Este trabajo fue apoyado por NIH AI099854 y AI126742 a la clave.

1. recocido de vDNA
<ol><li>Combinar 1 X Buffer 10 (10 X 10 stock: 100 mM Tris-HCl, pH 8,0, 1 M NaCl, 10 mM EDTA), 10 μm 1 Oligo (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 acciones μm) y 10 μm 2 Oligo (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 acciones μm) en un volumen final de 1.5 mL . Alícuota de 25 μL en tubos de reacción en cadena (PCR) de 0.2 mL polimerasa sesenta. Nota: Dependiendo de la aplicación, oligómeros pueden modificarse con fluoróforos o etiquetas en el extremo 5'-2 Oligo o como un interno amino-T 13 base desde el extremo 5' de Oligo 1. Oligómeros modificados deben ser purificados por cromatografía líquida de alto rendimiento (HPLC) antes del recocido. Hemos encontrado que 5'-end Cy3 o Cy5 fluoróforo etiquetado de Oligo 2 reduce la eficacia de la Asamblea de intasome 10 veces. Fluoróforo interno etiquetado no reduce la eficiencia de montaje.</li>
	<li>Recueza utilizando un termociclador con los siguientes tiempos y temperaturas: 1 ciclo a 94.0 ° c 3 min, 99 ciclos en (94.0 ° c 1 min, ° c 93,6 1 min) disminuyendo ambas temperaturas por 0,8 ° c por ciclo (el último ciclo es de 14,8 ° c 1 min, 14,4 ° c 1 min) y conservarlo a 4.0 ° c.</li>
	<li>Se combinan las reacciones recocidas de sesenta todos los tubos. Carga de 500 μl a dos 0.5 mL 3 kDa peso molecular límite (MWCO) filtro ultracentrífugo concentración unidades. El recocido vDNA se concentran mediante centrifugación en una microcentrífuga a 14.000 x g por 10 min a temperatura ambiente (RT). Nota: El volumen retenido debe ser ~ 50 μL en cada unidad de concentración.</li>
	<li>Deseche el flujo a través. Añadir 250 μl de la restante vDNA recocido a cada unidad de filtro. Repetir la vuelta y desechar el flujo a través. De búfer lavándola tres veces con 450 μl TE intercambio en buffer TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA).</li>
	<li>Invierta la unidad de filtrado y centrifugado a 1.000 x g durante 2 min a TA. El volumen retenido final para cada unidad de filtro debe ser ~ 50 μl. combinar el retentates y transfiéralo a un tubo de tapón de rosca de 1.5 mL.</li>
	<li>Medir la absorbancia de 260 nm ultravioleta (UV) de la vDNA. Utilice este valor para calcular la concentración molar final de la DNA. El coeficiente de extinción (ε260) de este vDNA es 622.803 cm-1 M-1 y su peso molecular es 23.972 da. tienda a-20 ° c.</li>
</ol>2. Intasome Asamblea
<ol><li>Si es posible, realizar la Asamblea de intasome en una pequeña habitación con un termostato variable. Ajuste el termostato entre 18-22 grados centígrados. Nota: En nuestra experiencia, montaje de intasome a 4 ° c es ineficiente.</li>
	<li>Preparar 1 L de tampón de diálisis (Bis-tris propano de 20 mM, pH 7,5, 200 mM NaCl, 2 mM Ditiotreitol (DTT), 25 μm vivencias2) en un vaso de precipitados de 2 L con una barra de agitación en una placa de agitación. Equilibrar el búfer en la sala de 18-22 ° c durante al menos 6 h.</li>
	<li>Para montar el intasomes, combinan propano 50 mM Bis-tris, pH 7,5, 500 mM NaCl, 120 μm en PFV y 50 μm vDNA en un volumen total de 150 μL. Nota: El en PFV debe estar libre de contaminantes actividad nucleasa de7,8. Si la concentración de PFV es demasiado diluida para dar cabida a 120 μm IN en volumen de 150 μL, entonces es posible aumentar el volumen final a 200 μl. Los factores críticos de este paso son para mantener la proporción molar de IN a vDNA (2.4:1) y tener suficiente complejo visualizar durante la cromatografía.</li>
	<li>Limpiar un pedazo largo de ~ 10 cm de tubo de diálisis de 10 mm 6-8 kDa MWCO y clips con agua bidestilada (ddH2O), o agua de pureza más alto disponible. Clip de uno de los extremos de la tubería. Nota: La tubería de la diálisis debe manejarse con cuidado para evitar cualquier posible contaminación del espacio lab.</li>
	<li>Tomar 15 mL de solución de enjuague de tubo de diálisis (propano 50 mM Bis-tris, pH 7,5, 500 mM NaCl). Enjuague el interior de la tubería de la diálisis tres veces con 1-2 mL de tampón de enjuague. Eliminar gran parte de la solución de enjuague como sea posible con una pipeta y gel fina punta de carga.</li>
	<li>Si es necesario, use una limpia hoja de afeitar o bisturí para cortar el tubo de diálisis de forma que una carga de gel fina punta puede alcanzar el extremo de la tubería.</li>
	<li>Transferir el conjunto de intasome de paso 2.3 a la tubería de la diálisis con una pipeta y un gel fino carga punta. Enganche el extremo abierto del tubo de diálisis, minimizando la cantidad de aire introducido en el tubo. Coloque el tubo en el buffer de diálisis.</li>
	<li>Dializarse durante la noche (16-20 h) con agitación suave para que el tubo gira, pero no es en un vórtice. Asegúrese que el tubo de diálisis sumergida y móviles. Después de aproximadamente una hora, observar un precipitado visible dentro de la tubería. Nota: Con Cy3 y Cy5 fluorescencia etiquetada vDNA el precipitado es más obvio. Esto es cierto para finalizar etiquetado e internamente etiquetado vDNA fluorescente.</li>
</ol>3. Intasome solubilización
<ol><li>Preparar dos alesaje ancho puntas de pipeta mediante la eliminación de 2-4 mm del extremo de una punta de 200 μL con una cuchilla de afeitar o bisturí nuevo sobre una superficie limpia. Nota: Las puntas se utilizará en el paso 3.3 y 3.5.</li>
	<li>Quite los tubos de diálisis desde el buffer de diálisis. Con el fin de evitar la dilución de la muestra intasome con buffer de diálisis que puede permanecer en el extremo de la tubería cerca del clip, utilice una micropipeta con una pequeña pipeta para quitar cualquier buffer de diálisis exceso. Retire el clip de uno de los extremos de la tubería de la diálisis.</li>
	<li>Uso una amplia agujereada pipeta de paso 3.1 para transferir la muestra incluyendo el precipitado dentro de la tubería de la diálisis a un tubo de 1,5 mL en hielo. Tenga en cuenta el volumen total del material recuperado; el volumen total es típicamente ~ 140 μl.</li>
	<li>La muestra con precipitado es a 200 mM de NaCl; aumentar la sal a una concentración final de 320 mM de NaCl añadiendo el volumen adecuado de una solución de NaCl de 5 M madre. Por ejemplo, para una muestra de 150 μL, añadir μl 3,9 5 M NaCl y 1,1 μl ddH2O para un volumen final de 155 μl. transferencia de cubo de hielo con la muestra en una cámara fría de 4 ° c.</li>
	<li>Uso una amplia agujereada pipeta de paso 3.1 a suspender y solubilizar el precipitado mediante pipeteo. Repetir cada 20 min para por lo menos 1 h. Observe que la mayor parte del precipitado en solución. Nota: Pipeteo para Resuspender el precipitado puede suspenderse cuando es evidente que el precipitado no perceptiblemente se reduce entre puntos de tiempo. Cuando vDNA internamente es indicado o no está etiquetado, el precipitado se reduce por el ~ 90% basado en la inspección visual. En el caso de Cy5 final etiquetado vDNA, el precipitado se reduce sólo ~ 20%; la mayor parte del precipitado con el fluoróforo final etiquetado vDNA no se solubilizan. La cantidad de precipitado que efectivamente es solubilizado es variable y debe determinarse empíricamente.</li>
</ol>4. Intasome purificación
<ol><li>Preparar 250 mL de cromatografía por exclusión de tamaño (SEC) funcionamiento tampón (propano 20 mM Bis-tris, pH 7,5, 320 mM NaCl, 10% glicerol). Filtro estéril el buffer con un 0.2 μm filtro unidad y almacenar a 4 ° c. Nota: Todos los pasos de purificación se realizan en una cámara fría de 4 ° c.</li>
	<li>Equilibrar una columna de agarosa reticulado SEC (diámetro = 10 mm; longitud = 300 mm, volumen de la cama = 24 mL, volumen de muestra = 25-500 μl; presión máxima = 1,5 MPa, límite de exclusión = 4 x 107 Da; separa pesos moleculares entre 5.000 y 5 kDa, ver la de la estera de tabla erials) con el almacenador intermediario corriente seg con un caudal de 0,4 mL/min. Nota: Esta purificación puede adaptarse a columnas de exclusión de diverso tamaño si son capaces de separar eficazmente 300 kDa de 44 kDa, como Superose 12 10/300 GL Superose 6 aumentar. Superose 12 10/300 GL tiene menor resolución, llevando a más superposición de picos. Por el contrario, Superose 6 aumentar ofrece mayor resolución y mejor separación.</li>
	<li>Centrifugue la muestra de intasome en una microcentrífuga a 14.000 x g durante 10 min a 4 ° c a cualquier precipitado restante de pellets. Retire con cuidado el sobrenadante. Cargar el sobrenadante a un bucle de inyección de 200 μl (tubería que puede contener ~ 200 μL). Aplicar la muestra a la columna de seg. Nota: Volúmenes más pequeños de la carga permiten una mayor resolución de la SEC.</li>
	<li>Eluir con 25 mL seg funcionando del almacenador intermediario y cobrar 95 fracciones de 270 μl. observar que el cromatograma de la SEC muestra picos de260 A280/A (figura 1) tres. Nota: La primera debe ser un agregado (~9.0 - elución mL 11,5), seguido de la PFV tetrámero intasome pico (~12.0 - elución mL 14,75) y monómero en PFV con pico vDNA libre (~15.0 - 18,0 mL).</li>
</ol>5. integración del filamento transferencia ensayo, selección de la fracción y almacenamiento
<ol><li>Combinar 2 μl de cada fracción de pico intasome y 50 ng superenrollado 3 kb ADN plásmido (stock concentración es de 50 ng/μL) en buffer de reacción (gas propano 10 mM Bis-tris, pH 7,5, 110 mM NaCl, 5 mM MgSO4, 4 μm vivencias2, 10 mM DTT) en un volumen de reacción final de 15 μl. Incubar a 37 ° c durante 5 minutos.</li>
	<li>Incluir un control negativo con ningún agregado intasome PFV. Detener la reacción con proteinasa μl 0.75 K (20 mg/mL de solución stock) y 0,75 μl SDS (solución stock al 10%). Incubar a 55 ° c para las muestras de la tienda 1 h. según sea necesario en-20 ° c para posteriores análisis. Nota: Este ensayo es una evaluación cualitativa de la actividad de integración. Antes este análisis no es determinar la concentración molar de intasome de cada fracción. Fracciones incluidas en el análisis de transferencia de cadena de integración pueden ser almacenados en hielo (incluido el almacenamiento durante la noche) hasta integración actividad es confirmada y las fracciones alícuotas. Aquí utilizamos pMP2, un derivado de pUC199. Hemos utilizado también con éxito el 5,4 kb plásmido pcDNA 3.1. Cualquier plásmido que puede resolverse a relajado círculo, lineal, y superenrolladas formas pueden utilizarse como un objetivo de integración.</li>
	<li>Preparar un peso de 1% de 120 mL por gel de agarosa de volumen (p/v) en tampón de TAE X 1 (40 mM Tris acetato, EDTA 1 mM) con 0,1 μg/mL etidio bromuro (EtBr, solución stock de 10 mg/mL)10. La solución de agarosa del derretimiento y vierta en una bandeja de fundición de gel de 15 cm x 10 cm. Inserte un peine de 15 pozos con 5 mm ancho, 0,75 mm espesor pozos. Nota: Pozos de menos rendimiento mejor resolución de banda en comparación con los pozos de espesor 1,5 mm.</li>
	<li>Permita que el gel se solidifique a temperatura ambiente. Sumergir el gel en 1 X TAE con EtBr de 0.1 μg/mL.</li>
	<li>Agregar 3 μl 50% de glicerol a cada reacción de integración del paso 5.2. El volumen de reacción todo el gel de la carga. Carga 1 μl del marcador de tamaño de DNA de 10 kb (concentración stock de 150 ng/μL) a carriles a ambos lados de las muestras; en otras palabras, el marcador del tamaño de ADN debe flanquean las calles de la muestra.</li>
	<li>En un carril exterior, carga tinte de G anaranjado de 6 μl (0,25% naranja G, glicerol 30%). Correr el gel a tensión constante, 10 V/cm (100 V) a temperatura ambiente durante 1 hora o hasta que el frente de tinte naranja G llega al final del gel.</li>
	<li>Inmediatamente la imagen del gel de agarosa con un analizador fluorescente para detectar EtBr (532 nm excitación, filtro de emisión de 610 nm). Si se utilizaron fluoróforo con la etiqueta vDNAs, también imagen con ajustes de fluoróforo adecuado. Nota: por ejemplo detectar Cy5 etiquetado ADN, imagen con 633 nm excitación y filtros de emisión de 670 nm. Productos de integración concertada (CI, ADN lineal) deben ejecutar tallaje a ~ 3 kb plásmido superenrollado (SC) debe correr más rápido (~ 2 kb) y productos de integración de media página (HSI, círculo relajado DNA) deben ejecutar más lento (~3.5 kb). VDNA debe ejecutarse tallaje en ~ 40 bp.</li>
	<li>Cuantificar las bandas en cada carril con proyección de imagen de software7. Calcular la fracción de ADN en cada carril CI, HSI o SC; vDNA no está incluido en este cálculo. Nota: Eficiencia de la integración o la fracción de SC convertida en un producto lineal, se calculó dividiendo el volumen de píxeles de productos de integración concertada (IC) por el volumen total de píxeles de tres bandas (HSI + CI + SC). Si intasomes son fluoróforo con la etiqueta, los productos de HSI y CI pueden cuantificarse por fluorescencia.</li>
	<li>Seleccione fracciones que tienen la actividad de integración más concertada. Nota: En nuestra experiencia, la actividad de integración concertada de pico coincide con el pico de la proteína identificado como intasomes PFV tetramérica. Mida A280 de cada una de estas fracciones y calcular la concentración final de intasome. Ε280 por un tetrámero de tipo salvaje en PFV con dos vDNAs descrito aquí es 908.339 cm-1M-1 y el peso molecular es 225,5 kDa. Las concentraciones deben seguir el mismo patrón como el pico del cromatograma de SEC y en el análisis de transferencia de cadena.</li>
	<li>Distribuir cada fracción en 5 alícuotas μl y snap congelar en nitrógeno líquido. Guardar alícuotas a-80 ° c. Fracciones seleccionadas para el almacenamiento son típicamente entre 200-600 nM.</li>
</ol>

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Los autores no tienen nada que revelar.

Retroviral INs forman un complejo con DNA genómica viral para realizar integración y continuar el ciclo de vida viral multimérica. El número de monómeros por intasome puede ser tetrámeros, octamers o posiblemente mayor orden Multímeros11,12,13,14. Intasomes PFV son un tetrámero de recombinante con oligómeros de ADN bicatenario que imitan la DNA genomic viral termina3<...

Integración del genoma viral en el genoma del anfitrión es un paso obligatorio en el ciclo de vida de todos los retrovirus1. La enzima viral integrasa (IN) cataliza la unión covalente de los extremos del genoma viral de la DNA al anfitrión DNA. Durante una infección celular, en forma parte de un complejo de pre-integración que media integración. Recombinante en complexed con oligómeros de ADN de doble trenzados mímico los extremos del ADN virales también puede realizar la integración en un ADN en vitrode objetivo2. Un común integración análisis en vitro utiliza un plásmido superenrollado como el ADN diana. Integración de ambos oligómeros de ADN virales (vDNA) para el plásmido da lugar a un producto lineal y se denomina integración concertada (figura 2A). La integración análisis de vitro también se pueden producir productos con sólo un vDNA covalentemente unido al plásmido de blanco dando como resultado un círculo relajado. Este producto de la integración de medio sitio parece ser un artefacto del ensayo in vitro.
Recombinante en y vDNA pueden realizar integración en vitro, pero no son reactivos ideal para el estudio de la dinámica o estructura de los complejos de integración cuando IN monomérica oscurecería visualización pertinente. Complejos de integración purificado, o "intasomes," son necesarios para estudios de análisis o estructural dinámico a la sola molécula. EN PFV y vDNAs puede ser montada por diálisis de un búfer relativamente alta concentración de sal a una baja concentración de sal3,4. Durante la diálisis, un precipitado formas. Este precipitado se elimina de la diálisis y se aumenta la concentración de sal. La mayor concentración de sal solubiliza el precipitado que contiene intasomes PFV. El intasomes entonces se purifican por cromatografía por exclusión de tamaño (SEC). Prototipo recombinante virus espumoso (PFV) IN se ha demostrado que existe como monómero en solución a concentraciones de hasta 225 μm5. Fraccionamiento s efectivamente separa la intasomes PFV (225,5 kDa), que incluye un tetrámero en PFV y dos vDNAs, PFV monomérica en (44,4 kDa) y vDNA gratis (24.0 kDa). La intasomes PFV pueden congelar y conservar actividad de integración para al menos seis meses de almacenamiento a-80 ° c.
Recombinante intasomes PFV también puede ser modificada para incluir en las substituciones del aminoácido o mutaciones de truncamiento o vDNAs con fluoróforos o biotina4,6. Las intasomes PFV purificados fácilmente realizar integración en un objetivo de plásmido superenrollado ADN en vitro. Ensayos de integración bioquímica a granel con intasomes pueden probar los efectos de en mutaciones, inhibidores, o otros aditivos químicos. Biotinilado intasomes puede utilizarse para sonda afinidad con proteínas o ácidos nucleicos. Intasomes PFV funcionan a temperatura ambiente permitiendo análisis de microscopia sola molécula por pinza magnética para medir el tiempo entre la Unión de los dos extremos de vDNA o fluorescencia de la reflexión interna total para visualizar la búsqueda intasome en blanco De ADN6. Además, PFV intasomes fueron los primeros en ser estructuralmente caracterizan impactando significativamente el campo de la integración retroviral3.

<table><tbody><tr><td>DNA Oligomers</td><td>IDT</td><td>N/A</td><td>Custom DNA Oligos</td></tr><tr><td>Tris Ultra Pure</td><td>Gojira Fine Chemicals</td><td>UTS1003</td><td></td></tr><tr><td>NaCl</td><td>P212121</td><td>RP-S23020</td><td></td></tr><tr><td>UltraPure EDTA</td><td>Invitrogen/Gibco</td><td>15575</td><td></td></tr><tr><td>Amicon Ultra 0.5 mL centrifugal filters</td><td>Sigma-Aldrich</td><td>Z677094-24EA</td><td>3 kDa MWCO</td></tr><tr><td>DTT</td><td>P212121</td><td>SV-DTT</td><td></td></tr><tr><td>BIS-TRIS propane,&gt;=99.0% (titration)</td><td>Sigma-Aldrich</td><td>B6755-500G</td><td></td></tr><tr><td>ZnCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>208086</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;</td><td>Amresco</td><td>0662</td><td></td></tr><tr><td>Glycerol</td><td>Thermo Fisher Scientific</td><td>G37-20</td><td></td></tr><tr><td>Gel-loading tips, 1 - 200 &amp;mu;L</td><td>Corning</td><td>CLS4853-400EA</td><td></td></tr><tr><td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td><td>Fisher Scientific</td><td>12-640</td><td></td></tr><tr><td>Sterile Disposable Filter Units with PES Membrane &gt; 250mL</td><td>Thermo Fisher Scientific</td><td>568-0020</td><td></td></tr><tr><td>Dialysis tubing clips</td><td>Spectrum Labs</td><td>132734</td><td></td></tr><tr><td>6-8 kDa 10 mm Dialysis Tubing</td><td>Spectrum Medical</td><td>132645</td><td></td></tr><tr><td>Superose 6 10/300 GL</td><td>GE Healthcare Life Sciences</td><td>17517201</td><td></td></tr><tr><td>Hi-Res Standard Agarose</td><td>AGTC Bioproducts</td><td>AG500D1</td><td></td></tr><tr><td>Ethidium bromide</td><td>Thermo Fisher Scientific</td><td>BP1302</td><td></td></tr><tr><td>Orange G</td><td>Fisher Scientific</td><td>0-267</td><td></td></tr><tr><td>Hyladder 10kb, 500 lanes</td><td>Denville Scientific</td><td>CB4225-4</td><td></td></tr></tbody></table>

assembly and purification of prototype foamy virus intasomes

A definición de función y paso necesario del ciclo de vida de retrovirus es la integración del genoma viral en el genoma del anfitrión. Los retrovirus codifican enzima integrasa (IN) que cataliza la unión covalente de viral a anfitrión DNA, que se conoce como transferencia de cadena. Integración puede ser modelada en vitro con IN retrovirus recombinante y oligómeros de ADN mímico los extremos del genoma viral. Con el fin de recapitular más de cerca la reacción de integración que se presenta en vivo, integración complejos son ensamblados de oligómeros sintéticos y recombinante IN por diálisis en un tampón de menor concentración de sal. La integración compleja, llamada un intasome, puede ser purificada por cromatografía por exclusión de tamaño. En el caso de virus espumoso de los prototipos (PFV), el intasome es un tetrámero de IN y oligómeros de ADN dos y se separa fácilmente en monomérica y oligómero gratuito ADN. La eficacia de la integración de intasomes PFV puede ensayarse bajo una variedad de condiciones experimentales para comprender mejor la dinámica y la mecánica de integración retroviral.

Intasomes PFV son ensamblados de IN recombinante y vDNA. Después del montaje, intasomes son purificadas por segundos (figura 1). Actividad de integración de cada fracción se ensayaron con un superenrollado ADN blanco y agarosa electroforesis en gel (figura 2). Este gel es reflejado con un analizador fluorescente para detectar EtBr (y fluoróforo, si se utiliza el fluoróforo vDNA). Usando software de análisis de imagen, volú...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Integrasa de retrovirus recombinante y oligómeros de ADN mímico extremos de DNA virales pueden formar un complejo enzimático activo conocido como un intasome. Intasomes puede ser usada para estudios bioquímicos, estructurales y cinéticos. Este protocolo detalla cómo montar y purificar el prototipo virus espumoso de los intasomes.

Asamblea y purificación del prototipo Virus espumoso de los Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Research

JoVE Journal

Immunology and Infection

5.4K vistas.  The Ohio State University College of Medicine. Integrasa de retrovirus recombinante y oligómeros de ADN mímico extremos de DNA virales pueden formar un complejo enzimático activo conocido como un intasome. Intasomes puede ser usada para estudios bioquímicos, estructurales y cinéticos. Este protocolo detalla cómo montar y purificar el prototipo virus espumoso de los intasomes.

Video: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

Simple y robusto En vivo Y In vitro Enfoque para el estudio de ensamblaje del virus

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Investigación

Inmunología e Infección

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States alone, an average of 41,400 deaths and 1.86 million hospitalizations are caused by influenza virus infection each year 1. Point mutations in the polymerase basic protein 2 subunit (PB2) have been linked to the adaptation of the viral infection in humans 2. Findings from such studies have revealed the biological significance of PB2 as a virulence factor, thus highlighting its potential as an antiviral drug target.
The structural genomics program put forth by the National Institute of Allergy and Infectious Disease (NIAID) provides funding to Emerald Bio and three other Pacific Northwest institutions that together make up the Seattle Structural Genomics Center for Infectious Disease (SSGCID). The SSGCID is dedicated to providing the scientific community with three-dimensional protein structures of NIAID category A-C pathogens. Making such structural information available to the scientific community serves to accelerate structure-based drug design.
Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for new lead discovery by targeting a pathway or an entire protein family. Emerald Bio has developed a high-throughput, multi-target parallel processing pipeline (MTPP) for gene-to-structure determination to support the consortium. Here we describe the protocols used to determine the structure of the PB2 subunit from four different influenza A strains.

Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for lead discovery. The following article highlights how the Seattle Structural Genomics Center for Infectious Disease utilizes a multi-target approach for gene-to-structure determination of the PB2 influenza A subunit.

Multi-objetivo enfoque de procesamiento paralelo para Gene a la estructura de determinación de la polimerasa subunidad PB2 Influenza

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States ...

Detergent-assisted Reconstitution of Recombinant Drosophila Atlastin into Liposomes for Lipid-mixing Assays

Membrane fusion is a crucial process in the eukaryotic cell. Specialized proteins are necessary to catalyze fusion. Atlastins are endoplasmic reticulum (ER) resident proteins implicated in homotypic fusion of the ER. We detail here a method for purifying a glutathione S-transferase (GST) and poly-histidine tagged Drosophila atlastin by two rounds of affinity chromatography. Studying fusion reactions in vitro requires purified fusion proteins to be inserted into a lipid bilayer. Liposomes are ideal model membranes, as lipid composition and size may be adjusted. To this end, we describe a reconstitution method by detergent removal for Drosophila atlastin into preformed liposomes. While several reconstitution methods are available, reconstitution by detergent removal has several advantages that make it suitable for atlastins and other similar proteins. The advantage of this method includes a high reconstitution yield and correct orientation of the reconstituted protein. This method can be extended to other membrane proteins and for other applications that require proteoliposomes. Additionally, we describe a FRET based lipid mixing assay of proteoliposomes used as a measurement of membrane fusion.

Detergent-assisted Reconstitution of Recombinant Drosophila Atlastin into Liposomes for Lipid-mixing Assays

Biological membrane fusion is catalyzed by specialized fusion proteins. Measuring the fusogenic properties of proteins can be achieved by lipid mixing assays. We present a method for purifying recombinant Drosophila atlastin, a protein that mediates homotypic fusion of the ER, reconstituting it to preformed liposomes, and testing for fusion capacity.

Reconstitución asistida por detergente de Drosophila Atlastin recombinante en liposomas para ensayos de mezcla de lípidos

Membrane fusion is a crucial process in the eukaryotic cell. Specialized proteins are necessary to catalyze fusion. Atlastins are endoplasmic reticulum ...

Bioquímica

Generation and Assembly of Virus-Specific Nucleocapsids of the Respiratory Syncytial Virus

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and assay development in virology. The RNA template of nonsegmented negative-sense (NNS) RNA viruses, such as the respiratory syncytial virus (RSV), is not an RNA molecule alone but rather a nucleoprotein (N) encapsidated ribonucleoprotein complex. Despite the importance of the authentic RNA template, the generation and assembly of such a ribonucleoprotein complex remain sophisticated and require in-depth elucidation. The main challenge is that the overexpressed RSV N binds non-specifically to cellular RNAs to form random nucleocapsid-like particles (NCLPs). Here, we established a protocol to obtain RNA-free N (N0) first by co-expressing N with a chaperone phosphoprotein (P), then assembling N0 with RNA oligos with the RSV-specific RNA sequence to obtain virus-specific nucleocapsids (NCs). This protocol shows how to overcome the difficulty in the preparation of this traditionally challenging viral ribonucleoprotein complex.

For in-depth mechanistic analysis of the respiratory syncytial virus (RSV) RNA synthesis, we report a protocol of utilizing the chaperone phosphoprotein (P) for coexpression of the RNA-free nucleoprotein (N0) for subsequent in vitro assembly of the virus-specific nucleocapsids (NCs).

Generación Y Ensamblaje De Nucleocápsides Específicas Del Virus Respiratorio Sincitial

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and ...

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus (IAV), virus fusion with the endosomal membrane as well as the subsequent disassembly of the viral capsid, called uncoating, is governed by the ionic conditions inside endocytic vesicles. The early steps in the virus life cycle are hard to study because endosomes cannot be directly accessed experimentally, creating the need for an in vitro approach. Here, we describe a method based on velocity gradient centrifugation of purified virions through a two-layer glycerol gradient, which enables analysis of the IAV core and its stability. The gradient contains a non-ionic detergent (NP-40) in its lower layer to remove the viral membrane by solubilization as the virus sediments toward the bottom. At neutral pH, viral cores are pelleted as stable structures. The major core components, matrix protein (M1) and the viral ribonucleoproteins (vRNPs), can be clearly identified in the pellet fraction by SDS-PAGE. Decreasing the pH to 6.0 or lower in the bottom layer selectively removes M1 from the pellet followed by release of vRNPs at more acidic conditions. Viral protein bands on Coomassie-stained gels can be subjected to densitometric quantification to monitor intermediate states of IAV disassembly. Besides pH, other factors that influence viral core stability can be assessed, such as salt concentration and putative viral uncoating factors, simply by modifying the detergent-containing glycerol layer accordingly. Taken together, the presented technique allows highly reproducible and quantitative analysis of viral uncoating in vitro. It can be applied to other enveloped viruses that undergo complex uncoating processes.

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Disassembly of influenza A virus cores during virus entry into host cells is a multistep process. We describe an in vitro method to analyze the early stages of viral uncoating. In this approach, velocity gradient centrifugation is used to biochemically dissect the steps that initiate uncoating under defined conditions.

In Vitro El desmontaje de virus de influenza A cápsides por centrifugación en gradiente

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus ...

Advancing High-Resolution Imaging of Virus Assemblies in Liquid and Ice

Interest in liquid-electron microscopy (liquid-EM) has skyrocketed in recent years as scientists can now observe real-time processes at the nanoscale. It is extremely desirable to pair high-resolution cryo-EM information with dynamic observations as many events occur at rapid timescales - in the millisecond range or faster. Improved knowledge of flexible structures can also assist in the design of novel reagents to combat emerging pathogens, such as SARS-CoV-2. More importantly, viewing biological materials in a fluid environment provides a unique glimpse of their performance in the human body. Presented here are newly developed methods to investigate the nanoscale properties of virus assemblies in liquid and vitreous ice. To accomplish this goal, well-defined samples were used as model systems. Side-by-side comparisons of sample preparation methods and representative structural information are presented. Sub-nanometer features are shown for structures resolved in the range of ~3.5-&#197;-10 &#197;. Other recent results that support this complementary framework include dynamic insights of vaccine candidates and antibody-based therapies imaged in liquid. Overall, these correlative applications advance our ability to visualize molecular dynamics, providing a unique context for their use in human health and disease.

Here protocols are described to prepare virus assemblies suitable for liquid-EM and cryo-EM analysis at the nanoscale using transmission electron microscopy.

Avance de imágenes de alta resolución de ensamblajes de virus en líquido y hielo

Interest in liquid-electron microscopy (liquid-EM) has skyrocketed in recent years as scientists can now observe real-time processes at the nanoscale. It ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

Detección y eliminación de nucleasa contaminación durante la purificación de prototipo recombinante Virus Espumoso integrasa

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

In Vitro Reconstitution of the Actin Cytoskeleton Inside Giant Unilamellar Vesicles

The actin cytoskeleton, the principal mechanical machinery in the cell, mediates numerous essential physical cellular activities, including cell deformation, division, migration, and adhesion. However, studying the dynamics and structure of the actin network in vivo is complicated by the biochemical and genetic regulation within live cells. To build a minimal model devoid of intracellular biochemical regulation, actin is encapsulated inside giant unilamellar vesicles (GUVs, also called liposomes). The biomimetic liposomes are cell-sized and facilitate a quantitative insight into the mechanical and dynamical properties of the cytoskeleton network, opening a viable route for bottom-up synthetic biology. To generate liposomes for encapsulation, the inverted emulsion method (also referred to as the emulsion transfer method) is utilized, which is one of the most successful techniques for encapsulating complex solutions into liposomes to prepare various cell-mimicking systems. With this method, a mixture of proteins of interest is added to the inner buffer, which is later emulsified in a phospholipid-containing mineral oil solution to form monolayer lipid droplets. The desired liposomes are generated from monolayer lipid droplets crossing a lipid/oil-water interface. This method enables the encapsulation of concentrated actin polymers into the liposomes with desired lipid components, paving the way for in vitro reconstitution of a biomimicking cytoskeleton network.

In Vitro Reconstitution of the Actin Cytoskeleton Inside Giant Unilamellar Vesicles

In this manuscript, we demonstrate the experimental techniques to encapsulate the F-actin cytoskeleton into giant unilamellar lipid vesicles (also called liposomes), and the method to form a cortex-biomimicking F-actin layer at the inner leaflet of the liposome membrane.

In vitro Reconstitución del citoesqueleto de actina dentro de vesículas unilamelares gigantes

The actin cytoskeleton, the principal mechanical machinery in the cell, mediates numerous essential physical cellular activities, including cell ...

Bioingeniería

Sample Preparation for Single Virion Atomic Force Microscopy and Super-resolution Fluorescence Imaging

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule imaging assays which allows adhesion of single virions to glass surfaces with specificity. This preparation is based on grafting the surface of the glass with a mixture of PLL-g-PEG and PLL-g-PEG-Biotin, adding a layer of avidin, and finally creating virion anchors through attachment of biotinylated virus specific antibodies. We have applied this technique across a range of experiments including atomic force microscopy (AFM) and super-resolution fluorescence imaging. This sample preparation method results in a control adhesion of the virions to the surface.

The attachment of virions to a surface is a requirement for single virion imaging by Super-resolution fluorescence imaging or atomic force microscopy (AFM). Here we demonstrate a sample preparation method for controlled adhesion of virions to glass surfaces suitable for use in AFM and super-resolution fluorescence imaging.

Preparación de muestras para microscopía de fuerza atómica de virión único e imágenes de fluorescencia de súper resolución

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule ...

Biología

Expression and Purification of Virus-like Particles for Vaccination

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased biosafety and stability over use of live pathogens. Non-infectious and self-assembling, VLPs are used to present structural proteins as immunogens, bypassing the need for live pathogens or recombinant viral vectors for antigen delivery. In this article, we demonstrate the different stages of VLP design and development for future applications in preclinical animal testing. The procedure includes the following stages: selection of antigen, expression of antigen in cell line of choice, purification of VLPs/SVPs, and quantification for antigen dosing. We demonstrate use of both mammalian and insect cell lines for expression of our antigens and demonstrate how methodologies differ in yield. The methodology presented may apply to a variety of pathogens and can be achieved by substituting the antigens with immunogenic structural proteins of the user&#39;s microorganism of interest. VLPs and SVPs assist with antigen characterization and selection of the best vaccine candidates.

Here, we present a protocol for synthesizing virus-like particles using either baculovirus or mammalian expression systems, and ultracentrifugation purification. This highly customizable approach is used to identify viral antigens as vaccine targets in a safe and flexible manner.

Expresión y purificación de partículas similares al virus para la Vacunación

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased ...