרה של החלבון בRCF, כדאי להשוות את הנוכחות ושפע יחסי של DBP בשני RCF וNPL בזמנים שונים לאחר הדבקה. בתאי HFF 16 HPI מייצג את הזמן מוקדם במהלך מחזור שכפול adenoviral; 24 HPI מסמן את המעבר לשלב המאוחר של זיהום כסינתזת ה- DNA נגיפי מתחילה; 36 HPI מייצג לאחר זיהום מאוחר זמן. המסה המולקולרית הצפויה של DBP מוצגת. <a href="https://www.jove.com/files/ftp_upload/53296/53296fig2large.jpg" target="_blank">אנא Clic</a>k כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 3" src="/files/ftp_upload/53296/53296fig3.jpg" /> איור 3. PCR Assay לזיהוי נגיפי DNA (vDNA) בRCF. DNA היה מטוהר מRCF וNPL ב 24 ו -36 HPI. ה- DNA הנגיפי היה מוגבר על ידי PCR באמצעות פריימרים ספציפיים להגנום הנגיפי. הגרף מראה את ההעשרה של ה- DNA הנגיפי בRCF ב 36 HPI. <a href="https://www.jove.com/files/ftp_upload/53296/53296fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" src="/files/ftp_upload/53296/53296fig4.jpg" /> .. איור 4. ניתוח של נגיפי RNA המאוחר mRNA היה מבודד מRCF וNPL ונותח על ידי RT-PCR לגילוי mRNA מאוחר נגיפי הספציפי () סה&quot;כ ויראלי המאוחר mRNA (ML: רס&quot;ן המאוחר); (ב) mRNA מL2 משפחה; (ג) mRNA ממשפחת L4; (ד) mRNA ממשפחת L5. ערכים מייצגים ממוצע ± סטיית תקן של דגימות בשלושה עותקים. <a href="https://www.jove.com/files/ftp_upload/53296/53296fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table border="0" fo:keep-together.within-page="1" style=";text-align:right;direction:rtl"><tbody><tr><td> שֵׁם </td><td> רצף קדימה פריימר (5&#39;-3 &quot;) </td><td> רצף הפוך פריימר (5&#39;-3 &quot;) </td><td> טמפרטורת חישול </td></tr><tr><td> ML mRNA </td><td> GCCTCCGAACGGTACTCCGCC </td><td> CGCCACGGTGCTCAGCCTACC </td><td> 60 מעלות צלזיוס </td></tr><tr><td> L2 mRNA </td><td> GTCACAGTCGCAAGATGTCCAAGC </td><td> GCAACGCCAGCATGTCCTTATGC </td><td> 58 מעלות צלזיוס </td></tr><tr><td> L4 mRNA </td><td> CCTCCGAACGGTACTCCGC </td><td> CCTTGCTCATCTTGCGACTGTG </td><td> 58 מעלות צלזיוס </td></tr><tr><td> L5 mRNA </td><td> GTCACAGTCGCAAGATGAAGCG </td><td> GGTAACTAGAGGTTCGGATAGGCG </td><td> 60 מעלות צלזיוס </td></tr></tbody></table> . טבלת 1. Primers משמש לויראלי המאוחר mRNA הגברה ML mRNA: פריימרים אלה מאפשרים ההגברה של אזור בתוך המנהיג המשולש, הרצף 5 &#39;שמשותף לכל mRNA מאוחר הנגיפי; פריימרים L2 mRNA מאפשרים ההגברה של אזור מסוים בתוך mRNA PV; פריימרים L4 mRNA מאפשרים ההגברה של אזור מסוים בתוך 100 K mRNA; L5 mRNA מאפשר ההגברה של אזור בתוך mRNA הסיבים. טמפרטורות הרצף וחישול עבור כל חסודאה מוצגים.

Watch this Scientific Journal Video about Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells at JoVE.com

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

בידוד של שברים תת-גרעיניים מועשרים-תא ויראלי שכפול מתאים נורמלים אדם נגוע Adenovirus

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments ...

isolation-viral-replication-compartment-enriched-sub-nuclear

Google

Research

JoVE Journal

Immunology and Infection

8.7K Views.  Universidad Autónoma del Estado de Morelos. We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC. 

Video: Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

בידוד של פידליטי גרסאות של וירוסים RNA ו אפיון תדירות המוטציה וירוס

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

ההכנה של ה-DNA ויראלי של Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

הקמת תרבות הנוזלית מכוסית של Airway האנושי המקוטב-3 Calu תאי אפיתל ללמוד תגובת תא מארחת לפתוגנים נשימה<em&gt; במבחנה</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Isolation of Myeloid Dendritic Cells and Epithelial Cells from Human Thymus

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen presenting cell (APC) types found in a normal thymus and it is well established that they play distinct roles during thymic selection. These cells are localized in distinct microenvironments in the thymus and each APC type makes up only a minor population of cells. To further understand the biology of these cell types, characterization of these cell populations is highly desirable but due to their low frequency, isolation of any of these cell types requires an efficient and reproducible procedure. This protocol details a method to obtain cells suitable for characterization of diverse cellular properties. Thymic tissue is mechanically disrupted and after different steps of enzymatic digestion, the resulting cell suspension is enriched using a Percoll density centrifugation step. For isolation of myeloid DC (CD11c+), cells from the low-density fraction (LDF) are immunoselected by magnetic cell sorting. Enrichment of TEC populations (mTEC, cTEC) is achieved by depletion of hematopoietic (CD45hi) cells from the low-density Percoll cell fraction allowing their subsequent isolation via fluorescence activated cell sorting (FACS) using specific cell markers. The isolated cells can be used for different downstream applications.

This protocol details a method to isolate antigen presenting cells from human thymus via different steps of enzymatic digestion of the tissue followed by density centrifugation of the single cell suspension and finally magnetic and/or FACS sorting of the cell populations of interest.

בידוד של תאי מיאלואידית דנדריטים ותאי האפיתל מקורנית האדם

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these glycoprotein &#8216;spikes&#8217; is often technically challenging but important for understanding viral pathogenesis and in drug design. Here, a protocol is presented for viral spike structure determination through computational averaging of electron cryo-tomography data. Electron cryo-tomography is a technique in electron microscopy used to derive three-dimensional tomographic volume reconstructions, or tomograms, of pleomorphic biological specimens such as membrane viruses in a near-native, frozen-hydrated state. These tomograms reveal structures of interest in three dimensions, albeit at low resolution. Computational averaging of sub-volumes, or sub-tomograms, is necessary to obtain higher resolution detail of repeating structural motifs, such as viral glycoprotein spikes. A detailed computational approach for aligning and averaging sub-tomograms using the Jsubtomo software package is outlined. This approach enables visualization of the structure of viral glycoprotein spikes to a resolution in the range of 20-40 &#197; and study of the study of higher order spike-to-spike interactions on the virion membrane. Typical results are presented for Bunyamwera virus, an enveloped virus from the family Bunyaviridae. This family is a structurally diverse group of pathogens posing a threat to human and animal health.

An approach is presented for determining structures of viral membrane glycoprotein complexes using a combination of electron cryo-tomography and sub-tomogram averaging with the computational package Jsubtomo.

ממוצע של ויראלי מעטפת גליקופרוטאין Spikes מאלקטרוני Cryotomography שחזור באמצעות Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Isolation of Leukocytes from the Human Maternal-fetal Interface

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua parietalis). This interface is the anatomical site of contact between maternal and fetal tissues; therefore, it is an immunological site of action during pregnancy. Infiltrating leukocytes at the maternal-fetal interface play a central role in implantation, pregnancy maintenance, and timing of delivery. Therefore, phenotypic and functional characterizations of these leukocytes will provide insight into the mechanisms that lead to&#160;pregnancy disorders. Several protocols have been described in order to isolate infiltrating leukocytes from the decidua basalis and decidua parietalis; however, the lack of consistency in the reagents, enzymes, and times of incubation makes it difficult to compare these results. Described herein is&#160;a novel approach that combines the use of gentle mechanical and enzymatic dissociation techniques to preserve the viability and integrity of extracellular and intracellular markers in leukocytes isolated from the human tissues at the maternal-fetal interface. Aside from immunophenotyping, cell culture, and cell sorting, the future applications of this protocol are numerous and varied. Following this protocol, the isolated leukocytes can be used to determine DNA methylation, expression of target genes, in vitro leukocyte functionality (i.e., phagocytosis, cytotoxicity, T-cell proliferation, and plasticity, etc.), and the production of reactive oxygen species at the maternal-fetal interface. Additionally, using the described protocol, this laboratory has been able to describe new and rare leukocytes at the maternal-fetal interface.

Described herein is a protocol to isolate and further study the infiltrating leukocytes of the decidua basalis and decidua parietalis - the human maternal-fetal interface. This protocol maintains the integrity of cell surface markers and yields enough viable cells for downstream applications as proven by flow cytometry analysis.

בידוד של לויקוציטים מממשק האדם-האימהי העוברי

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua ...

Isolation of Sertoli Cells and Peritubular Cells from Rat Testes

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of puberty - more than ten years after the establishment of systemic immune tolerance. Spermatogenic cells express a number of proteins that may be seen as non-self by the immune system. The testis must then be able to establish tolerance to these neo-antigens on the one hand but still be able to protect itself from infections and tumor development on the other hand. Therefore the testis is one of a few immune privileged sites in the body that tolerate foreign antigens without evoking a detrimental inflammatory immune response. Sertoli cells play a key role for the maintenance of this immune privileged environment of the testis and also prolong survival of cotransplanted cells in a foreign environment. Therefore primary Sertoli cells are an important tool for studying the immune privilege of the testis that cannot be easily replaced by established cell lines or other cellular models. Here we present a detailed and comprehensive protocol for the isolation of Sertoli cells - and peritubular cells if desired - from rat testes within a single day.

Primary Sertoli cells are required for studying testis-immune privilege, signal transduction during inflammation or infection, and utilization of their immunoprotective properties. Here we describe an enzyme-based protocol for the isolation of highly purified primary Sertoli cells and peritubular cells from rat testes.

תאי בידוד של תאי Sertoli ו Peritubular מן חולדת האשכים

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the person-to-person route or indirectly through environmental surfaces or food, contaminated fomites and inanimate surfaces are important vehicles for the spread of the virus during norovirus outbreaks.
We developed and evaluated a protocol using macrofoam swabs for the detection and typing of human noroviruses from hard surfaces. Compared with fiber-tipped swabs or antistatic wipes, macrofoam swabs allow virus recovery (range 1.2-33.6%) from toilet seat surfaces of up to 700 cm2. The protocol includes steps for the extraction of the virus from the swabs and further concentration of the viral RNA using spin columns. In total, 127 (58.5%) of 217 swab samples that had been collected from surfaces in cruise ships and long-term care facilities where norovirus gastroenteritis had been reported tested positive for GII norovirus by RT-qPCR. Of these 29 (22.8%) could be successfully genotyped. In conclusion, detection of norovirus on environmental surfaces using the protocol we developed may assist in determining the level of environmental contamination during outbreaks as well as detection of virus when clinical samples are not available; it may also facilitate monitoring of effectiveness of remediation strategies.

A macrofoam based sampling methodology was developed and evaluated for the detection and quantification of norovirus on environmental hard surfaces.

שיטת הדגימה ספוגית לצורך זיהוי של norovirus האדם על משטחים

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

Isolation of Dendritic Cells from the Human Female Reproductive Tract for Phenotypical and Functional Studies

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low numbers of DCs present per tissue. Yet, as the phenotype and function of DCs is modified by the tissue environment, it is necessary to analyze tissue resident DC populations, since blood derived DCs incompletely reflect the complexities of DCs in tissues. Here we present a protocol to isolate DCs from the human female reproductive tract (FRT) using hysterectomy specimens that allows both phenotypical and functional analyses. The protocol consists of tissue digestion to generate a single cell mixed cell suspension, followed by positive magnetic bead selection. Our tissue digestion protocol does not cleave surface markers, which allows phenotypical and functional analysis of DCs in the steady state, without overnight incubation or cell activation. This protocol can be adapted for the isolation of other immune cell types or isolation of DCs from other tissues.

We describe here a method to isolate and purify dendritic cells from different anatomical compartments in the human female reproductive tract for the evaluation of their phenotypical and functional characteristics. This method can be adapted to isolate other immune cells or dendritic cells from other mucosal tissues.

בידוד של תאים דנדריטים האדם באיברי הרבייה הנקביים ללימודי פנוטיפיות שהיו קיימות בעבר ופונקציונלי

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor response to insulin, local hypoxia, and inflammation. By stimulating the differentiation of functional white adipocytes from progenitors, radical hypertrophy of the adipocyte population can be prevented and, consequently, the metabolic health of adipose tissue can be improved along with a reduction of inflammation. Also, by stimulating a differentiation of beige/brown adipocytes, the total body energy expenditure can be increased, resulting in weight loss. This approach could prevent the development of obesity co-morbidities such as type 2 diabetes and cardiovascular disease.
This paper describes the isolation, expansion, and differentiation of white and beige adipocytes from a subset of human adipose tissue endothelial cells that co-express the CD31 and CD34 markers. The method is relatively cheap and is not labor-intensive. It requires access to human adipose tissue and the subcutaneous depot is suitable for sampling. For this protocol, fresh adipose tissue samples from morbidly obese subjects [body mass index (BMI) &#62;35] are collected during bariatric surgery procedures. Using a sequential immunoseparation from the stromal vascular fraction, enough cells are produced from as little as 2&#8211;3 g of fat. These cells can be expanded in culture over 10&#8211;14 days, can be cryopreserved, and retain their adipogenic properties with passaging up to passage 5&#8211;6. The cells are treated for 14 days with an adipogenic cocktail using a combination of human insulin and the PPAR&#947; agonist-rosiglitazone.
This methodology can be used for obtaining proof of concept experiments on molecular mechanisms that drive adipogenic responses in adipose endothelial cells, or for screening new drugs that can enhance the adipogenic response directed either towards white or beige/brown adipocyte differentiation. Using small subcutaneous biopsies, this methodology can be used to screen out non-responder subjects for clinical trials aimed to stimulate beige/brown and white adipocytes for the treatment of obesity and co-morbidities.

The differentiation of white and beige adipocytes from adipose tissue vascular progenitors bears potential for metabolic improvement in obesity. We describe protocols for a CD34+CD31+ endothelial cell isolation from human fat and for a subsequent in vitro expansion and differentiation into white and beige adipocytes. Several downstream applications are discussed.

בידוד, הרחבה, אינדוקציה Adipogenic CD34 + CD31 + תאי אנדותל של אדם עם פגיעה ו התת-עורית שומן

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...