This work was supported by grants from CONACyT-SEP (SEP-2008-84582; CB-2011-01-168497) and Promep-SEP for R.A.G.; P.H. received a scholarship from CONACyT (447442).

1. HFF Cultura de Células e-infecção Anúncio <ol><li> Propagar o vírus Ad5 WT em monocamadas de células HEK-293 e título como unidades formadoras fluorescentes (UFF) em células HFF como anteriormente descrito 8. </li><li> Cresça fibroblastos de prepúcio humano (HFF) em 10 ml de DMEM / 10% de Soro Fetal Bovino (FBS) em cultura estéreis placas de 100 mm a 37 ° C e 5% de CO2 num incubador humidificado. Determinar o número de células utilizando uma câmara de Neubauer por contagem de células nas quatro conjuntos de 16 quadrados. O número de células por mL é obtida através do cálculo da média do número de células nas quatro conjuntos de 16 quadrados e multiplicando este número por 10 4. Para cada tempo de pós-infecção incluídos na etapa 1.3, usar 1 x 10 7 células HFF. </li><li> Mock-infectar ou infectar células HFF com adenovírus tipo 5 (Ad5) do tipo selvagem (WT) (H5pg4100 8) em 100 mm placas de cultura de tecido com 1 ml de Ad5 em DMEM por prato a uma MOI de 30 Foco Forming Unit, ou FFU , por célula. Incubar por 2 horas em ahumidified incubadora de cultura de células a 37 ° C e 5% de CO 2, de balanço cuidadosamente os pratos a cada 15 minutos para assegurar uma distribuição homogénea do inoculo de vírus sobre as células. Após este tempo, remover o meio e adicionar DMEM fresco suplementado com FBS a 10% e incuba-se durante 16, 24 ou 36 h numa incubadora de cultura de células humidificada a 37 ° C e 5% de CO 2. Prossiga para a etapa 2.1. </li></ol> 2. Preparação de fracções Sub-nuclear Enriquecido com Adenovírus RC <ol><li> Colheita Ad5-infectadas ou células HFF falsamente infectadas com um raspador celular e recolher as células em tubos de centrífuga estéreis. Determinar o número de células como no passo 1.2. Use 1 x 10 7 células para cada pós-infecção de tempo especificado no passo 1.3. </li><li> Centrifugar as células a 220 xg, 4 ºC por 5 min. </li><li> Ressuspender o sedimento celular em PBS arrefecido em gelo (NaCl 137 mM, KCl 2,7 mM, 10 mM de Na 2 HPO 4 1,8 mM e KH 2 PO 4). Lave o peletizado de célulass 3 vezes com 5 ml de PBS gelado por lavagem. Para este efeito, centrifugar as células a 220 xg, a 4 ° C durante 5 minutos, decantar e desprezar o sobrenadante (SN), e ressuspender o sedimento de células por pipetagem suave. </li><li> Para romper a membrana de plasma, ressuspender o sedimento celular em 700 uL de tampão hipotónico gelado (HEPES 10 mM pH 7,9, KCl 10 mM, MgCl 1,5 mM, 2, 0,5 mM DTT, 20 μ g / ml de fluoreto de fenilmetilsulfonilo (PMSF) , uma mistura de cisteína, serina, treonina e inibidores da aspartil protease, incluindo 10 μ g / ml de inibidor de tripsina pancreática bovina, 10 μ g / ml de pepstatina A e 10 μ g / ml de N-acetil-L-leucil-L-leucil-L- -argininal) e deixar que as células inchar em gelo durante 3 h. </li><li> Lyse as células utilizando um homogeneizador com uma folgada Um pilão tipo teflon. Realize 80 dounce derrames e monitor de amostras a cada 20 golpes por microscopia de campo claro para assegurar que todas as células foram lisadas, mas que têm núcleos not sido danificado ou rompido. </li><li> Centrifuga-se o homogeneizado de células a 300 xg, 4 ° C durante 5 min. Armazenar o SN como a fracção citoplasmática a -20 ° C em um tubo de centrífuga. </li><li> Para remover os detritos celulares a partir de núcleos, ressuspender o sedimento em 750 μ l de solução de 1 (S1) (0,25 M de sacarose, 10 mM de MgCl 2 20 ug / ml de PMSF, uma mistura de cisteína, serina, inibidores da treonina e da protease de aspartilo que incluem 10 μ g / ml de inibidor de tripsina pancreática bovina, 10 μ g / ml de pepstatina A e 10 μ g / ml de N-acetil-L-leucil-L-leucil-L-argininal) e camada sobre um volume igual de solução de 2 (S2) (0,35 M de sacarose, 0,5 mM de MgCl 2, 20 μ g / ml de PMSF, uma mistura de cisteína, serina, inibidores da treonina e da protease de aspartilo que incluem 10 μ g / ml de inibidor de tripsina pancreática bovina, 10 μ g / ml de pepstatina A e 10 μ g / ml de N-acetil-L-leucil-L-leucil-L-argininal). Centrifuge a 1.400 xg, 4 ºC por 5 min. </li><li> Descartar o SN utilizando uma micropipeta. Evite perturbar o sedimento. </li><li> Ressuspender o sedimento contendo núcleos isolados em 750 μ l de S2. </li><li> Para isolar frações subnucleares enriquecidos com adenovírus RC (RCF), sonicate núcleos ressuspenso com um banho de ultra-som, usando dois pulsos 5 min, ou até que todos os núcleos são lisadas como observado por microscopia de campo claro. Use gelo no banho de ultra-sons, conforme necessário para manter as amostras a, ou abaixo de 4 ° C. </li><li> Camada os núcleos sonicadas sobre um volume igual de solução de 3 (S3) (0,88 M de sacarose, 0,5 mM de MgCl2) e centrifuga-se a 3000 xg, 4 ° C durante 10 min. Guarde a 1,5 ml sobrenadante como a fracção nucleoplasmic (NPL) a -70 ºC. Ressuspender o sedimento em 700 μ l de S2 e armazenar como RCF a -70 ºC. </li></ol> 3. As análises de Western Blot RCF NOTA: Para a análise Western Blot de NPL e RCF frações set de lado 640 ul para Npl e 300 μ l para RCF do volume total obtido na etapa 2.11. <ol><li> Misturar 15 μ l de cada fracção subnuclear em tampão Laemmli 2x (4% de SDS, 20% glicerol, 10% de 2-mercaptoetanol, 0,004% de azul de bromofenol, Tris-HCl 0,125 M pH 6,8) e fervura a 95 ºC durante 5 min. Coloque as amostras em uma electroforese de sódio dodecil 10% sulfato-poliacrilamida gel (SDS-PAGE) em gel de desnaturação e de proteínas separadas por 1,5 h, a 20 miliamperes (mA). </li><li> Proteínas transferir por Eletroblotting durante 1,5 horas a 400 mA para polivinilideno (PVDF) membranas. </li><li> Bloco de membrana durante 2 horas à temperatura ambiente a partir de leite seco sem gordura a 3% em PBS. </li><li> Incubar O / N a 4 ºC com o anticorpo primário contra proteína E2A de ligação a DNA viral (B6-8 9) a uma diluição de 1: 500 em leite seco PBS / 0,3% desnatado. </li><li> Membrana Lavar 3 vezes com PBS / 0,1% Tween 20 durante 10 min. </li><li> Incubar a membrana com um rato anti IgG secundáriotibody acoplado a peroxidase de rábano (HRP) a uma diluição de 1: 10.000 em PBS durante 2 horas à temperatura ambiente. </li><li> Lava-se a membrana 3 vezes com PBS / 0,1% Tween 20 durante 10 min. </li><li> Desenvolver a membrana usando quimioluminescência aumentada e filmes de raios-X. </li></ol> 4. Detecção de ADN viral no RCF NOTA: Para o isolamento de ADN a partir de ambas as fracções de morosidade e RCF, utilizar 210 μ l para Npl e 100 μ l para RCF do volume total obtido na etapa 2.11. <ol><li> Incubar fracções sub-nucleares durante 1 h a 55 ºC, com 1 mg / ml de proteinase K e 0,5% de Tween 20. </li><li> Inactivar a proteinase K por incubação das amostras durante 10 min a 95 ° C. </li><li> Centrifugar as amostras a 20.000 xg, à temperatura ambiente durante 2 min. </li><li> Recolher o SN. Precipitar o ADN com 1/10 de volume de acetato de sódio 3M e um volume de isopropanol, O / N a 4 ° C. </li><li> Centrifugar as amostras a 20.000 xg, à temperatura ambiente durante 10 min. </li><li> Descarte o u SNcantar uma micropipeta. Lava-se a pastilha com etanol a 70% e centrifuga-se a 20000 xg, 4 ° C durante 5 min. </li><li> Ressuspender o ADN em 10 μ l de 10 mM de Tris-HCl a pH 7,4 </li><li> Quantificar ADN utilizando um espectrofotómetro, medindo a densidade óptica (DO) a 260 nm. </li><li> Para amplificar o ADN viral, utilizar 100 ng de ADN de cada fracção subnuclear numa reacção de PCR utilizando polimerase de ADN de Taq em 25 μ l de volume de reacção com iniciadores que permitem a amplificação de uma região no interior da unidade de transcrição tardia principal, a partir do nucleótido 7273 de nucleotídeo 7353 (81 pb) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Use as seguintes condições de ciclos: desnaturação inicial durante 3 min a 95 ºC, seguido por 20 ciclos de amplificação (1 min a 95 ° C, recozimento durante 1 minuto a 62 ° C e extensão durante 30 s a 72 ° C) e um passo final de extensão para 3 min a 72 ºC. </li><li> Executar o produto de PCR em géis de agarose a 2%, a 90 V. mancha com etídiobrometo em 0,5 μ g / ml de concentração final e visualizar o ADN para corroborar o enriquecimento do ADN viral no RCF. Lidar com brometo de etídio com extremo cuidado e certifique-se sempre usar luvas, como este composto é um potente mutagênico. Descarte brometo de etídio de acordo com as diretrizes institucionais. </li></ol> 5. tarde Viral Detecção de mRNA em RCF NOTA: Para o isolamento do RNA a partir de ambas as frações NPL e RCF, use 640 μ l para Npl e 300 μ l para RCF do volume total obtido na etapa 2.11. <ol><li> Isolar o ARN a partir de fracções subnucleares usando Trizol de acordo com as instruções do fabricante. Ressuspender o RNA em 50 μ l de DEPC (diethilpyrocarbonate) tenha sido tratada com água. </li><li> Quantificar o ARN utilizando um espectrofotómetro para medir a densidade óptica a 260 nm (cerca de 3 μ g são obtidos). Armazenar o ARN em 50 ng / ul de aliquotas a -70 ° C. </li><li> Verifique RNA purificadopara a ausência de contaminação com ADN através da realização de uma reacção de controlo na ausência de PCR de transcriptase reversa (RT), utilizando-se 5 ng de ARN total e as condições do ciclo descritas no passo 4.9. <ol><li> Se a contaminação de ADN não está ausente amplicão deve ser produzido. Se a contaminação de ADN está presente, incubar as amostras com 10 U de ADNase I, 10 U de inibidor de RNase, 0,1 M de Tris-HCl pH 8,3, 0,5 M de KCl e 15 mM de MgCl2 durante 30 min a 37 ºC. Prossiga para a re-isolar RNA como no passo 5.1. </li></ol></li><li> Para analisar ARNm viral associado a RCF, ampliada 100 ng de ARN a partir de cada fracção subnuclear por RT-PCR utilizando iniciadores desenhados para detectar ARNm tardio adenoviral de diferentes famílias de genes (Tabela 1). <ol><li> Para a transcrição reversa (RT) a 100 ng de ARN, a partir de cada fracção subnuclear numa reacção de RT utilizando enzima M-MuLV RT em 20 μ l de volume de reacção durante 1 hora a 42 ° C e 10 min a 70 ºC. </li><li> Para a amplificação, usar 1μ l do ADNc em reacções de PCR, como no passo 4.9. Use as seguintes condições de ciclos: desnaturação inicial durante 3 min a 95 ºC, seguido por 25 ciclos de amplificação (1 min a 95 ° C, recozimento durante 1 minuto à temperatura especificada no Quadro 1 e extensão durante 30 s a 72 ºC) e um etapa de extensão final de 3 min a 72 ºC. </li></ol></li><li> Executar os produtos de RT-PCR em géis de agarose a 2%, em géis de 90 V. mancha com brometo de etídio a 0,5 μ g / ml de concentração final e visualizar a corroborar associação ARNm tardio virai para o RCF. Pega brometo de etídio, tal como indicado no passo 4.10. </li></ol> 6. Imunofluorescência Visualização de RCF NOTA: Carry-out este procedimento sob uma câmara de fluxo laminar para evitar a contaminação das amostras com as partículas de poeira e filtrar todas as soluções antes de usar. <ol><li> Spot 5 uL da fracção RCF obtidos no passo 2.10 directly em uma lâmina revestida de silano. </li><li> Deixe o local seco durante cerca de 5 min à temperatura ambiente. </li><li> Re-hidratado por lentamente e indiretamente pipetando 500 μ l de PBS em uma queda ao lado do local RCF e deixá-lo fluir pela inclinação do slide. Escorra o excesso de PBS de lado. </li><li> Bloquear, cobrindo a amostra com 500 μ l de PBS / 5% de albumina de soro bovino (BSA) durante 2 horas à temperatura ambiente. </li><li> Lave o slide 3 vezes por suavemente e indiretamente pipetando 500 l μ da PBS sobre a amostra. Incline o slide para drenar o excesso de PBS. </li><li> Incubar a amostra com o anticorpo primário contra proteína E2A de ligação a DNA viral (B6-8 9) a uma diluição de 1: 500 em PBS durante 2 horas à temperatura ambiente. Cobrir a amostra manchada com 20 μ l da solução de anticorpo e incuba-se numa câmara húmida, para evitar a secagem. </li><li> Lava-se a amostra 3 vezes com PBS / 0,02% de Tween 20 e, indirectamente, por suavemente pipetando 500 μ l de PBS para a amostra. Incline o slide para drenar o exsolução de lavagem cesso. </li><li> Incubar as amostras com rato anticorpo secundário IgG anti acoplado a um fluoróforo que é excitada a 488 nm, a uma diluição de 1: 2000 em PBS, durante 1 hora a 4 ºC. Cobrir a amostra manchada com 20 μ l da solução de anticorpo e incuba-se numa câmara húmida, para evitar a secagem. </li><li> Lava-se a amostra 3 vezes com PBS / 0,02% de Tween 20 e, indirectamente, por suavemente pipetando 500 μ l de PBS para a amostra. Incline o slide para drenar o excesso de solução de lavagem. </li><li> Cobrir a amostra manchada sobre a lâmina com uma lamela utilizando 2 μ l de PBS / glicerol a 10% como meio de montagem. Selo com clara unha polonês e armazenar al -20 ºC. </li><li> Analisar as amostras utilizando um microscópio de fluorescência, com uma objectiva 63x e uma Abertura Numérica 1,4 (NA) num comprimento de onda de 488 nm. </li></ol>

<ol>
	<li>Doucas, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+replication+is+coupled+with+the+dynamic+properties+of+the+PML+nuclear+structure.">Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.</a> Genes &#38; Dev. 10, 196-207 (1996).</li><li>Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+virus+replication+compartments.">DNA virus replication compartments.</a> J. Virol. 88, 1404-1420 (2014).</li><li>Boon, J. A., Diaz, A., Ahlquist, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+viral+replication+complexes.">Cytoplasmic viral replication complexes.</a> Cell host microbe. 8, 77-85 (2010).</li><li>Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+and+biochemical+characterization+of+the+membranous+hepatitis+C+virus+replication+compartment.">Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.</a> J. Virol. 87, 10612-10627 (2013).</li><li>Busch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Nucleoli.">Isolation of Nucleoli.</a> Exp Cell Res. 24, 150-163 (1963).</li><li>Lam, Y. W., Lyon, C. E., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+isolation+of+Cajal+bodies+from+HeLa+cells.">Large-scale isolation of Cajal bodies from HeLa cells.</a> Mol. Biol. Cell. 13, 2461-2473 (2002).</li><li>Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+nucleolus.">The nucleolus.</a> J Cell Sci. 118, 1335-1337 (2005).</li><li>Groitl, P., Dobner, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+adenovirus+type+5+early+region+1+and+4+virus+mutants.">Construction of adenovirus type 5 early region 1 and 4 virus mutants.</a> Methods Mol Med. 130, 29-39 (2007).</li><li>Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+which+recognize+native+and+denatured+forms+of+the+adenovirus+DNA-binding+protein.">Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein.</a> Virology. 128, 480-484 (1983).</li><li>Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+effects+on+adenovirus+late+gene+expression+of+deleting+the+E1b+55K+protein.">Selective effects on adenovirus late gene expression of deleting the E1b 55K protein.</a> J Gen Virol. 74 (Pt 4), 575-582 (1993).</li><li>Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+E1B+55-kilodalton+protein+is+required+for+both+regulation+of+mRNA+export+and+efficient+entry+into+the+late+phase+of+infection+in+normal+human+fibroblasts.">Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts.</a> J. Virol. 80, 964-974 (2006).</li><li>Castillo-Villanueva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mre11+Cellular+Protein+Is+Modified+by+Conjugation+of+Both+SUMO-1+and+SUMO-2/3+during+Adenovirus+Infection.">The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection.</a> ISRN Virology. 2014, 14 (2014).</li><li>Morris, S. J., Scott, G. E., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+late-phase+infection+is+controlled+by+a+novel+L4+promoter.">Adenovirus late-phase infection is controlled by a novel L4 promoter.</a> J. Virol. 84, 7096-7104 (2010).</li><li>Wright, J., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+adenovirus+5+L4+promoter+is+activated+by+cellular+stress+response+protein+p53.">The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53.</a> J. Virol. 87, 11617-11625 (2013).</li></ol>

The authors have nothing to disclose.

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of th...

Os adenovírus contêm um genoma de ADN de cadeia dupla que replicam no núcleo da célula infectada. Quando o ADN virai entra no núcleo, que se localiza junto a PML corpos nucleares 1. Após expressão do gene precoce viral, a arquitetura nuclear é reorganizada de forma dramática, induzindo a formação de microambientes virais, denominado de Compartimentos replicação viral (RC) 2. Desde adenovirus (Ad) RC são os locais onde a replicação viral genoma e expressão de genes virais final têm lugar, eles fornecem um ambiente para o recrutamento de todos os fatores virais e celulares necessários que participam nestes processos. Curiosamente, uma variedade de proteínas celulares responsáveis ​​pela resposta antiviral celular, tais como a resposta a danos no ADN, a resposta imune inata e supressão tumoral são co-optou por esses sítios virais 2. Cubos reguladoras Assim, Ad RC pode ser considerado que promovem a replicação viral eficiente enquanto concomitantemente regulação doresposta antiviral celular, indicando que estas estruturas são fundamentais para a compreensão das interacções vírus-hospedeiro de células. No entanto, os mecanismos moleculares da formação de RC, a sua composição e as suas actividades são mal compreendidos. RC adenoviral, bem como RC de outros vírus de ADN que se replicam no núcleo não estão associadas a membranas, em contraste com RC citoplasmática 3. Além disso, estas estruturas induzida por vírus são susceptíveis de ser inteiramente constituída por proteínas e ácidos nucleicos. RC formado nas células infectadas com os vírus de ARN (usualmente denominado fábricas virais) foram isolados, aproveitando a sua localização citoplásmica e ligada à membrana de estado, o que facilitou a sua morfológica detalhada, a caracterização funcional e bioquímica 4. Para nosso conhecimento, RC viral nuclear não tenham sido isolados, talvez devido à complexidade da arquitectura nuclear e ausência de m intranuclearesembranes que facilitem o seu isolamento. O estudo se baseou em vez de microscopia de imunofluorescência, FISH e microscopia eletrônica de transmissão. No entanto, apesar de complicações inerentes a isolar estruturas subnucleares, outros domínios nucleares, tais como nucléolos e Corpos de Cajal foram isoladas antes de 5,6. Desde nucléolos e Rc são ambas compostas de proteínas e ácidos nucleicos, e tem um diâmetro entre 0,5 - 5 mm, a hipótese de que RC também devem ser passíveis de isolamento. Por conseguinte, a fim de caracterizar mais precisamente a composição molecular e funções associadas a RC, foi estabelecido um novo método para isolar fracções enriquecidas com subnucleares RC. Para este fim, preparado de fracções sub-nuclear utilizando gradientes de velocidade e almofadas de sucrose semelhantes aos procedimentos usados ​​para isolar nucléolos 7 ou outros domínios nucleares 6 e estabelecido um sistema isento de células, que permite o estudo da composição molecular e de actividades associadasRC. Essa técnica deve, portanto, fazer avançar a compreensão das interações celulares vírus-hospedeiro e representa uma ferramenta poderosa que devem também facilitar a análise detalhada de RC de outros vírus que se replicam no núcleo e induzir a formação de compartimentos de replicação de dimensões semelhantes às formada em adenovirus- As células infectadas, tais como, vírus do herpes, vírus de papiloma ou poliomavírus.

<table border="0">
	<tbody>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>12100-046</td>
			<td>Warm in 37 &#186;C water bath before use</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Gibco</td>
			<td>12484-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose, Ultra Pure</td>
			<td>Research Organics</td>
			<td>0928S</td>
			<td>Prepare a 2.55 M stock solution and store at 4 &#186;C</td>
		</tr>
		<tr>
			<td>Dounce homogenizer</td>
			<td>Kontess Glass Company</td>
			<td>884900-0000</td>
			<td></td>
		</tr>
		<tr>
			<td>Branson 1800 Ultrasonic Bath</td>
			<td>Branson</td>
			<td>Z769533&#160;SIGMA</td>
			<td>Turn on 15 min before use.</td>
		</tr>
		<tr>
			<td>Peroxidase AffiniPure F(ab&#39;)&#8322; Fragment Goat Anti-Mouse IgG (H+L)</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-036-003</td>
			<td>Use at a 1:10,000 dilution in PBS/0.03% non-fat milk</td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate</td>
			<td>Life Technologies</td>
			<td>A-21121</td>
			<td>Use at a 1:2,000 dilution in PBS</td>
		</tr>
		<tr>
			<td>Silane-Prep Slides</td>
			<td>Sigma</td>
			<td>S4651-72EA</td>
			<td>Open in a laminar flow cabinet</td>
		</tr>
		<tr>
			<td>SuperSignal West Pico Chemiluminescent Substrate</td>
			<td>Pierce ThermoScientific</td>
			<td>34080</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of viral replication compartment-enriched sub-nuclear fractions from adenovirus-infected normal human cells

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

Uma vez que os compartimentos de replicação virai (RC) são estruturas virais induzidas subnucleares compostas por proteínas e ácidos nucleicos, semelhante a outros domínios nucleares, elas provaram ser passíveis de isolamento por gradientes de velocidade com base nas características bioquímicas. As etapas críticas no protocolo de fraccionamento são ilustrados na Figura 1. Em cada passo, as amostras devem ser monitorizada por microscopia de campo brilhante para assegurar a int...

Watch this Scientific Journal Video about Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells at JoVE.com

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

Isolamento de Frações Sub-nuclear Viral Replication Compartimento enriquecidas de Adenovirus-infectados células normais Humanos

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments ...

isolation-viral-replication-compartment-enriched-sub-nuclear

Research

JoVE Journal

Immunology and Infection

8.7K visualizações.  Universidad Autónoma del Estado de Morelos. We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC. 

Vídeo: Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

Isolamento de variantes de vírus de RNA Fidelity e Caracterização de frequência de mutação de vírus

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Imunologia e Infecção

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Preparação de DNA viral a partir nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

Estabelecer uma cultura líquida, coberta de vias respiratórias humanas epiteliais Polarized Calu-3 células para estudar a resposta Cell Host para patógenos respiratórios<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Isolation of Myeloid Dendritic Cells and Epithelial Cells from Human Thymus

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen presenting cell (APC) types found in a normal thymus and it is well established that they play distinct roles during thymic selection. These cells are localized in distinct microenvironments in the thymus and each APC type makes up only a minor population of cells. To further understand the biology of these cell types, characterization of these cell populations is highly desirable but due to their low frequency, isolation of any of these cell types requires an efficient and reproducible procedure. This protocol details a method to obtain cells suitable for characterization of diverse cellular properties. Thymic tissue is mechanically disrupted and after different steps of enzymatic digestion, the resulting cell suspension is enriched using a Percoll density centrifugation step. For isolation of myeloid DC (CD11c+), cells from the low-density fraction (LDF) are immunoselected by magnetic cell sorting. Enrichment of TEC populations (mTEC, cTEC) is achieved by depletion of hematopoietic (CD45hi) cells from the low-density Percoll cell fraction allowing their subsequent isolation via fluorescence activated cell sorting (FACS) using specific cell markers. The isolated cells can be used for different downstream applications.

This protocol details a method to isolate antigen presenting cells from human thymus via different steps of enzymatic digestion of the tissue followed by density centrifugation of the single cell suspension and finally magnetic and/or FACS sorting of the cell populations of interest.

O isolamento de células dendríticas mielóides e células epiteliais de timo humano

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these glycoprotein &#8216;spikes&#8217; is often technically challenging but important for understanding viral pathogenesis and in drug design. Here, a protocol is presented for viral spike structure determination through computational averaging of electron cryo-tomography data. Electron cryo-tomography is a technique in electron microscopy used to derive three-dimensional tomographic volume reconstructions, or tomograms, of pleomorphic biological specimens such as membrane viruses in a near-native, frozen-hydrated state. These tomograms reveal structures of interest in three dimensions, albeit at low resolution. Computational averaging of sub-volumes, or sub-tomograms, is necessary to obtain higher resolution detail of repeating structural motifs, such as viral glycoprotein spikes. A detailed computational approach for aligning and averaging sub-tomograms using the Jsubtomo software package is outlined. This approach enables visualization of the structure of viral glycoprotein spikes to a resolution in the range of 20-40 &#197; and study of the study of higher order spike-to-spike interactions on the virion membrane. Typical results are presented for Bunyamwera virus, an enveloped virus from the family Bunyaviridae. This family is a structurally diverse group of pathogens posing a threat to human and animal health.

An approach is presented for determining structures of viral membrane glycoprotein complexes using a combination of electron cryo-tomography and sub-tomogram averaging with the computational package Jsubtomo.

Calculando a média de Viral glicoproteína do envelope Spikes de Electron Cryotomography reconstruções com Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Isolation of Leukocytes from the Human Maternal-fetal Interface

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua parietalis). This interface is the anatomical site of contact between maternal and fetal tissues; therefore, it is an immunological site of action during pregnancy. Infiltrating leukocytes at the maternal-fetal interface play a central role in implantation, pregnancy maintenance, and timing of delivery. Therefore, phenotypic and functional characterizations of these leukocytes will provide insight into the mechanisms that lead to&#160;pregnancy disorders. Several protocols have been described in order to isolate infiltrating leukocytes from the decidua basalis and decidua parietalis; however, the lack of consistency in the reagents, enzymes, and times of incubation makes it difficult to compare these results. Described herein is&#160;a novel approach that combines the use of gentle mechanical and enzymatic dissociation techniques to preserve the viability and integrity of extracellular and intracellular markers in leukocytes isolated from the human tissues at the maternal-fetal interface. Aside from immunophenotyping, cell culture, and cell sorting, the future applications of this protocol are numerous and varied. Following this protocol, the isolated leukocytes can be used to determine DNA methylation, expression of target genes, in vitro leukocyte functionality (i.e., phagocytosis, cytotoxicity, T-cell proliferation, and plasticity, etc.), and the production of reactive oxygen species at the maternal-fetal interface. Additionally, using the described protocol, this laboratory has been able to describe new and rare leukocytes at the maternal-fetal interface.

Described herein is a protocol to isolate and further study the infiltrating leukocytes of the decidua basalis and decidua parietalis - the human maternal-fetal interface. This protocol maintains the integrity of cell surface markers and yields enough viable cells for downstream applications as proven by flow cytometry analysis.

Isolamento de Leucócitos do Human Interface materno-fetal

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua ...

Isolation of Sertoli Cells and Peritubular Cells from Rat Testes

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of puberty - more than ten years after the establishment of systemic immune tolerance. Spermatogenic cells express a number of proteins that may be seen as non-self by the immune system. The testis must then be able to establish tolerance to these neo-antigens on the one hand but still be able to protect itself from infections and tumor development on the other hand. Therefore the testis is one of a few immune privileged sites in the body that tolerate foreign antigens without evoking a detrimental inflammatory immune response. Sertoli cells play a key role for the maintenance of this immune privileged environment of the testis and also prolong survival of cotransplanted cells in a foreign environment. Therefore primary Sertoli cells are an important tool for studying the immune privilege of the testis that cannot be easily replaced by established cell lines or other cellular models. Here we present a detailed and comprehensive protocol for the isolation of Sertoli cells - and peritubular cells if desired - from rat testes within a single day.

Primary Sertoli cells are required for studying testis-immune privilege, signal transduction during inflammation or infection, and utilization of their immunoprotective properties. Here we describe an enzyme-based protocol for the isolation of highly purified primary Sertoli cells and peritubular cells from rat testes.

Isolamento de células de Sertoli e as células de rato peritubular Testículos

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the person-to-person route or indirectly through environmental surfaces or food, contaminated fomites and inanimate surfaces are important vehicles for the spread of the virus during norovirus outbreaks.
We developed and evaluated a protocol using macrofoam swabs for the detection and typing of human noroviruses from hard surfaces. Compared with fiber-tipped swabs or antistatic wipes, macrofoam swabs allow virus recovery (range 1.2-33.6%) from toilet seat surfaces of up to 700 cm2. The protocol includes steps for the extraction of the virus from the swabs and further concentration of the viral RNA using spin columns. In total, 127 (58.5%) of 217 swab samples that had been collected from surfaces in cruise ships and long-term care facilities where norovirus gastroenteritis had been reported tested positive for GII norovirus by RT-qPCR. Of these 29 (22.8%) could be successfully genotyped. In conclusion, detection of norovirus on environmental surfaces using the protocol we developed may assist in determining the level of environmental contamination during outbreaks as well as detection of virus when clinical samples are not available; it may also facilitate monitoring of effectiveness of remediation strategies.

A macrofoam based sampling methodology was developed and evaluated for the detection and quantification of norovirus on environmental hard surfaces.

Swab método de amostragem para a detecção do norovírus Humano em Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

Isolation of Dendritic Cells from the Human Female Reproductive Tract for Phenotypical and Functional Studies

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low numbers of DCs present per tissue. Yet, as the phenotype and function of DCs is modified by the tissue environment, it is necessary to analyze tissue resident DC populations, since blood derived DCs incompletely reflect the complexities of DCs in tissues. Here we present a protocol to isolate DCs from the human female reproductive tract (FRT) using hysterectomy specimens that allows both phenotypical and functional analyses. The protocol consists of tissue digestion to generate a single cell mixed cell suspension, followed by positive magnetic bead selection. Our tissue digestion protocol does not cleave surface markers, which allows phenotypical and functional analysis of DCs in the steady state, without overnight incubation or cell activation. This protocol can be adapted for the isolation of other immune cell types or isolation of DCs from other tissues.

We describe here a method to isolate and purify dendritic cells from different anatomical compartments in the human female reproductive tract for the evaluation of their phenotypical and functional characteristics. This method can be adapted to isolate other immune cells or dendritic cells from other mucosal tissues.

Isolamento de células dendríticas do tracto reprodutivo feminino humano para estudos fenotípica e funcionais

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor response to insulin, local hypoxia, and inflammation. By stimulating the differentiation of functional white adipocytes from progenitors, radical hypertrophy of the adipocyte population can be prevented and, consequently, the metabolic health of adipose tissue can be improved along with a reduction of inflammation. Also, by stimulating a differentiation of beige/brown adipocytes, the total body energy expenditure can be increased, resulting in weight loss. This approach could prevent the development of obesity co-morbidities such as type 2 diabetes and cardiovascular disease.
This paper describes the isolation, expansion, and differentiation of white and beige adipocytes from a subset of human adipose tissue endothelial cells that co-express the CD31 and CD34 markers. The method is relatively cheap and is not labor-intensive. It requires access to human adipose tissue and the subcutaneous depot is suitable for sampling. For this protocol, fresh adipose tissue samples from morbidly obese subjects [body mass index (BMI) &#62;35] are collected during bariatric surgery procedures. Using a sequential immunoseparation from the stromal vascular fraction, enough cells are produced from as little as 2&#8211;3 g of fat. These cells can be expanded in culture over 10&#8211;14 days, can be cryopreserved, and retain their adipogenic properties with passaging up to passage 5&#8211;6. The cells are treated for 14 days with an adipogenic cocktail using a combination of human insulin and the PPAR&#947; agonist-rosiglitazone.
This methodology can be used for obtaining proof of concept experiments on molecular mechanisms that drive adipogenic responses in adipose endothelial cells, or for screening new drugs that can enhance the adipogenic response directed either towards white or beige/brown adipocyte differentiation. Using small subcutaneous biopsies, this methodology can be used to screen out non-responder subjects for clinical trials aimed to stimulate beige/brown and white adipocytes for the treatment of obesity and co-morbidities.

The differentiation of white and beige adipocytes from adipose tissue vascular progenitors bears potential for metabolic improvement in obesity. We describe protocols for a CD34+CD31+ endothelial cell isolation from human fat and for a subsequent in vitro expansion and differentiation into white and beige adipocytes. Several downstream applications are discussed.

Isolamento, expansão e indução de Adipogenic de CD34 + CD31 + células endoteliais de tecido adiposo humano de Omental e subcutâneo

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...