Diese Arbeit wurde von NIH AI099854 und AI126742 auf Schlüssel unterstützt.

(1) Glühen des vDNA
<ol><li>Mähdrescher 1 X 10-Puffer (10 X 10 Lager: 100 mM Tris-HCl, pH 8.0, 1 M NaCl 10 mM EDTA), 10 µM Oligo-1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM-Lager) und 10 µM Oligo-2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM-Lager) in einem Endvolumen von 1,5 mL . Aliquoten 25 µL in sechzig 0,2 mL Polymerase-Kettenreaktion (PCR) Röhren. Hinweis: Abhängig von der Anwendung können Oligomere mit Fluorophore oder Tags am 5'-Ende von Oligo 2 oder als eine interne amino-T im Boden 13 vom 5'-Ende von Oligo 1 geändert werden. Modifizierte Oligomere sollte durch Hochleistungs-Flüssigkeitschromatographie (HPLC) vor Glühen gereinigt werden. Wir haben festgestellt, dass 5'-Ende Cy3 oder Cy5 Fluorophor Kennzeichnung von Oligo-2 Intasome-Montage-Effizienz 10-fache reduziert. Interne Fluorophor Kennzeichnung verringert nicht die Versammlung Effizienz.</li>
	<li>Tempern mit einem Thermocycler mit folgenden Zeiten und Temperaturen: 1 Zyklus auf 94,0 ˚C 3 min 99 Zyklen bei (94,0 ˚C 1 min, 93,6 ˚C 1 min) beide Temperaturen um 0,8 ° c pro Zyklus verringert (der letzte Zyklus ist 14,8 ˚C 1 min, 14,4 ° c 1 min) , und bei 4,0 ° c lagern.</li>
	<li>Kombinieren Sie die Glühen Reaktionen alle 60 Röhren. Laden Sie 500 µL, zwei 0,5 mL 3 kDa Molekulargewicht cutoff (MWCO) ultracentrifugal Filter Konzentrationseinheiten. Die geglühten vDNA durch Zentrifugieren in einem Microcentrifuge 14.000 x g für 10 min bei Raumtemperatur (RT) zu konzentrieren. Hinweis: Das Retentat Laufwerk sollte ~ 50 µL in jeder Konzentration Einheit.</li>
	<li>Die Durchströmung zu verwerfen. Jede Filteranlage 250 µL der verbleibenden geglühten vDNA hinzufügen. Wiederholen Sie den Spin und verwerfen Sie die Durchströmung zu. Tausch in TE-Puffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) durch waschen dreimal mit 450 µL TE-Puffer.</li>
	<li>Invertieren der Filtereinheit und Spin bei 1.000 x g für 2 min bei RT Die endgültige Retentat Lautstärke für jede Filteranlage sollte ~ 50 µL kombinieren Sie die Retentates und Übertragung auf ein 1,5 mL Schraubverschluss Rohr.</li>
	<li>Messen Sie die Absorption 260 nm Ultraviolett (UV) von der vDNA. Verwenden Sie diesen Wert, um die Endkonzentration der molaren DNA zu berechnen. Die vom Aussterben bedroht Leistungszahl (ε260) dieses vDNA ist 622.803 cm-1 M-1 und seine Molekulargewicht 23.972 Da. Store bei-20 ° c.</li>
</ol>2. Intasome Montage
<ol><li>Führen Sie nach Möglichkeit die Intasome-Assembly in einem kleinen Raum mit einem Variablen Thermostat. Stellen Sie den Thermostat auf ca. 18-22 ° c. Hinweis: Nach unserer Erfahrung ist Intasome Versammlung bei 4 ° c ineffizient.</li>
	<li>Bereiten Sie 1 L des Dialyse-Puffer (20 mM Bis-Tris Propan, pH 7,5, 200 mM NaCl, 2 mM Dithiothreitol (DTT), 25 µM ZnCl2) in einem 2 L Becherglas mit Stir Bar auf einem Teller rühren. Equilibrate des Puffers in der 18-22 ° c Raum für mindestens 6 h.</li>
	<li>Um die Intasomes zu montieren, verbinden Sie Propan 50 mM Bis-Tris, pH 7.5, 500 mM NaCl und 120 µM PFV IN 50 µM vDNA in einem Gesamtvolumen von 150 µL. Hinweis: Der PFV IN sollte frei von kontaminierenden Nuklease Aktivität7,8. Wenn die Konzentration des PFV IN zu verdünnen, 120 µM IN 150 µL Volumen unterzubringen, ist dann es möglich ist, das Endvolumen zu 200 µL zu erhöhen. Die entscheidenden Faktoren für diesen Schritt sind weiterhin das molare Verhältnis von IN zu vDNA (2.4:1) und ausreichend komplex, während der Chromatographie zu visualisieren.</li>
	<li>Reinigen Sie ein ~ 10 cm langes Stück 10 mm 6-8 kDa MWCO Dialyse Schläuche und Clips mit doppelt destilliertem Wasser (DdH2O) oder die höchste Reinheit Wasser zur Verfügung. Stecken Sie ein Ende des Schlauches. Hinweis: Dialyse Schläuche sollten mit Sorgfalt, um zu verhindern, dass etwaige Kontaminationen aus dem Labor-Raum behandelt werden.</li>
	<li>15 mL Dialyse Schläuche spülen Puffer (50 mM Bis-Tris Propan, pH 7.5, 500 mM NaCl) zu machen. Spülen Sie die Innenseite des Schlauches Dialyse dreimal mit 1-2 mL spülen Puffer. Entfernen Sie so viel des Puffers spülen wie möglich mit einer Pipette und dünnen Gel laden Tipp.</li>
	<li>Verwenden Sie ggf. eine saubere Rasierklinge oder einem Skalpell schneiden die Dialyse Schläuche, so dass ein dünne Gel-laden-Tipp am Ende des Schlauches erreichen kann.</li>
	<li>Übertragen Sie die Intasome-Assembly von Schritt 2.3 auf der Dialyse-Schlauch mit einer Pipette und einem dünnen Gel laden Tipp. Befestigen Sie das offene Ende der Dialyse Schläuche, Minimierung der Menge von Luft in den Schlauch eingeführt. Legen Sie die Schläuche in der Dialyse-Puffer.</li>
	<li>Dialyse über Nacht (16-20 h) unter schonenden rühren, damit das Rohr dreht sich aber nicht in einen Strudel. Sicherstellen Sie, dass die Dialyse-Schlauch unter Wasser und mobile. Beobachten Sie nach etwa einer Stunde einen sichtbaren Niederschlag in den Schlauch. Hinweis: Mit Cy3 oder Cy5 Eindringmittel vDNA bezeichnet, ist der Niederschlag deutlicher. Dies gilt auch für Ende beschriftet und intern beschrifteten fluoreszierende vDNA.</li>
</ol>3. Intasome Solubilization
<ol><li>Bereiten Sie zwei breite Bohrung Pipettenspitzen durch Entfernen von 2-4 mm vom Ende von 200 µL Tipp mit einer neuen Rasierklinge oder Skalpell Klinge auf eine saubere Oberfläche. Hinweis: Die Tipps werden in Schritt 3.3 und 3.5 verwendet werden.</li>
	<li>Entfernen Sie die Dialyse-Schläuche aus der Dialyse-Puffer. Vermeidung einer Verdünnung der Probe mit Dialyse-Puffer Intasome, die am Ende des Schlauches in der Nähe des Clips bleiben können, mithilfe einer Mikropipette mit einem kleinen Pipettenspitze um jede überschüssige Dialyse-Puffer zu entfernen. Entfernen Sie den Clip von einem Ende der Dialyse Schläuche.</li>
	<li>Verwendung eine große Bohrung Pipettenspitze Schritt 3.1, die Probe einschließlich des Niederschlags in der Dialyse-Schlauch, ein 1,5-mL-Tube auf Eis zu übertragen. Beachten Sie das Gesamtvolumen des zurückgewonnenen Materials; Das Gesamtvolumen beträgt in der Regel ca. 140 µL.</li>
	<li>Die Probe mit Niederschlag ist bei 200 mM NaCl; erhöhen Sie das Salz, eine Endkonzentration von 320 mM NaCl, indem das entsprechende Volumen der NaCl-Stammlösung der 5 M. Zum Beispiel für eine Probe von 150 µL hinzufügen 3,9 µL 5 M NaCl und 1,1 µL DdH2O für ein Endvolumen von 155 µL. Transfer Eiseimer mit Probe in einen Kühlraum von 4 ° c.</li>
	<li>Verwendung eine große Bohrung Pipettenspitze Schritt 3.1 Aufschwemmen und solubilisieren die Ausfällung von pipettieren. Wiederholen Sie alle 20 min für mindestens 1 Stunde beobachten, die meisten des Niederschlags in Lösung gehen sollte. Hinweis: Um den Niederschlag Aufschwemmen Pipettieren kann beendet werden, wenn es ersichtlich ist, dass der Niederschlag zwischen Zeitpunkten nicht mehr spürbar reduziert wird. Wenn vDNA nicht beschriftet ist oder intern bezeichnet, ist der Niederschlag um ~ 90 % bezogen auf die Sichtprüfung reduziert. Bei Cy5 Ende beschriftet vDNA wird der Niederschlag nur ~ 20 % reduziert; die meisten des Niederschlags mit Fluorophor Ende beschriftet vDNA werden nicht anderweitig. Die Menge des Niederschlags, die effektiv solubilisiert ist ist variabel und sollte empirisch ermittelt werden.</li>
</ol>4. Intasome-Reinigung
<ol><li>Bereiten Sie 250 mL Größe Ausgrenzung Chromatography (SEC) Puffer (20 mM Bis-Tris Propan, pH 7.5, 320 mM NaCl, 10 % Glycerin) ausgeführt. Sterilfilter des Puffers mit einem 0,2 µm Filtern Einheit und bei 4 ° c lagern. Hinweis: Alle Reinigungsschritte sind in einem 4 ° c kalten Raum durchgeführt.</li>
	<li>Equilibrate eine vernetzte Agarose SEC-Spalte (Durchmesser = 10 mm; Länge = 300 mm; Volumen Bett = 24 mL; probieren Volumen = 25-500 µL; Maximaldruck = 1,5 MPa; Ausgrenzung Limit = 4 x 107 Da; trennt Molekulargewichte zwischen 5 bis 5.000 kDa, sehen die Tabelle von Mat Erials) mit SEC laufenden Puffer mit einer Durchflussrate von 0,4 mL/min. Hinweis: Diese Reinigung kann auf unterschiedlicher Größe Ausgrenzung Spalten angepasst werden, wenn sie effektiv 300 kDa trennen 44 kDa, z. B. Superose 12 10/300 GL oder Superose 6 erhöhen können. Superose 12 10/300 GL hat niedrigeren Auflösung, was zu mehr Überschneidungen der Gipfel. Im Gegensatz dazu Superose 6 erhöhen verfügt über höhere Auflösung und besseren Trennung.</li>
	<li>Zentrifuge Intasome Probe in ein Microfuge bei 14.000 x g für 10 min bei 4 ° c, alle übrigen Niederschlag pellet. Entfernen Sie vorsichtig den überstand. Laden des Überstands zu einem 200 µL Injektionsschleife (Schläuche, die ~ 200 μL enthalten kann). Die Probe auf der SEC-Spalte anwenden. Hinweis: Kleinere Ladevolumen ermöglichen höhere Auflösung von SEC</li>
	<li>Eluieren mit 25 mL SEC laufen zu puffern und sammeln 95 Bruchteile von 270 µL. beachten Sie, dass die SEC-Chromatogramm drei A280/a260 -Gipfel (Abbildung 1 zeigt). Hinweis: Die erste sollte ein Aggregat (~9.0 - 11,5 mL Elution), gefolgt von der PFV Tetramer Intasome Peak (~12.0 - 14,75 mL Elution) und PFV IN Monomer mit kostenlosen vDNA Peak (~15.0 - 18,0 mL) sein.</li>
</ol>5. Integration Strang Transfer Assay, Bruchteil Auswahl und Lagerung
<ol><li>Kombinieren Sie 2 µL der Höhepunkt jedes Intasome und 50 ng 3 kb supercoiled Plasmid DNA (Lager Konzentration ist 50 ng/µL) in Reaktion-Puffer (10 mM Bis-Tris Propan, pH 7.5, 110 mM NaCl, 5 mM MgSO4, 4 µM ZnCl2, 10 mM DTT) in eine endgültige Reaktionsvolumen von 15 µL. Bei 37 ° c für 5 min inkubieren.</li>
	<li>Gehören Sie eine Negativkontrolle mit keine zusätzlichen PFV Intasome. Stoppen Sie die Reaktion mit 0,75 µL Proteinase K (20 mg/mL Stammlösung) und 0,75 µL SDS (10 % Stammlösung). Inkubieren Sie bei 55 ° c für 1 h Store Proben Bedarf bei-20 ° c für spätere Analysen. Hinweis: Dieser Test ist eine qualitative Bewertung der Integration Aktivität. Die Intasome molare Konzentration der einzelnen Fraktionen ist nicht vor dieser Assay ermittelt. Brüche in der Integration Strang Transfer Test enthalten können gespeichert werden auf dem Eis (einschließlich Lagerung über Nacht) bis zur Integration Tätigkeit bestätigt und ausgewählte Brüche sind regelmÄÑig. Hier verwenden wir pMP2, eine pUC19 Derivative9. Wir haben auch erfolgreich die 5,4 kb-Plasmid PcDNA 3.1 verwendet. Alle Plasmid, das gelöst werden kann entspannt Kreis, linear, und supercoiled Formen als Ziel für die Integration verwendet werden.</li>
	<li>Bereiten Sie ein 120 mL 1 % Gewicht pro Volumen (w/V) Agarose-Gel auf 1 X TAE-Puffer (40 mM Tris-Acetat, 1 mM EDTA) mit 0,1 μg/mL Interkalation Bromid (EtBr, 10 mg/mL Stammlösung)10. Schmelzen Sie die Agarose-Lösung zu und gießen Sie sie in ein 15 x 10 cm Gel Casting Tablett. Legen Sie einen 15-Brunnen-Kamm mit 5 mm breit, 0,75 mm dick Brunnen. Hinweis: Schmalere Brunnen liefern besseren Band-Auflösung im Vergleich zu 1,5 mm Dicke Brunnen.</li>
	<li>Lassen Sie das Gel bei Raumtemperatur zu festigen. Tauchen Sie das Gel in 1 X TAE mit 0,1 μg/mL EtBr.</li>
	<li>Jede Integration Reaktion 3 µL 50 % Glycerin aus Schritt 5.2 hinzufügen. Laden Sie das gesamte Reaktionsvolumen auf das Gel. 1 µL 10 kb DNA Größe Marker (150 ng/µL Lager Konzentration) auf Bahnen auf beiden Seiten der Proben zu laden; Das heißt, sollte der DNA Größe Marker die Probe Gassen flankieren.</li>
	<li>Laden Sie in eine äußere Fahrspur 6 µL Orange G Farbstoff (0,25 % Orange G, 30 % Glycerin). Führen Sie das Gel bei konstanter Spannung, 10 V/cm (100 V) bei Raumtemperatur 1 Stunde oder bis Orange G Farbstoff vorne das Ende des Gels erreicht.</li>
	<li>Sofort Bild das Agarosegel mit einem fluoreszierenden Scanner EtBr (532 nm Anregung, 610 nm Emission Filter) überschreitet. Wenn Fluorophore beschriftet vDNAs verwendet wurden, auch mit entsprechenden Fluorophor Einstellungen Bild. Hinweis: zum Beispiel mit der Bezeichnung Cy5 erkennen DNA, Bild mit 633 nm Anregung und 670 nm Emission Filter. Abgestimmte Integrationsprodukte (CI, lineare DNA) laufen maßhaltig bei ~ 3 kb, nicht umgesetztes supercoiled Plasmid (SC) läuft schneller (~ 2 kb) und halb-Website Integrationsprodukte (HSI, entspannten Kreis DNA) läuft langsamer (~3.5 kb). Nicht umgesetztes vDNA führen maßhaltig bei ~ 40 bp.</li>
	<li>Die Bänder in jeder Bahn mit imaging Software7zu quantifizieren. Der Anteil der DNA in jeder Spur, die CI, HSI oder SC ist zu berechnen; vDNA ist in dieser Berechnung nicht enthalten. Hinweis: Integration Effizienz oder der Bruch des SC zu einem linearen Produkt umgewandelt wurde dividiert das Pixel-Volumen von abgestimmten Integrationsprodukte (CI) durch das gesamte Pixel Volumen von drei Bands (HSI + CI + SC). Wenn Intasomes Fluorophore beschriftet sind, können die HSI und CI-Produkte auch durch Fluoreszenz quantitated.</li>
	<li>Wählen Sie Brüche, die die meisten abgestimmte Integration-Aktivität haben. Hinweis: Nach unserer Erfahrung fällt der Spitzenaktivität abgestimmte Integration mit dem Protein-Gipfel als tetrameres PFV Intasomes identifiziert. Messen Sie die A280 jedes dieser Fraktionen und berechnen Sie die endgültigen Intasome Konzentration. Die ε-280 für ein Tetramer von Wildtyp PFV IN mit zwei vDNAs hier beschriebenen ist 908.339 cm-1M-1 und das Molekulargewicht ist 225.5 kDa. Die Konzentrationen sollten das gleiche Muster als die SEC Chromatogramm Peak und im Strang Transfer Test folgen.</li>
	<li>Jede Fraktion in 5 µL-Aliquots verteilen und snap Einfrieren in flüssigem Stickstoff. Lagern Sie Aliquote bei-80 ° c. Brüche, ausgewählt für die Lagerung sind in der Regel zwischen 200 und 600 nM.</li>
</ol>

<ol><li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aCoffin%2C+JM+%22Retroviruses%22">Retroviruses</a>. , Cold Spring Harbor Laboratory Press. (1997).</li>
<li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li>
<li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li>
<li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration%5BTitle%5D)+AND+%22Protein+Sci%22%5BJournal%5D)">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li>
<li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA%5BTitle%5D)+AND+%22Structure%22%5BJournal%5D)">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li>
<li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409(2016).</li>
<li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li>
<li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase%5BTitle%5D)+AND+%22J+Virol+Methods%22%5BJournal%5D)">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li>
<li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers%5BTitle%5D)+AND+%22J+Mol+Biol%22%5BJournal%5D)">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li>
<li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li>
<li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li>
<li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+supramolecular+assembly+mediates+lentiviral+DNA+integration%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li>
<li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li>
<li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Crystal+structure+of+the+Rous+sarcoma+virus+intasome%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li>
<li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li>
<li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structural+basis+for+retroviral+integration+into+nucleosomes%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li>
</ol>

Die Autoren haben nichts preisgeben.

Retroviren INs bilden einen Komplex mit viralen genomischen DNA führen Integration und weiter den viralen Lebenszyklus Multimeric. Die Anzahl der im Monomeren pro Intasome möglicherweise Tetramers, Octamers oder eventuell höhere Ordnung Multimere11,12,13,14. PFV Intasomes sind, dass ein Tetramer des rekombinanten mit doppelsträngigen DNA-Oligomere, die viralen genomischen DNA zu imitieren e...

Integration des viralen Genoms in das Wirtsgenom ist ein obligatorischer Schritt im Lebenszyklus von allen Retroviren1. Das virale Enzym Integrase (IN) katalysiert die kovalente Verbindung der beiden Enden der viralen DNA-Genom an den Host DNA. Während einer zellulären Infektion gehört eine Vorintegration Komplex, die die Integration vermittelt. Rekombinante IN komplexiert mit doppelten gestrandeten DNA-Oligomere imitiert die virale DNA-enden können auch die Integration in ein Ziel DNA in Vitro2durchführen. Eine gemeinsame Integration Assay in Vitro nutzt ein supercoiled Plasmid als Ziel DNA. Integration der beiden virale DNA-Oligomere (vDNA) auf dem Plasmid führt zu einem linearen Produkt und ist abgestimmte Integration (Abbildung 2A) bezeichnet. Die Integration Tests in Vitro können auch Produkte mit nur ein vDNA kovalent an das Ziel-Plasmid, was zu einem entspannten Kreis trat führen. Dieser halb-Website Integration Produkt scheint ein Artefakt der Assay in Vitro.
IN rekombinanten und vDNA Integration in Vitroverrichten, aber sie sind nicht ideal Reagenzien für das Studium der Dynamik oder die Struktur der komplexe Integration, wenn Monomere IN relevanten Visualisierung verdecken würde. Gereinigte Integration komplexe oder "Intasomes" sind für dynamische Einzelmolekül-Analyse oder strukturelle Studien erforderlich. PFV IN und vDNAs können durch Dialyse aus einem relativ hohen Salzkonzentration Puffer zu einem niedrigeren Salzkonzentration3,4montiert werden. Während der Dialyse, einen Niederschlag Formen. Dieser Niederschlag aus Dialyse entfernt und die Salzkonzentration steigt. Die höheren Salzkonzentration solubilisiert überstürzten enthaltenden PFV-Intasomes. Die Intasomes werden dann durch Größe Ausgrenzung Chromatography (SEC) gereinigt. Rekombinante Prototyp schaumig Virus (PFV) IN nachweislich als ein Monomer in Lösung in Konzentrationen bis zu 225 µM5existieren. SEC Fraktionierung trennt effektiv PFV Intasomes (225.5 kDa), die ein Tetramer des PFV IN und zwei vDNAs umfasst, von Monomeren PFV IN (44,4 kDa) und freie vDNA (24,0 kDa). Der PFV Intasomes können eingefroren werden und Integration Aktivität für mindestens sechs Monate Lagerung bei-80 ° c aufbewahren.
Rekombinante PFV Intasomes kann auch geändert werden, um IN Aminosäure Substitutionen oder abschneiden Mutationen oder vDNAs beschriftet mit Fluorophore oder Biotin4,6erweitert. Die gereinigten PFV Intasomes durchführen ohne weiteres Integration in ein Ziel supercoiled Plasmid DNA in Vitro. Bulk-biochemische Integration-Assays mit Intasomes können die Auswirkungen der IN Mutationen im Hemmer oder sonstigen chemischen Zusätzen testen. Biotinylierte Intasomes kann verwendet werden, Affinität mit Nukleinsäuren oder Proteine zu untersuchen. PFV Intasomes funktionieren bei Umgebungstemperatur zulassend Einzelmolekül-Mikroskopie-Analyse von magnetischen Pinzette Messung die Zeit zwischen den Beitritt der beiden vDNA enden oder Totalreflexion Fluoreszenz, die Intasome Suche auf Ziel zu visualisieren DNA-6. Darüber hinaus wurden PFV Intasomes die erste strukturell sein deutlich beeinflussen das Feld von Retroviren Integration3gekennzeichnet.

<table><tbody><tr><td>DNA Oligomers</td><td>IDT</td><td>N/A</td><td>Custom DNA Oligos</td></tr><tr><td>Tris Ultra Pure</td><td>Gojira Fine Chemicals</td><td>UTS1003</td><td></td></tr><tr><td>NaCl</td><td>P212121</td><td>RP-S23020</td><td></td></tr><tr><td>UltraPure EDTA</td><td>Invitrogen/Gibco</td><td>15575</td><td></td></tr><tr><td>Amicon Ultra 0.5 mL centrifugal filters</td><td>Sigma-Aldrich</td><td>Z677094-24EA</td><td>3 kDa MWCO</td></tr><tr><td>DTT</td><td>P212121</td><td>SV-DTT</td><td></td></tr><tr><td>BIS-TRIS propane,&gt;=99.0% (titration)</td><td>Sigma-Aldrich</td><td>B6755-500G</td><td></td></tr><tr><td>ZnCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>208086</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;</td><td>Amresco</td><td>0662</td><td></td></tr><tr><td>Glycerol</td><td>Thermo Fisher Scientific</td><td>G37-20</td><td></td></tr><tr><td>Gel-loading tips, 1 - 200 &amp;mu;L</td><td>Corning</td><td>CLS4853-400EA</td><td></td></tr><tr><td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td><td>Fisher Scientific</td><td>12-640</td><td></td></tr><tr><td>Sterile Disposable Filter Units with PES Membrane &gt; 250mL</td><td>Thermo Fisher Scientific</td><td>568-0020</td><td></td></tr><tr><td>Dialysis tubing clips</td><td>Spectrum Labs</td><td>132734</td><td></td></tr><tr><td>6-8 kDa 10 mm Dialysis Tubing</td><td>Spectrum Medical</td><td>132645</td><td></td></tr><tr><td>Superose 6 10/300 GL</td><td>GE Healthcare Life Sciences</td><td>17517201</td><td></td></tr><tr><td>Hi-Res Standard Agarose</td><td>AGTC Bioproducts</td><td>AG500D1</td><td></td></tr><tr><td>Ethidium bromide</td><td>Thermo Fisher Scientific</td><td>BP1302</td><td></td></tr><tr><td>Orange G</td><td>Fisher Scientific</td><td>0-267</td><td></td></tr><tr><td>Hyladder 10kb, 500 lanes</td><td>Denville Scientific</td><td>CB4225-4</td><td></td></tr></tbody></table>

assembly and purification of prototype foamy virus intasomes

A Definition von Funktion und notwendiger Schritt des Lebenszyklus Retrovirus ist die Integration des viralen Genoms in das Wirtsgenom. Alle Retroviren kodiert eine Integrase (IN)-Enzym, das katalysiert die kovalente Verbindung von viralen Host DNA, bekannt als Strang übertragen. Integration kann modelliert in Vitro mit rekombinante Retroviren und DNA-Oligomere imitiert die Enden des Virusgenoms. Um genauer rekapitulieren die Integration-Reaktion, die auftritt, in Vivo, Integration sind komplexe von rekombinanten IN und synthetischen Oligomere durch Dialyse in einem reduzierten Salzgehalt Puffer montiert. Die Integration komplexer, genannt eine Intasome kann durch Größe Ausgrenzung Chromatographie gereinigt werden. Bei Prototyp schaumig Virus (PFV) der Intasome ist ein Tetramer von innen und zwei DNA-Oligomere und ist leicht von Monomeren IN und kostenlose Oligomer DNA getrennt. Die Effizienz der Integration des PFV Intasomes kann unter einer Vielzahl von experimentellen Bedingungen für die Dynamik besser zu verstehen und Mechanik der retroviralen Integration untersucht.

PFV Intasomes werden von rekombinanten IN und vDNA montiert. Nach der Montage sind Intasomes durch SEC (Abbildung 1) gereinigt. Integration-Aktivität der einzelnen Fraktionen ist mit einem supercoiled DNA Ziel- und Agarose Gelelektrophorese (Abbildung 2) untersucht. Dieses Gel wird mit einem fluoreszierenden Scanner eingestellt, erkennt EtBr (und Fluorophor, wenn Fluorophore beschriftet vDNA verwendet wird) abgebildet. Bildanaly...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Rekombinante Retroviren Integrase und DNA-Oligomere imitiert virale DNA enden können einen enzymatisch aktiven Komplex bekannt als ein Intasome bilden. Intasomes können für biochemische, strukturellen und kinetischen Studien verwendet werden. Dieses Protokoll beschreibt, wie zu montieren und zu reinigen Prototyp schaumig Virus Intasomes.

Montage und Reinigung der Prototyp schaumig Virus Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Research

JoVE Journal

Immunology and Infection

5.5K Aufrufe.  The Ohio State University College of Medicine. Rekombinante Retroviren Integrase und DNA-Oligomere imitiert virale DNA enden können einen enzymatisch aktiven Komplex bekannt als ein Intasome bilden. Intasomes können für biochemische, strukturellen und kinetischen Studien verwendet werden. Dieses Protokoll beschreibt, wie zu montieren und zu reinigen Prototyp schaumig Virus Intasomes.

Serie: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

Einfach und robust In-vivo- Und In-vitro- Ansatz für das Studium Virusassemblierung

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Forschung

Immunologie und Infektion

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States alone, an average of 41,400 deaths and 1.86 million hospitalizations are caused by influenza virus infection each year 1. Point mutations in the polymerase basic protein 2 subunit (PB2) have been linked to the adaptation of the viral infection in humans 2. Findings from such studies have revealed the biological significance of PB2 as a virulence factor, thus highlighting its potential as an antiviral drug target.
The structural genomics program put forth by the National Institute of Allergy and Infectious Disease (NIAID) provides funding to Emerald Bio and three other Pacific Northwest institutions that together make up the Seattle Structural Genomics Center for Infectious Disease (SSGCID). The SSGCID is dedicated to providing the scientific community with three-dimensional protein structures of NIAID category A-C pathogens. Making such structural information available to the scientific community serves to accelerate structure-based drug design.
Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for new lead discovery by targeting a pathway or an entire protein family. Emerald Bio has developed a high-throughput, multi-target parallel processing pipeline (MTPP) for gene-to-structure determination to support the consortium. Here we describe the protocols used to determine the structure of the PB2 subunit from four different influenza A strains.

Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for lead discovery. The following article highlights how the Seattle Structural Genomics Center for Infectious Disease utilizes a multi-target approach for gene-to-structure determination of the PB2 influenza A subunit.

Multi-Target-Parallel Processing Ansatz zur Gene-to-Struktur Bestimmung der Influenza Polymerase PB2-Untereinheit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States ...

Detergent-assisted Reconstitution of Recombinant Drosophila Atlastin into Liposomes for Lipid-mixing Assays

Membrane fusion is a crucial process in the eukaryotic cell. Specialized proteins are necessary to catalyze fusion. Atlastins are endoplasmic reticulum (ER) resident proteins implicated in homotypic fusion of the ER. We detail here a method for purifying a glutathione S-transferase (GST) and poly-histidine tagged Drosophila atlastin by two rounds of affinity chromatography. Studying fusion reactions in vitro requires purified fusion proteins to be inserted into a lipid bilayer. Liposomes are ideal model membranes, as lipid composition and size may be adjusted. To this end, we describe a reconstitution method by detergent removal for Drosophila atlastin into preformed liposomes. While several reconstitution methods are available, reconstitution by detergent removal has several advantages that make it suitable for atlastins and other similar proteins. The advantage of this method includes a high reconstitution yield and correct orientation of the reconstituted protein. This method can be extended to other membrane proteins and for other applications that require proteoliposomes. Additionally, we describe a FRET based lipid mixing assay of proteoliposomes used as a measurement of membrane fusion.

Detergent-assisted Reconstitution of Recombinant Drosophila Atlastin into Liposomes for Lipid-mixing Assays

Biological membrane fusion is catalyzed by specialized fusion proteins. Measuring the fusogenic properties of proteins can be achieved by lipid mixing assays. We present a method for purifying recombinant Drosophila atlastin, a protein that mediates homotypic fusion of the ER, reconstituting it to preformed liposomes, and testing for fusion capacity.

Waschmittelunterstützte Rekonstitution von rekombinantem Drosophila Atlastin in Liposomen für Lipid-Mischtests

Membrane fusion is a crucial process in the eukaryotic cell. Specialized proteins are necessary to catalyze fusion. Atlastins are endoplasmic reticulum ...

Biochemie

Generation and Assembly of Virus-Specific Nucleocapsids of the Respiratory Syncytial Virus

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and assay development in virology. The RNA template of nonsegmented negative-sense (NNS) RNA viruses, such as the respiratory syncytial virus (RSV), is not an RNA molecule alone but rather a nucleoprotein (N) encapsidated ribonucleoprotein complex. Despite the importance of the authentic RNA template, the generation and assembly of such a ribonucleoprotein complex remain sophisticated and require in-depth elucidation. The main challenge is that the overexpressed RSV N binds non-specifically to cellular RNAs to form random nucleocapsid-like particles (NCLPs). Here, we established a protocol to obtain RNA-free N (N0) first by co-expressing N with a chaperone phosphoprotein (P), then assembling N0 with RNA oligos with the RSV-specific RNA sequence to obtain virus-specific nucleocapsids (NCs). This protocol shows how to overcome the difficulty in the preparation of this traditionally challenging viral ribonucleoprotein complex.

For in-depth mechanistic analysis of the respiratory syncytial virus (RSV) RNA synthesis, we report a protocol of utilizing the chaperone phosphoprotein (P) for coexpression of the RNA-free nucleoprotein (N0) for subsequent in vitro assembly of the virus-specific nucleocapsids (NCs).

Generierung und Aufbau virusspezifischer Nukleokapsiden des respiratorischen Synzytialvirus

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and ...

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus (IAV), virus fusion with the endosomal membrane as well as the subsequent disassembly of the viral capsid, called uncoating, is governed by the ionic conditions inside endocytic vesicles. The early steps in the virus life cycle are hard to study because endosomes cannot be directly accessed experimentally, creating the need for an in vitro approach. Here, we describe a method based on velocity gradient centrifugation of purified virions through a two-layer glycerol gradient, which enables analysis of the IAV core and its stability. The gradient contains a non-ionic detergent (NP-40) in its lower layer to remove the viral membrane by solubilization as the virus sediments toward the bottom. At neutral pH, viral cores are pelleted as stable structures. The major core components, matrix protein (M1) and the viral ribonucleoproteins (vRNPs), can be clearly identified in the pellet fraction by SDS-PAGE. Decreasing the pH to 6.0 or lower in the bottom layer selectively removes M1 from the pellet followed by release of vRNPs at more acidic conditions. Viral protein bands on Coomassie-stained gels can be subjected to densitometric quantification to monitor intermediate states of IAV disassembly. Besides pH, other factors that influence viral core stability can be assessed, such as salt concentration and putative viral uncoating factors, simply by modifying the detergent-containing glycerol layer accordingly. Taken together, the presented technique allows highly reproducible and quantitative analysis of viral uncoating in vitro. It can be applied to other enveloped viruses that undergo complex uncoating processes.

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Disassembly of influenza A virus cores during virus entry into host cells is a multistep process. We describe an in vitro method to analyze the early stages of viral uncoating. In this approach, velocity gradient centrifugation is used to biochemically dissect the steps that initiate uncoating under defined conditions.

In - vitro - Zerlegung von Influenza - A - Virus Kapside durch Gradientenzentrifugation

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus ...

Advancing High-Resolution Imaging of Virus Assemblies in Liquid and Ice

Interest in liquid-electron microscopy (liquid-EM) has skyrocketed in recent years as scientists can now observe real-time processes at the nanoscale. It is extremely desirable to pair high-resolution cryo-EM information with dynamic observations as many events occur at rapid timescales - in the millisecond range or faster. Improved knowledge of flexible structures can also assist in the design of novel reagents to combat emerging pathogens, such as SARS-CoV-2. More importantly, viewing biological materials in a fluid environment provides a unique glimpse of their performance in the human body. Presented here are newly developed methods to investigate the nanoscale properties of virus assemblies in liquid and vitreous ice. To accomplish this goal, well-defined samples were used as model systems. Side-by-side comparisons of sample preparation methods and representative structural information are presented. Sub-nanometer features are shown for structures resolved in the range of ~3.5-&#197;-10 &#197;. Other recent results that support this complementary framework include dynamic insights of vaccine candidates and antibody-based therapies imaged in liquid. Overall, these correlative applications advance our ability to visualize molecular dynamics, providing a unique context for their use in human health and disease.

Here protocols are described to prepare virus assemblies suitable for liquid-EM and cryo-EM analysis at the nanoscale using transmission electron microscopy.

Weiterentwicklung der hochauflösenden Bildgebung von Virusanordnungen in Flüssigkeit und Eis

Interest in liquid-electron microscopy (liquid-EM) has skyrocketed in recent years as scientists can now observe real-time processes at the nanoscale. It ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

Erkennung und Entfernung von Nuklease Kontamination während der Reinigung von rekombinanten Prototyp schaumig Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

In Vitro Reconstitution of the Actin Cytoskeleton Inside Giant Unilamellar Vesicles

The actin cytoskeleton, the principal mechanical machinery in the cell, mediates numerous essential physical cellular activities, including cell deformation, division, migration, and adhesion. However, studying the dynamics and structure of the actin network in vivo is complicated by the biochemical and genetic regulation within live cells. To build a minimal model devoid of intracellular biochemical regulation, actin is encapsulated inside giant unilamellar vesicles (GUVs, also called liposomes). The biomimetic liposomes are cell-sized and facilitate a quantitative insight into the mechanical and dynamical properties of the cytoskeleton network, opening a viable route for bottom-up synthetic biology. To generate liposomes for encapsulation, the inverted emulsion method (also referred to as the emulsion transfer method) is utilized, which is one of the most successful techniques for encapsulating complex solutions into liposomes to prepare various cell-mimicking systems. With this method, a mixture of proteins of interest is added to the inner buffer, which is later emulsified in a phospholipid-containing mineral oil solution to form monolayer lipid droplets. The desired liposomes are generated from monolayer lipid droplets crossing a lipid/oil-water interface. This method enables the encapsulation of concentrated actin polymers into the liposomes with desired lipid components, paving the way for in vitro reconstitution of a biomimicking cytoskeleton network.

In Vitro Reconstitution of the Actin Cytoskeleton Inside Giant Unilamellar Vesicles

In this manuscript, we demonstrate the experimental techniques to encapsulate the F-actin cytoskeleton into giant unilamellar lipid vesicles (also called liposomes), and the method to form a cortex-biomimicking F-actin layer at the inner leaflet of the liposome membrane.

In vitro Rekonstitution des Aktinzytoskeletts in riesigen unilamellaren Vesikeln

The actin cytoskeleton, the principal mechanical machinery in the cell, mediates numerous essential physical cellular activities, including cell ...

Biotechnik

Sample Preparation for Single Virion Atomic Force Microscopy and Super-resolution Fluorescence Imaging

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule imaging assays which allows adhesion of single virions to glass surfaces with specificity. This preparation is based on grafting the surface of the glass with a mixture of PLL-g-PEG and PLL-g-PEG-Biotin, adding a layer of avidin, and finally creating virion anchors through attachment of biotinylated virus specific antibodies. We have applied this technique across a range of experiments including atomic force microscopy (AFM) and super-resolution fluorescence imaging. This sample preparation method results in a control adhesion of the virions to the surface.

The attachment of virions to a surface is a requirement for single virion imaging by Super-resolution fluorescence imaging or atomic force microscopy (AFM). Here we demonstrate a sample preparation method for controlled adhesion of virions to glass surfaces suitable for use in AFM and super-resolution fluorescence imaging.

Probenvorbereitung für Single Virion Atomic Force Microscopy und Super-Resolution Fluorescence Imaging

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule ...

Biologie

Expression and Purification of Virus-like Particles for Vaccination

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased biosafety and stability over use of live pathogens. Non-infectious and self-assembling, VLPs are used to present structural proteins as immunogens, bypassing the need for live pathogens or recombinant viral vectors for antigen delivery. In this article, we demonstrate the different stages of VLP design and development for future applications in preclinical animal testing. The procedure includes the following stages: selection of antigen, expression of antigen in cell line of choice, purification of VLPs/SVPs, and quantification for antigen dosing. We demonstrate use of both mammalian and insect cell lines for expression of our antigens and demonstrate how methodologies differ in yield. The methodology presented may apply to a variety of pathogens and can be achieved by substituting the antigens with immunogenic structural proteins of the user&#39;s microorganism of interest. VLPs and SVPs assist with antigen characterization and selection of the best vaccine candidates.

Here, we present a protocol for synthesizing virus-like particles using either baculovirus or mammalian expression systems, and ultracentrifugation purification. This highly customizable approach is used to identify viral antigens as vaccine targets in a safe and flexible manner.

Expression und Reinigung von virusähnlichen Partikeln zur Vakzinierung

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased ...