Los autores desean agradecer a Kristen Bullard-Feibelman, a Milena Veselinovic ya Claudia Rückert por su ayuda en la caracterización del virus derivado de clones. Este trabajo fue apoyado en parte por subvenciones del Instituto Nacional de Alergias y Enfermedades Infecciosas, NIH bajo las concesiones AI114675 (BJG) y AI067380 (GDE).

1. Transformación y recuperación de plásmidos de clones infecciosos <ol><li> Transformar ambos plásmidos (por separado) utilizando un protocolo de transformación comercial ( por ejemplo , NEB 5 Minute Transformation Protocol) con algunas modificaciones. Ambos plásmidos contienen un gen que codifica la resistencia a ampicilina, por lo tanto, usan ampicilina o carbenicilina para la selección. Se prefiere la carbenicilina, ya que es más estable. <ol><li> Retirar las células (ver tabla de materiales) de -80 ° C congelador y descongelar en hielo durante 5-10 min. Caldo de lysogénesis pre-calcinado (LB) (conteniendo 10 g / L de NaCl y 25 μg / mL de carbenicilina, llamado LB-carb) y el caldo con catabolita (SOC (sin antibióticos) - a 37 ° C. </li><li> Añadir entre 100 pg-10 ng en 1 μl de ADN plasmídico a un tubo que contenga 50 μl de células competentes; Mezcle suavemente haciendo chasquear el tubo. </li><li> Incubar los tubos en hielo durante 5 min. </li><li> Tubos de choque térmico a 42 ° C durante 30 sEn un baño de agua. Regrese al hielo por 2 minutos inmediatamente después del choque térmico. </li><li> Pipetee 950 μL de temperatura ambiente en cada tubo y mezcle por pipeteado. Se disemina 100 μL de la mezcla bacteriana sobre una placa de LB-carb e incuba durante la noche a 37 ° C (aproximadamente 12-14 h). </li></ol></li><li> Quitar las placas de 37 ° C incubadora después de 12-14 h de incubación. Colocar las placas en un cajón oscuro a temperatura ambiente para permitir que las colonias continúen creciendo (aproximadamente 8-9 h). </li><li> Utilizando 5 mL de Caldo Terrific (TB, que contiene 25 μg / mL de carbenicilina, llamado TB-carb), crecen 5-10 pequeñas colonias para cada plásmido durante la noche a 30 ° C en un agitador bacteriano (aproximadamente 14-16 h). NOTA: Las colonias pequeñas son un indicador de que el plásmido está intacto; Las colonias con plásmidos que contienen delecciones, reordenamientos o mutaciones (en lo sucesivo denominados eventos de inestabilidad) crecerán más rápidamente y, por tanto, serán más grandes. Por lo tanto, uno debe tratar de recoger las colonias más pequeñas en la placa, específicamente noT seleccionando las colonias más grandes presentes. También se pueden seleccionar algunas colonias de tamaño medio para que sean completas. La temperatura más baja utilizada reduce la probabilidad de que las células crezcan demasiado (DO 600 de más de 0,6-0,8). Como la mayoría de los investigadores realizan crecimiento durante la noche, permite más control y menor probabilidad de crecimiento excesivo. </li><li> Compruebe si hay turbidez en los cultivos líquidos (aproximadamente DO 600 de 0,6-0,8). Coloque los tubos turbios a 4 ° C y permita que otros tubos se vuelvan turbios creciendo por más tiempo. NOTA: No cultivar bacterias a valores de DO 600 mayores de lo recomendado, ya que pueden ocurrir eventos de inestabilidad plasmídica. </li><li> Extraer el ADN del plásmido de las bacterias con un kit comercial de miniprep de plásmido (Ver Tabla de Materiales). Eluir en 15 μL de tampón de elución precalentado (hasta 70 ° C en un bloque de calentamiento). Dejar que el tampón de elución se incube en la columna durante 5 minutos antes de la centrifugación. NOTA: Preserve al menos 1 mL de este cultivo de arranque a 4 ° C paraUso adicional en la siguiente etapa. </li><li> Digerir 10 μL de los plásmidos recuperados para evaluar si los eventos de inestabilidad del plásmido se produjeron durante el cultivo. NOTA: Digerir p1 con SalI / NheI y p2 con BamHI / HindIII a 37 ° C durante 1 h. Confirme la presencia de las bandas correctas después de la digestión ( Figura 2a ) por electroforesis en gel y continúe con el paso 2. Si se prepara ADN de plásmido mediante amplificación en círculo rodante (RCA), reserve parte del eluido de miniprep para servir como molde. </li></ol> 2. Preparación de ADN plasmídico suficiente para la ligadura NOTA: La ligadura y la electroporación subsecuente requieren una cantidad suficiente de ADN plasmídico que debe generarse a través de maxiprep o RCA. Mientras que el maxiprep es el enfoque tradicionalmente utilizado, RCA ofrece la ventaja de no requerir bacterias, eliminando así el potencial de toxicidad inducida por plásmidos en bacterias que pueden dar lugar a eventos de inestabilidad. <ol><li><stRong&gt; Realice el siguiente procedimiento maxiprep. <ol><li> Para cada plásmido que demostró el patrón de digestión de la enzima de restricción correcto en la sección anterior, añadir 500 μl de cultivo de arranque a 1 L de caldo de TB-Carb (25 μg / mL de carbenicilina) y agitar durante la noche a 30 ° C (aproximadamente 14-16 h , Aproximadamente OD $ _ $ de 0,6-0,8). NOTA: No permita que el cultivo crezca sobre este valor de OD 600 . Esto resultará potencialmente en eventos de inestabilidad dentro de los plásmidos. </li><li> Coseche las bacterias y realice maxipreps por el protocolo del fabricante (véase la tabla de materiales). </li></ol></li><li> Utilizando el miniprep guardado desde el paso 1.6, realice lo siguiente para el procedimiento RCA. <ol><li> Transferir 1 μl de ADN plasmídico a un tubo que contenga 50 μl de tampón de muestra. </li><li> Desnaturalizar por calor la muestra a 95 ° C durante 3 min, e incubar después a 4 ° C hasta que esté listo para usar. </li><li> Preparar la amplificación comercialPremezcla (ver tabla de materiales ). Se combinan 50 μl de tampón de reacción con 2 μl de mezcla enzimática en un conjunto de tubos sobre hielo. NOTA: La premezcla de amplificación debe mantenerse en hielo hasta que esté lista para su uso. Es conveniente preparar una mezcla maestra combinando reactivos suficientes para el número requerido de reacciones de amplificación. Cualquier premezcla no utilizada debe desecharse. </li><li> Transferir 50 μl de premezcla de amplificación preparada a la muestra desnaturalizada. </li><li> Incubar los tubos de reacción a 30 ° C durante 18 h. </li><li> Incubar los tubos a 65 ° C durante 10 min para inactivar la DNA polimerasa ø29. </li><li> Guarde los tubos de reacción a 4 ° C o -20 ° C hasta que estén listos para su uso. NOTA: En este punto, se debe cuantificar el ADN plasmídico preparado a través de ambos métodos (utilizando absorbancia a 260 nm) y el genoma ZIKV debe ser secuenciado completamente por Sanger para confirmar que no ocurrieron eventos de inestabilidad (deleciones y reordenamientos) durante la preparación. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Primer Nombre </td><td> Secuencia (5 &#39;- 3&#39;) </td></tr><tr><td> ZIKV PRVABC59 1Para. </td><td> AGTTGTTGATCTGTGTGAATCAGAC </td></tr><tr><td> ZIKV Conservado 632Para. </td><td> GCCCTATGCTGGATGAGG </td></tr><tr><td> ZIKV Conserved 692Rev. </td><td> GGTTCCGTACACAACCCAAGTTG </td></tr><tr><td> ZIKV Conservado 1313Rev. </td><td> CTCCCTTTGCCAAAAAGTCCACA </td></tr><tr><td> ZIKV Conservado 1201Para. </td><td> CCAACACAAGGTGAAGCCTAC </td></tr><tr><td> ZIKV conservado 1663For. </td><td> GCAGACACCGGAACTCCACACT </td></tr><tr><td> ZIKV Conservado 2008For. </td><td> CAGATGGCGGTGGACATGC </td></tr><tr><td> ZIKV Conservado 2350Rev. </td><td> GTGAGAACCAGGACATTCCTCC </td></tr><tr><td> ZIKV conservado 2605 para. </td><td> TACAAGTACCATCCTGACTCCC </td></tr><tr><td> ZIKV Conservado 3499Rev. </td><td>GCCTTATCTCCATTCCATACCA </td></tr><tr><td> ZIKV Conservado 3961Rev. </td><td> TTGCCAACCAGGCCAAAG </td></tr><tr><td> ZIKV Conservado 4132Para. </td><td> CATTTGTCATGGCCCTGG </td></tr><tr><td> ZIKV Conservado 4561Rev. </td><td> CTATTGGGTTCATGCCACAGAT </td></tr><tr><td> ZIKV conservado 4665For. </td><td> GACCACAGATGGAGTGTACAGAGT </td></tr><tr><td> ZIKV Conservado 5189Rev. </td><td> AAGACAGTTAGCTGCTTCTTCTTCAG </td></tr><tr><td> ZIKV conservado 5219For. </td><td> GAGAGTTCTTCCTGAAATAGTCCGTGA </td></tr><tr><td> ZIKV Conservado 6086Rev. </td><td> CTTGCTTCAAGCCAGTGTGC </td></tr><tr><td> ZIKV Conservado 6119Para. </td><td> GCCTCATAGCCTCGCTCTATCG </td></tr><tr><td> ZIKV Conservado 6721Rev. </td><td> CCATTCCAAAGCCCATCTTCCC </td></tr><tr><td> ZIKV Conservado 6769Para. </td><td> CCAGCCAGAATTGCATGTGTCC </td></tr><tr><td> ZIKV Conservado 7209Rev. </td><td> ATCATTAGCAGCGGGACTCCAA </td></tr><tr><td> ZIKV Conservado 7343Para. </td><td> GTTGTGGATGGAATAGTGGT </td></tr><tr><td> ZIKV conservado 8243Para. </td><td> TGCCCATACACCAGCACTATGA </td></tr><tr><td> ZIKV PRVABC59 8893Rev. </td><td> TGCATTGCTACGAACCTTGTTG </td></tr><tr><td> ZIKV conservado 9133For. </td><td> AGCCCTTGGATTCTTGAACGAGGA </td></tr><tr><td> ZIKV PRVABC59 9673Rev. </td><td> AACGCAATCATCTCCACTGACT </td></tr><tr><td> ZIKV Conservado 9686Para. </td><td> GATGATAGGTTTGCACATGCC </td></tr><tr><td> ZIKV Conservado 10321Rev. </td><td> GTCCATGTACTTTTCTTCATCACCTAT </td></tr><tr><td> ZIKV Conservado 10455Para. </td><td> CAGGAGAAGCTGGGAAACC </td></tr><tr><td> ZIKV Conservado 10621Rev. </td><td> CAGATTGAAGGGTGGGGAAGGTC </td></tr></tbody></table> TABLA 1: Cebadores para la secuenciación de clones de cDNA. Los plásmidos pueden secuenciarse completamente con los cebadores enumerados. Primers marcados como &quot;conservados&quot; indiQue son capaces de secuenciar / amplificar todos los genotipos de ZIKV. Primers etiquetados como &quot;PRVABC59&quot; son específicos de esta cepa, pero también puede trabajar para otras cepas de genotipo asiático y, posiblemente, otros genotipos. 3. Preparación del ARN transcrito in vitro <ol><li> Establecer la reacción de digestión de maxiprep o RCA preparado ADN. <ol><li> Para la digestión con p1, mezclar 10 μl de tampón de reacción 10x, 3 μl de ApaLI, 3 μl de BamHI-HF, 3 μl de rSAP o CIP y 3,3 μg de ADN p1. Añadir ddH $ ₂ $ O a 100 μl. </li><li> Para la digestión con p2, mezclar 10 μl de tampón de reacción 10x, 3 μl de ApaLI, 3 μl de EcoRI-HF y 13,3 μg de ADN p2. Añadir ddH $ ₂ $ O a 100 μl. </li><li> Incubar a 37 ° C durante 1-2 h. </li><li> Purificar usando un gel comercial y un kit de limpieza de PCR (Ver Tabla de Materiales). Eluir en 30 μl de tampón de elución precalentado a 70 ° C en un bloque de calentamiento (incubar elColumna durante 5 min antes de hilar). NOTA: Mantenga 1 μL para que funcione en un gel más tarde. </li></ol></li><li> Preparar la reacción de ligadura. <ol><li> Se combinan 10 μl de tampón de reacción de ligación de ADN T4 10x, 3 μl de ADN ligasa T4 (400 U / μl), 29 μL de p1 purificado y 29 μL de p2 purificado. Añadir ddH $ ₂ $ O a 100 μl. </li><li> Incubar a temperatura ambiente durante 2 h o 16 ° C durante la noche. </li><li> Purificar usando un gel comercial y un kit de limpieza de PCR (Ver Tabla de Materiales). Eluir en 10 μl de tampón de elución precalentado a 70 ° C en un bloque de calentamiento (incubar la columna durante 5 minutos antes de centrifugar). NOTA: Mantenga 1 μL para que funcione en un gel más tarde. </li></ol></li><li> Ejecutar plásmidos no digeridos, plásmidos digeridos y ligación en un gel de agarosa. El producto de ligación debe tener una banda de mayor peso molecular (alrededor de 11 kb) que cualquiera de los plásmidos digeridos solo, lo que indica que la ligación fue exitosa ( Figura 2b ).</li><li> Establecer T7 reacción de transcripción in vitro . <ol><li> Combinar 10 μL 2x ARCA / NTP Mix, 2 μL de T7 RNA polimerasa y 8 μL de la reacción de ligación purificada para un volumen final de 20 μL. NOTA: El ARCA incluido en la mezcla es un análogo de tapa que se incorpora exclusivamente en la orientación correcta. Los análogos de tapa estándar pueden dar como resultado que sólo ~ 50% de los transcritos tengan una tapa en la orientación correcta. </li><li> Incubar durante 4 h a 37 ° C. </li><li> Medir la concentración de ARN a través de un espectrofotómetro UV. Opcionalmente, ejecute un gel de agarosa desnaturalizante para confirmar la longitud del transcrito de ARN. </li></ol></li></ol> 4. Rescate del Virus Infeccioso por Electroporación <ol><li> Días antes de la electroporación, se prepara un matraz T182 de células Vero (entre T150 y T182 es aceptable, se desarrolla en DMEM + suero bovino fetal al 10% (FBS)) por constructo que se va a recuperar. Incluir 1 T182 como un control de transfección simulada. CeLls debe utilizarse en un 70-80% de confluencia. </li><li> Cuando las células estén listas, coloque 12 ml / reacción de DMEM + 15% de FBS + 10 mM de HEPES en un baño de agua calentado a 37 ° C. </li><li> Se separan las células por tripsinización con un protocolo estándar y se recuperan las células en medio con FBS al 10% para inactivar tripsina; Centrifugar las células a 150 xg durante 5 min a 4 ° C. </li><li> Lavar las células en 1x solución salina tamponada con fosfato (PBS), sedimentar las células a 150 xg durante 5 min a 4 ° C. Repita este paso dos veces para un total de tres lavados. </li><li> Resuspender las células en 200 μ l de RPMI 1640 + 10 mM HEPES (estéril) por # de muestras. Transferir 200 μl de suspensión celular a un tubo estéril. Las células deben ser ~ 0,5 x 10 7 células / mL. </li><li> Añadir 20 μl de agua (control negativo simulador) o 20 μL de ARN (preferiblemente 5-10 μg) producido en la etapa 3.4 a cada conjunto de células. Mezclar suavemente golpeando el tubo y transferir el contenido del tubo a una cubeta de electroporación de espacio de 2 mm. </li><li> Establecer una electrOporator a 170 V LV, omega (resistencia) a 0 y 950 μF (aproximadamente 625 V / cm y 20 ms de constante de tiempo para otras máquinas). Ajuste la resistencia al valor más bajo disponible, ya sea 0 o ∞ si está disponible. </li><li> Pulse una vez e inmediatamente añada 600 μL de DMEM + 15% de FBS + 10 mM de HEPES que se calentó en el paso 4.2. Enjuague el interior de la cubeta a fondo para eliminar todas las células. Se añaden células a un matraz de cultivo de tejido T75 que contiene 10 ml de medio precalentado. Retire los medios adicionales de la cubeta usando el cuentagotas que se incluye con la cubeta. Tenga cuidado de mantener la esterilidad. </li><li> Frasco de remolino para mezclar los medios y las células y colocar en incubadora a 37 ° C. </li><li> Compruebe el día siguiente para la viabilidad celular, y hacerlo todos los días hasta 50-75% de muerte celular se observa. La muerte celular se observa comparando con el control electroporado simulado. NOTA: El efecto citopático ZIKV (CPE) es bastante pronunciado en células Vero, dando lugar a células redondeadas que se separan y flotan en el medio de cultivo. TenemosObservó un rango de 8-10 días como ideal para la cosecha. </li><li> Colocar el sobrenadante en un tubo cónico y centrifugar para eliminar los desechos celulares a&gt; 3.000 xg durante 10 min a 4 ° C. </li><li> Eliminar el sobrenadante clarificado a un nuevo tubo y completar con una concentración final de FBS al 20% (a partir de 100% de stock). Adicionalmente, se añade HEPES estéril a una concentración final de 10 mM como agente tamponador para preservar la infectividad del virus mientras se congela (a partir de un stock estéril 1 M). </li><li> Mezcle el virus agitando vórtice y alícuota en viales de tapa roscada. Almacenar a -80 ° C para uso futuro. </li></ol> 5. Titulación del virus recuperado <ol><li> Sembrar el número apropiado de placas de 6 o 12 pocillos de células Vero el día antes de la titulación. </li><li> Eliminar el virus del congelador y hacer diluciones en serie de 10 veces en DMEM + 2% de FBS en tubos o placas de 96 pocillos. NOTA: El título esperado de clones recuperados está entre 1 x 10 6 y 5 x 10 7 PFU / mL. </li><li> Añadir 200 oR 400 μl de cada dilución en duplicado a un pocillo de una placa de 12 ó 6 pocillos, respectivamente. </li><li> Coloque las placas en una incubadora a 37 ° C y roca cada 15 min, durante un período de adsorción total de ~ 1-1,5 h. </li><li> Elimine el inóculo viral y añada 1 mL de recubrimiento de DMEM-Tragacanto de (12 pocillos) o 2 mL (6 pocillos) a cada pocillo. NOTA: Es posible utilizar agarosa, agar, metilcelulosa u otros medios de recubrimiento aquí. </li><li> Incubar las células en un incubador a 37 ° C durante 5 días. El tiempo para la formación adecuada de placa variará dependiendo de la superposición utilizada. </li><li> Para fijar las células, retire las placas de la incubadora y decántela suavemente en desinfectante. </li><li> Añadir suficiente 20% de etanol / 0,1% de violeta de cristal (CV) a cada pocillo para cubrir y remolinar para mezclar. NOTA: Existen muchos otros fijadores y se pueden utilizar aquí. Además, si se utiliza una capa de agarosa o agar, puede utilizarse una segunda capa de recubrimiento junto con un rojo neutro para visualizar las placas sin fijación. El 20% de etanol ha demostrado serEficaces en la inactivación de virus envueltos en estudios previos; No utilice esta cantidad para los virus no envueltos ya que no serán inactivados 19 . </li><li> Incubar las placas durante 30-60 min a temperatura ambiente (en un gabinete de bioseguridad de clase II); Desechar el CV (según las regulaciones locales) y lavar los platos con agua del grifo. </li><li> Permita que las placas se sequen y cuente manualmente las placas. NOTA: La referencia 20 puede usarse como una referencia adicional para realizar ensayos de placa. </li></ol>

<ol>
	<li>Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika:+the+origin+and+spread+of+a+mosquito-borne+virus.">Zika: the origin and spread of a mosquito-borne virus.</a> Bull World Health Organ. 94 (9), 675C-686C (2016).</li><li>Oehler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+infection+complicated+by+Guillain-Barre+syndrome--case+report,+French+Polynesia,+December+2013.">Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013.</a> Euro Surveill. 19 (9), (2014).</li><li>Li, D., Aaskov, J., Lott, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+cryptic+prokaryotic+promoter+within+the+cDNA+encoding+the+5'+end+of+dengue+virus+RNA+genome.">Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.</a> PLoS One. 6 (3), e18197 (2011).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+approach+to+propagate+flavivirus+infectious+cDNA+clones+in+bacteria+by+introducing+tandem+repeat+sequences+upstream+of+virus+genome.">A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome.</a> J Gen Virol. 95 (Pt 7), 1493-1503 (2014).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+propagation+of+flavivirus+infectious+cDNAs+by+a+novel+method+to+reduce+the+cryptic+bacterial+promoter+activity+of+virus+genomes.">Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes.</a> J Virol. 85 (6), 2927-2941 (2011).</li><li>Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+of+infectious+yellow+fever+RNA+from+full-length+cDNA+templates+produced+by+in+vitro+ligation.">Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation.</a> New Biol. 1 (3), 285-296 (1989).</li><li>Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+reverse+genetics+system+for+Japanese+encephalitis+virus.">Development and application of a reverse genetics system for Japanese encephalitis virus.</a> J Virol. 77 (11), 6450-6465 (2003).</li><li>Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+major+determinant+of+mouse+neurovirulence+of+dengue+virus+type+2+using+stably+cloned+genomic-length+cDNA.">Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA.</a> J Gen Virol. 79 (Pt 3), 437-446 (1998).</li><li>Johansen, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intron+insertion+facilitates+amplification+of+cloned+virus+cDNA+in+Escherichia+coli+while+biological+activity+is+reestablished+after+transcription+in+vivo.">Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo.</a> Proc Natl Acad Sci U S A. 93 (22), 12400-12405 (1996).</li><li>Shan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Infectious+cDNA+Clone+of+Zika+Virus+to+Study+Viral+Virulence,+Mosquito+Transmission,+and+Antiviral+Inhibitors.">An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors.</a> Cell Host Microbe. 19 (6), 891-900 (2016).</li><li>Schwarz, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rescue+of+the+1947+Zika+Virus+Prototype+Strain+with+a+Cytomegalovirus+Promoter-Driven+cDNA+Clone.">Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone.</a> mSphere. 1 (5), (2016).</li><li>Tsetsarkin, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Full-Length+Infectious+cDNA+Clone+of+Zika+Virus+from+the+2015+Epidemic+in+Brazil+as+a+Genetic+Platform+for+Studies+of+Virus-Host+Interactions+and+Vaccine+Development.">A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development.</a> MBio. 7 (4), (2016).</li><li>Gadea, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+method+for+the+rapid+generation+of+recombinant+Zika+virus+expressing+the+GFP+reporter+gene.">A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene.</a> Virology. 497, 157-162 (2016).</li><li>Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+characterization+of+an+infectious+dengue+virus+type-2+RNA+genome+(New+Guinea+C+strain).">Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain).</a> Gene. 162 (2), 175-180 (1995).</li><li>Messer, W. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+characterization+of+a+reverse+genetic+system+for+studying+dengue+virus+serotype+3+strain+variation+and+neutralization.">Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization.</a> PLoS Negl Trop Dis. 6 (2), e1486 (2012).</li><li>Kinney, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avian+virulence+and+thermostable+replication+of+the+North+American+strain+of+West+Nile+virus.">Avian virulence and thermostable replication of the North American strain of West Nile virus.</a> J Gen Virol. 87 (Pt 12), 3611-3622 (2006).</li><li>Chang, A. C., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+amplifiable+multicopy+DNA+cloning+vehicles+derived+from+the+P15A+cryptic+miniplasmid.">Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.</a> J Bacteriol. 134 (3), 1141-1156 (1978).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. 91 (1), (2017).</li><li>Roberts, P. L., Lloyd, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus+inactivation+by+protein+denaturants+used+in+affinity+chromatography.">Virus inactivation by protein denaturants used in affinity chromatography.</a> Biologicals. 35 (4), 343-347 (2007).</li><li>Baer, A., Kehn-Hall, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+concentration+determination+through+plaque+assays:+using+traditional+and+novel+overlay+systems.">Viral concentration determination through plaque assays: using traditional and novel overlay systems.</a> J Vis Exp. (93), e52065 (2014).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. , (2016).</li><li>Grubaugh, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Drift+during+Systemic+Arbovirus+Infection+of+Mosquito+Vectors+Leads+to+Decreased+Relative+Fitness+during+Host+Switching.">Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching.</a> Cell Host Microbe. 19 (4), 481-492 (2016).</li></ol>

Los autores no tienen nada que revelar.

Here we describe a method for the recovery of a bipartite infectious cDNA clone system for ZIKV. Previously described clones for ZIKV suffer from either attenuation or require the addition of introns, making plasmids larger and preventing rescue in insect cells. Infectious virus can be recovered using the two-plasmid clone system in either mammalian or insect cells (data not shown). In addition, virus recovered from this system behaves similarly to wild-type virus in several cell lines, in an immunocompromised mouse mode...

El virus Zika (ZIKV, Familia Flaviviridae : Género Flavivirus ) es un flavivirus transmitido por mosquitos que llegó a Brasil en 2013-14 y posteriormente se asoció con un brote masivo de enfermedad febril que se extendió a través de las Américas 1 . Además, ZIKV se ha relacionado con graves resultados de la enfermedad, como el síndrome de Guillain-Barré en adultos y microcefalia en fetos y neonatos [ 2] . Poco se sabía acerca de ZIKV antes de su rápida propagación en el hemisferio occidental. Esto incluyó la falta de herramientas moleculares, dificultando así la investigación mecanicista. Las herramientas moleculares para los virus, como los clones de cDNA infecciosos, facilitan el desarrollo terapéutico de las vacunas y antivirales y permiten la evaluación de factores genéticos virales relacionados con la patogénesis viral diferencial, la respuesta inmune y la evolución viral. Se sabe que los clones infecciosos de flavivirus son altamente inestables en bacterias debido a crY promotores prokaryotic yptic presentes en sus genomas 3 . Se han utilizado varios enfoques para mitigar este problema; Incluyendo la inserción de repeticiones en tándem aguas arriba de las secuencias víricas 4 , mutación de las secuencias putativas del promotor procariótico 5 , división del genoma en múltiples plásmidos 6 , vectores de bajo número de copias (incluidos los cromosomas artificiales bacterianos) 7 , 8 e inserción de intrones en el genoma viral 9 . Se ha descrito un sistema de longitud completa sin modificaciones para ZIKV; Sin embargo, este clon parecía estar atenuado en cultivo celular y en ratones 10 . Otros grupos han introducido intrones en el genoma ZIKV, permitiendo la interrupción de secuencias inestables en bacterias que pueden ser empalmadas en células de mamíferos in vitro para la producción de virus infeccioso 11, 12 . Además, se ha utilizado con éxito un sistema basado en PCR denominado Infectious Subgenomic-Amplicons para rescatar la cepa MR766 de ZIKV 13 . El enfoque aquí descrito no requiere secuencias foráneas, sino que altera el genoma en la región de alta inestabilidad mediante el uso de múltiples plásmidos, que se ha utilizado previamente con éxito con la fiebre amarilla 6 , dengue 14 , 15 y virus del Nilo Occidental 16 . Además, la adición de la secuencia de ribozima de hepatitis D en los extremos genómicos víricos facilita la creación de un extremo 3 &#39;auténtico sin la necesidad de la adición de un sitio de linealización. Además, ambos plásmidos se construyen en un vector de número de copias bajas (pACYC177, ~ 15 copias por célula) para mitigar cualquier toxicidad residual 17 . El virus recuperado muestra un perfil de crecimiento comparable alParental en curvas de crecimiento in vitro en 8 líneas celulares que comprenden una variedad de tipos de células derivadas de mamíferos e insectos, y ha exhibido perfiles patógenos idénticos en ratones y tasas de infección, diseminación y transmisión en mosquitos 18 . En el presente documento, detallamos un protocolo que describe cómo cultivar los plásmidos de clones infecciosos, genera ARN viral de longitud completa (el genoma viral) in vitro y recupera el virus infeccioso en cultivo celular. En primer lugar, se describe la propagación de los plásmidos en bacterias o sin bacterias de amplificación mediante amplificación de círculo de rodadura (RCA). A continuación, se muestra cómo se digieren los dos plásmidos y luego se ligan entre sí para generar el virus de longitud completa. Por último, se describe la producción de ARN transcrito y su posterior electroporación en células Vero, seguido de la valoración del virus recuperado ( Figura 1 ]. El enfoque descrito es rápido,R recuperación de las poblaciones de virus infecciosos en 1-2 semanas.

<table><tbody><tr><td>NEB Stable CompetentE. coli</td><td>New England BioLabs</td><td>C3040H</td><td></td></tr><tr><td>Carbenicillin, Disodium Salt</td><td>various</td><td></td><td></td></tr><tr><td>Zyppy Plasmid Miniprep Kit</td><td>Zymo Research</td><td>D4036</td><td></td></tr><tr><td>ZymoPURE Plasmid Maxiprep Kit</td><td>Zymo Research</td><td>D4202</td><td></td></tr><tr><td>SalI-HF</td><td>New England BioLabs</td><td>R3138S</td><td>20,000 units/ml</td></tr><tr><td>NheI-HF</td><td>New England BioLabs</td><td>R3131S</td><td>20,000 units/ml</td></tr><tr><td>ApaLI</td><td>New England BioLabs</td><td>R0507S</td><td>10,000 units/ml</td></tr><tr><td>EcoRI-HF</td><td>New England BioLabs</td><td>R3101S</td><td>20,000 units/ml</td></tr><tr><td>BamHI-HF</td><td>New England BioLabs</td><td>R3136S</td><td>20,000 units/ml</td></tr><tr><td>HindIII-HF</td><td>New England BioLabs</td><td>R3104S</td><td>20,000 units/ml</td></tr><tr><td>illustra TempliPhi 100 Amplification Kit</td><td>GE Healthcare Life Sciences</td><td>25640010</td><td></td></tr><tr><td>NucleoSpin Gel and PCR Clean-up</td><td>Macherey-Nagel</td><td>740609.5</td><td></td></tr><tr><td>Shrimp Alkaline Phosphatase (rSAP)</td><td>New England BioLabs</td><td>M0371S</td><td>1,000 units/ml</td></tr><tr><td>Alkaline Phosphatase, Calf Intestinal (CIP)</td><td>New England BioLabs</td><td>M0290S</td><td>10,000 units/ml</td></tr><tr><td>T4 DNA Ligase</td><td>New England BioLabs</td><td>M0202S</td><td>400,000units/mL</td></tr><tr><td>HiScribe T7 ARCA mRNA Kit</td><td>New England BioLabs</td><td>E2065S</td><td></td></tr><tr><td>Vero cells</td><td>ATCC</td><td>CCL-81</td><td></td></tr><tr><td>ECM 630 High Throughput Electroporation System</td><td>BTX</td><td>45-0423</td><td>Other machines are acceptable.</td></tr><tr><td>LB Broth with agar (Miller)</td><td>Sigma</td><td>L3147</td><td>Can be homemade as well.</td></tr><tr><td>Terrific Broth</td><td>Sigma</td><td>T0918</td><td>Can be homemade as well.</td></tr><tr><td>Petri Dish</td><td>Celltreat</td><td>229693</td><td></td></tr><tr><td>Culture Tubes</td><td>VWR International</td><td>60818-576</td><td></td></tr><tr><td>T75 flasks</td><td>Celltreat</td><td>229340</td><td></td></tr><tr><td>T182 flasks</td><td>Celltreat</td><td>229350</td><td></td></tr><tr><td>1x PBS</td><td>Corning</td><td>21-040-CV</td><td></td></tr><tr><td>RPMI 1640 with L-glutamine</td><td>Corning</td><td>10-040-CV</td><td></td></tr><tr><td>DMEM with L-glutamine and 4.5 g/L glucose</td><td>Corning</td><td>10-017-CV</td><td></td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Atlas Biologicals</td><td>FP-0500-A</td><td></td></tr><tr><td>Tragacanth Powder</td><td>MP Bio</td><td>MP 104792</td><td></td></tr><tr><td>Crystal Violet</td><td>Amresco</td><td>0528-1006</td><td></td></tr><tr><td>Ethanol Denatured</td><td>VWR International</td><td>BDH1156-1LP</td><td></td></tr><tr><td>6 well plate</td><td>Celltreat</td><td>229106</td><td></td></tr><tr><td>12 well plate</td><td>Celltreat</td><td>229111</td><td></td></tr><tr><td>Sequencing Oligos</td><td>IDT</td><td>see table 1</td><td></td></tr><tr><td>Qubit 3.0</td><td>ThermoFisher</td><td>Qubit 3.0</td><td>other methods are acceptable.</td></tr><tr><td>Qubit dsDNA BR Assay Kit</td><td>ThermoFisher</td><td>Q32850</td><td>other methods are acceptable.</td></tr><tr><td>Qubit RNA HS Assay Kit</td><td>ThermoFisher</td><td>Q32852</td><td>other methods are acceptable.</td></tr><tr><td>Class II Biosafety Cabinet</td><td>Varies</td><td>N/A</td><td>This is necessary for live-virus work.</td></tr></tbody></table>

rescue and characterization of recombinant virus from a new world zika virus infectious clone

Los clones de cDNA infecciosos permiten la manipulación genética de un virus, facilitando así el trabajo sobre vacunas, patogénesis, replicación, transmisión y evolución viral. Aquí se describe la construcción de un clon infeccioso para el virus Zika (ZIKV), que actualmente está causando un brote explosivo en las Américas. Para evitar la toxicidad a las bacterias que se observa comúnmente con los plásmidos derivados de flavivirus, se generó un sistema de dos plásmidos que separa el genoma en el gen NS1 y es más estable que las construcciones de longitud completa que no pudo ser recuperado con éxito sin mutaciones. Después de la digestión y la ligación para unir los dos fragmentos, ARN viral de longitud completa puede ser generado por transcripción in vitro con ARN polimerasa T7. Tras la electroporación del ARN transcrito en las células, se recuperó el virus que exhibía cinética de crecimiento in vitro similar y fenotipos de virulencia e infección in vivo en ratones y mosquitos, respectivamente.

El protocolo descrito aquí permite la recuperación de virus Zika derivados de clones infecciosos. Manipular el sistema de clones infecciosos de dos plásmidos es sencillo cuando se realiza con cuidado, en comparación con las versiones de longitud completa que son altamente inestables (datos no mostrados). Después de la digestión y la ligación de las dos piezas distintas, ARN tapado se produce utilizando la transcripción in vitro con T7 polimerasa que luego se ele...

Watch this Scientific Journal Video about Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone at JoVE.com

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Este protocolo describe la recuperación del virus Zika infeccioso a partir de un clon de ADNc infeccioso de dos plásmidos.

Rescate y Caracterización del Virus Recombinante de un Nuevo Mundo Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

rescue-characterization-recombinant-virus-from-new-world-zika-virus

Research

JoVE Journal

Immunology and Infection

9.6K vistas.  Colorado State University.  Este protocolo describe la recuperación del virus Zika infeccioso a partir de un clon de ADNc infeccioso de dos plásmidos. 

Video: Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Generación de recombinantes del virus de influenza a partir del ADN plásmido

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Investigación

Inmunología e Infección

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

Generación de Arenavirus recombinante para el Desarrollo de Vacunas de la FDA aprobados células Vero

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Virus Zika Sistema infecciosa cultivo celular y la<em&gt; In Vitro</em&gt; Profiláctica Efecto de los interferones

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and damaging the testes. During an infection with the ZIKV, immune cells have been shown to infiltrate into the tissues. However, the cellular mechanisms that define the protection and/or immunopathogenesis of these immune cells during a ZIKV infection are still largely unknown. Herein, we describe methods to evaluate the virus-specific T-cell functionality in these immunoprivileged organs of ZIKV-infected mice. These methods include a) a ZIKV infection and vaccine inoculation in Ifnar1-/- mice; b) histopathology, immunofluorescence, and immunohistochemistry assays to detect the virus infection and inflammation in the brain, testes, and spleen; c) the preparation of a tetramer of ZIKV-derived T-cell epitopes; d) the detection of ZIKV-specific T cells in the monocytes isolated from the brain, testes, and spleen. Using these approaches, it is possible to detect the antigen-specific T cells that have infiltrated into the immunoprivileged organs and to evaluate the functions of these T cells during the infection: potential immune protection via virus clearance and/or immunopathogenesis to exacerbate the inflammation. These findings may also help to clarify the contribution of T cells induced by the immunization against ZIKV.

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

A protocol to evaluate antigen-specific T-cell responses in the immunoprivileged organs of the Ifnar1-/- murine model for the Zika virus (ZIKV) infection is described. This method is pivotal for investigating the cellular mechanisms of the protection and immunopathogenesis of ZIKV vaccines and is also valuable for their efficacy evaluation.

Evaluación de respuestas de células T Zika Virus-específica en Immunoprivileged órganos de ratones- / - Ifnar1 infectados

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

Cuantificación de estimulación dependiente de los anticuerpos del Virus Zika en células humanas primarias

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...

Establishing Mouse Models for Zika Virus-induced Neurological Disorders Using Intracerebral Injection Strategies: Embryonic, Neonatal, and Adult

The Zika virus (ZIKV) is a flavivirus currently endemic in North, Central, and South America. It is now established that the ZIKV can cause microcephaly and additional brain abnormalities. However, the mechanism underlying the pathogenesis of ZIKV in the developing brain remains unclear. Intracerebral surgical methods are frequently used in neuroscience research to address questions about both normal and abnormal brain development and brain function. This protocol utilizes classical surgical techniques and describes methods that allow one to model ZIKV-associated human neurological disease in the mouse nervous system. While direct brain inoculation does not model the normal mode of virus transmission, the method allows investigators to ask targeted questions concerning the consequence after ZIKV infection of the developing brain. This protocol describes embryonic, neonatal, and adult stages of intraventricular inoculation of ZIKV. Once mastered, this method can become a straightforward and reproducible technique that only takes a few hours to perform.

Here we describe a method for establishing a model of Zika virus-induced microcephaly in mouse. This protocol includes methods for embryonic, neonatal, and adult-stage intracerebral inoculation of the Zika virus.

Establecimiento de modelos de ratón para trastornos neurológicos inducidos por el Virus Zika utilizando estrategias de inyección Intracerebral: embrionario, Neonatal y adulto

The Zika virus (ZIKV) is a flavivirus currently endemic in North, Central, and South America. It is now established that the ZIKV can cause microcephaly ...

Neurociencias

Rescue of Recombinant Zika Virus from a Bacterial Artificial Chromosome cDNA Clone

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines and/or antivirals have underscored the urgent need to develop ZIKV reverse genetic systems to facilitate the study of ZIKV biology and the development of therapeutic and/or prophylactic approaches. However, like with other flaviviruses, the generation of ZIKV full-length infectious cDNA clones has been hampered due to the toxicity of viral sequences during its amplification in bacteria. To overcome this problem, we have developed a nontraditional approach based on the use of bacterial artificial chromosomes (BACs). Using this approach, the full-length cDNA copy of the ZIKV strain Rio Grande do Norte Natal (ZIKV-RGN) is generated from four synthetic DNA fragments and assembled into the single-copy pBeloBAC11 plasmid under the control of the human cytomegalovirus (CMV) immediate-early promoter. The assembled BAC cDNA clone is stable during propagation in bacteria, and infectious recombinant (r)ZIKV is recovered in Vero cells after transfection of the BAC cDNA clone. The protocol described here provides a powerful technique for the generation of infectious clones of flaviviruses, including ZIKV, and other positive-strand RNA viruses, particularly those with large genomes that have stability problems during bacterial&#160;propagation.

The recent epidemic of Zika virus highlights the importance of establishing reverse genetic approaches to develop vaccines and/or therapeutic strategies. Here, we describe the protocol to rescue an infectious recombinant Zika virus from a full-length cDNA clone assembled in a bacterial artificial chromosome under the control of the human cytomegalovirus immediate-early promoter.

Rescate del virus del Zika recombinante de un clon de ADNc cromosómico artificial bacteriano

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines ...

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral load. The purpose of the procedure is to quantify viral titers in peripheral and CNS areas of the mouse at different time points post infection or under different experimental conditions to identify virologic and immunological factors that regulate Zika virus infection. The organ isolation procedures demonstrated allow for both focus forming assay quantification and quantitative PCR assessment of viral titers. The rapid organ isolation techniques are designed for the preservation of virus titer. Viral titer quantification by focus forming assay allows for the rapid throughput assessment of Zika virus. The benefit of the focus forming assay is the assessment of infectious virus, the limitation of this assay is the potential for organ toxicity reducing the limit of detection. Viral titer assessment is combined with quantitative PCR, and using a recombinant RNA copy control viral genome copy number within the organ is assessed with low limit of detection. Overall these techniques provide an accurate rapid high throughput method for the analysis of Zika viral titers in the periphery and CNS of Zika virus infected animals and can be applied to the assessment of viral titers in the organs of animals infected with most pathogens, including Dengue virus.

The goal of the protocol is to demonstrate the techniques used to investigate viral disease by isolating and quantifying Zika virus, from multiple organs in a mouse following infection.

Aislamiento y cuantificación del virus del Zika de múltiples órganos en un ratón

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral ...

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine the rate of infection, disseminated infection, and potential transmission of the virus in the mosquito population in question. These procedures are widely utilized with various modifications in vector competence evaluations globally. They are important in determining the potential role that a given mosquito (i.e., species, population, individual) may play in the transmission of a given agent.

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The presented protocol can determine the vector competence of Aedes aegypti mosquito populations for a given virus, such as Zika, in a containment setting.

Análisis de competencia vectorial en mosquitos Aedes aegypti con el virus Zika

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine ...

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;).

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Ensayos antivirales de alto rendimiento para detectar inhibidores de la replicación del virus del Zika

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) ...

Rescate y Caracterización del Virus Recombinante de un Nuevo Mundo Zika Virus Infectious Clone

Resumen

Explorar más videos

Capítulos en este video