עבודה זו מומנה על ידי מענק (OPP1015402) של ביל ומלינדה גייטס באמצעות יוזמת חקירות אתגרים גרנד, ועל ידי ה-NIH באמצעות מענקים GM062958-01 ו 2R01EB002046. עבודה זו בוצעה כחלק בחסות מחלקת האנרגיה של ארה&quot;ב על ידי המעבדה הלאומית לורנס ליברמור תחת חוזה DE-AC52-07NA27344.

1. קביעת שלב <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> רכש את ה-DNA רלוונטיים, בדיקה שינוי כימי של חברת סינתזה אישית oligonucleotide כגון Biosearch טכנולוגיות (Novato, CA) או מידלנד מוסמך (מידלנד, טקסס). החללית הוא שונה במהלך הסינתזה על ידי תוספת של תיאול C6 בסוף 3&#39;-שלה כחול חמזור פעילה מתילן בסוף 5&#39;-שלה. </li><li style=";text-align:right;direction:rtl"> ממיסים את ה-DNA בדיקה שנאגרו פוספט pH 7.4 כדי מלוחים בריכוז של 200 מיקרומטר ולאמת שלו על ידי מדידת ריכוז ספיגת שלה ב 260 ננומטר באמצעות ספקטרופוטומטר. בשל מחצית מתילן כחול על החללית DNA הפתרון צריך גוון כחול גלוי. </li><li style=";text-align:right;direction:rtl"> להכין טרי 1 מ&quot;ל של תמיסה של 10 mM טריס (2-carboxyethyl) phosphine TCEP במים מזוקקים deionized (DI-מים). מניסיוננו, פתרונות אלה TCEP יישארו טריים למשך שבוע כאשר מאוחסנים בחושך ב 4 ° C. </li><li style=";text-align:right;direction:rtl"> כדי להפחית את כל איגרות החוב דיסולפיד שעשוי להיות נוכח פתרון ה-DNA בדיקה, לשלב 1 μL של פתרון ה-DNA בדיקה מניות עם μL 2 של הפתרון TCEP ומערבבים בעדינות עם טפטפת. דגירה את התערובת למשך שעה אחת במיכל, כהה בקירור. הפתרון כחול בתחילה צריך להיות ברור כמו TCEP הפיך מפחית את מתילן כחול. אם הפתרון אינו ברור, לחזור על התהליך באמצעות פתרון TCEP טריים או, אולי, בטמפרטורת החדר. </li><li style=";text-align:right;direction:rtl"> לאחר שעה לדלל את ה-DNA מופחת בדיקה עם פתרון מ&quot;ל 1 של חיץ, זה יהיה לדלל אותו ריכוז של 200nM. בהמשך, תוכלו דגירה קבוצה של אלקטרודות דיסק זהב 200 חלקים μL של פתרון זה בדיקה מדולל. </li><li style=";text-align:right;direction:rtl"> טרי להכין לפחות 2 מ&quot;ל של 2mm mercaptohexanol ב פוספט שנאגרו מלוחים. </li></ol> 2. חיישן הכנה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מערבבים אבקת 0.05 מיקרון אלומינה עם מים על בד ליטוש עדין. פולין קבוצה של אלקטרודות זהב דיסק (CH מכשירים, אוסטין, טקסס) על ידי לחיצה על משטח זהב בחוזקה לתוך הבד רטוב, ומרגש אותם הספרה שמונה דפוס כשלוש דקות לכל אלקטרודה. </li><li style=";text-align:right;direction:rtl"> יש לשטוף את האלקטרודות מלוטש עם DI-מים לטבול אותם לתוך צינורות Eppendorf מלאים זהה. Sonicate במשך חמש דקות כדי להסיר כל אבקת אלומינה שיורית. </li><li style=";text-align:right;direction:rtl"> הנח את האלקטרודות לתוך פתרון 0.5 חומצה גופרתית M, לצרף אותם potentiostat יחד עם מונה פלטינה וכסף / אלקטרודה כסף התייחסות כלוריד, ולהפעיל סדרה של voltammograms לחמצן, להקטין את electrochemically נקי השטח שלהם. בעקבות זאת לבצע ניקוי second אלקטרוכימיים בתמיסה של 0.01 M KCl חומצה גופרתית M 0.1. הפרטים קנס של הליכים אלה ניקוי ניתן למצוא במאמר שלנו הטבע הפרוטוקולים 1, וכן להשלים את הווידאו הזה. </li><li style=";text-align:right;direction:rtl"> סדר סט של 2 צינורות מ&quot;ל Eppendorf במעמד ולמלא כל אחד עם 200 μL של פתרון ה-DNA בדיקה. ריכוז ה-DNA בדיקה בפתרון זה יגדיר את הצפיפות שבה DNAs בדיקה לארוז על משטח החיישן. ביצועי חיישן תלויה מאוד על צפיפות בדיקה, עם צפיפות האופטימלי משתנה מארכיטקטורה one חיישן הבא. ריכוז החללית בשימוש בשלב זה צריך אפוא להיות מותאם לכל סוג חדש של חיישן 2. עבור ארכיטקטורות בדיקה לנו נחקר עד כה, ה-DNA ריכוזי בדיקה אנו מעסיקים בטווח זה צעד מן nM 15-2 מיקרומטר, עם 200 ננומטר להיות ערך טיפוסי. </li><li style=";text-align:right;direction:rtl"> יש לשטוף את האלקטרודות דיסק זהב עם DI-מים, ואז לטבול אותם הפתרון DNA רלוונטיים בדיקה בצינור Eppendorf במשך שעה אחת. בשלב זה, את ה-DNA בדיקה יצרף פני האלקטרודה זהב דרך היווצרות של monolayer תיאול-on-זהב עצמית התאספו. </li><li style=";text-align:right;direction:rtl"> לשטוף עם מים את האלקטרודות-DI, לטבול אותם 2mm mercaptohexanol בצינור Eppendorf ולאחסן אותם במקום חשוך למשך 3 שעות הלילה בטמפרטורת החדר כדי להבטיח היווצרות מלאה של monolayer התאספו עצמית. שלב זה כולל את mercaptohexanol כחלק monolayer מעורבת כדי להבטיח את היווצרות monolayer יציב. כדי למנוע אידוי מומלץ לאטום את האלקטרודה לתוך הצינור Eppendorf עם parafilm. חיישנים ניתן לאחסן את הפתרון הזה במשך כמה ימים אם יש צורך. </li><li style=";text-align:right;direction:rtl"> כאשר אתה מוכן להשתמש בחיישן, לשטוף אותו עם DI-מים ואז להשרות אותו חיץ לפחות עשר דקות. חיישנים שמטרתן זיהוי הנוגדן חייב גם להיות שקוע בפתרון של 100 ננומטר של גדיל את ההכרה הרלוונטיים לפני השימוש, ואחריו מהיר מאוד לשטוף עם חיץ. </li></ol> 3. בדיקת חיישן לזיהוי DNA <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בפרוטוקול זה, גדיל 17 בדיקה נוקלאוטיד מודבקת אלקטרודות זהב. יש כתב כחול מתילן חמזור בסוף 3&#39;שלה (איור 1). כאשר מולקולה בדיקה מכליא עם גדיל ללכוד, הנוכחי דרך המעגל חיישן פוחתת. </li><li style=";text-align:right;direction:rtl"> לשטוף חיישן טרי עם DI-מים לטבול אותו ריקמדגם חסר היעד על מנת להקליט את אות הרקע שהיא מייצרת. חבר את חיישן להוביל את האלקטרודה העבודה של potentiostat. המקום מונה פלטינה אלקטרודה כסף / כסף כלורי הפניה אלקטרודה לתוך התמיסה. </li><li style=";text-align:right;direction:rtl"> הפעל מדידה גל ריבועי בין 0 ל -0.6 V עם אמפליטודה של mV 25 וגודל הצעד של 1mV. תדירות אופטימלית גל מרובע יהיה תלוי בפרטים של ארכיטקטורת בדיקה 2,3; עבור ארכיטקטורות בדיקה השתמשנו בערכים אופטימליים הם בדרך כלל בטווח של 60 עד 600 הרץ. אתה צריך לראות לשיא מעוגלות בכ -0.35 V, פוטנציאל חיזור כחול מתילן (פוטנציאל שיא עשויים להשתנות מעט בהתאם pH המדויק של פתרון המבחן שלך). גובה מתחילת המחקר הנוכחי לשיא זו היא מידתית להעביר את יעילות אלקטרון בין הכחול מתילן ואת האלקטרודה זהב (Figure2). שמור המדידה ברקע. </li><li style=";text-align:right;direction:rtl"> הזז את האלקטרודות לפתרון המכיל את מולקולת ה-DNA היעד של עניין, לאזן (5 עד 120 דקות בהתאם למבנה גודל, ריכוז target4, 5) וכן לאסוף voltammagram הגל השני מרובע. גובה השיא ב -0.35 V ישתנה מן המדידה, הרקע הראשוני. גודל השינוי הזה קשור ריכוז אנליטי. זה נתוני התפוקה העיקרית של חיישן זה (איור 3). </li><li style=";text-align:right;direction:rtl"> מדידת שינוי אות יחסית, הירידה באחוז או הגדלת האות ביחס לשיא את הרקע, היא לעיתים קרובות יותר לשחזור מדידת שינוי מוחלט הנוכחית, כמו זו מתקנת עבור וריאציות באזור את פני השטח של האלקטרודה. כדי לעשות זאת, ההבדל בין זרם שיא השיא הנוכחי רקע מחולקים על ידי שיא הרקע הנוכחי. </li></ol> 4. חיישן התחדשות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לאחר המדידות שלך מלא, הזז את החיישן לתוך מיכל מלא במים DI-30 עבור s, או להשפריץ את זה עם זרם קבוע של מים DI-30 s. חזור על פעולה זו עוד פעמיים עם מים deionized טריים. הערה: analytes כמה הם עמידים בפני גישה זו; להם לנסות אגרסיבי שטיפה ב hydrochloride 6 guanidine M או אתנול 70%. </li><li style=";text-align:right;direction:rtl"> שים את חיישן בחזרה פתרון שבו יבוצעו מדידות. תוך דקה, את גובה שיא צריך לחזור לערכו המקורי. ראוי לציין כי חיישנים אלה מפגינים לעתים קרובות שינוי אות מעט גדול יותר במהלך המבחן הראשון שלהם מחזור התחדשות, והתוצאות עקביות מאוד במהלך המחזורים שלאחר מכן 6. </li></ol> 5. בדיקת חיישן לזיהוי נוגדנים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בפרוטוקול זה, בדיקה DNA מתילן כחול ו-תיאול שונה בשימוש חיישנים אלה משמש גדיל &quot;עוגן&quot; 7. היא מחוברת ישירות האלקטרודה זהב. זו הכלאה ואז עם השנייה, גדיל הדנ&quot;א &quot;הכרה&quot; כי כבר מצומדות קוולנטית אל האנטיגן הרלוונטי (איור 4). היו לנו מזל עם בתים סינתזה מסחריים, כגון Biosearch טכנולוגיות Panagene, לסינתזה של DNA-אנטיגן מפלצות הצורך. צעד הכלאה מתבצעת על ידי העברת חיישן מראש מפוברק לתוך צינור Eppendorf המכיל 100 ננומטר של גדיל הדנ&quot;א הרלוונטי הכרה PBS שעה 1. </li><li style=";text-align:right;direction:rtl"> מניחים את החיישן בפתרון ריק הרלוונטיים. צרף את זה כדי להוביל את האלקטרודה העבודה של potentiostat ובמקום מונה פלטינה אלקטרודה וכסף / אלקטרודה כסף התייחסות כלוריד לתוך התמיסה. </li><li style=";text-align:right;direction:rtl"> בצע voltammetry גל ריבועי כמתואר לעיל. עבור ארכיטקטורת בדיקה מסוימת השתמשנו כאן את התדר האופטימלי גל מרובע הוא 60 הרץ. אתה צריך לראות לשיא מעוגלות סביב -0.35 V. שמור המדידה ברקע. </li><li style=";text-align:right;direction:rtl"> מעבירים את האלקטרודות לפתרון אנליטי המכיל את היעד, דגירה של 5 דקות עד 60, וכן לאסוף voltammagram הגל השני מרובע. אם היעד הוא נוגדן להציג את השיא ב -0.35 V תפחת. גודל השינוי הזה קשור ריכוז נוגדן. </li></ol> 6. בדיקת חיישן לזיהוי מולקולה קטנה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> במקרה זה, המולקולה החללית על פני החיישן הוא aptamer, ה-DNA או RNA מולקולה כי נבחרה במבחנה לקשור אנליטי מולקולרית ספציפית, כי השינויים במבנה שלה (קפלים) על כבילת אנליטי היעד שלה 8,9 ( איור 5). כאן אנחנו מעסיקים קוקאין מחייב, aptamer דנ&quot;א שפותח על ידי המעבדה 10,11 Stojanovic. </li><li style=";text-align:right;direction:rtl"> לשטוף חיישן טרי עם DI-מים לטבול אותו מדגם ריק חסר היעד על מנת להקליט את אות הרקע שהיא מייצרת. חבר את חיישן להוביל את האלקטרודה העבודה של potentiostat. המקום מונה פלטינה התייחסות כסף / כסף כלורי לתוך התמיסה. </li><li style=";text-align:right;direction:rtl"> בצע voltammetry גל ריבועי כמתואר לעיל. עבור ארכיטקטורת בדיקה מסוימת השתמשנו כאן את התדר האופטימלי גל מרובע הוא 200Hz (אבל 60 הרץ גם עובד). אתה צריך לראות לשיא מעוגלות סביב -0.35 V. שמור המדידה ברקע. </li><li style=";text-align:right;direction:rtl"> מעבירים את האלקטרודות לפתרון אנליטי המכיל את היעד, דגירה של 5 דקות ~, ולאסוף voltammagram הגל השני מרובע. גובה השיא ב -0.35 V ישתנה. גודל השינוי הזה קשור ריכוז אנליטי היעד. אם אתה לא יכול לקבל מדגם קוקאין, פרוקאין, השימוש אשר אינה מוסדרת, יכול לשמש כתחליף. </li></ol> 7. נציג תוצאות: כאשר נעשה שימוש כדי לזהות DNA באמצעות ארכיטקטורה הראשונה, האות צריך ירידה של לפחות 60% כאשר equilibrated למטרה 200 ננומטר. לאחר שלוש שטיפות קצרה במים deionized, האות צריך לחזור קרוב מאוד (בטווח% 0.1-5) לערכו המקורי. חיישנים לגילוי נוגדנים צריך לעבור ירידה אות של 40% ל -80. Aptamer מבוססי חיישנים לגילוי של קוקאין התערוכה עלייה אות של עד 200% בהתאם כיסוי תדירות פני השטח שבו הם פועלים. עבור החיישן קוקאין, כיסוי השטח נמוכה היא הטובה ביותר 3. <img src="/files/ftp_upload/2922/2922fig1.jpg" alt="איור 1" /> באיור 1. איתור של ה-DNA עם biosensor DNA אלקטרוכימיים. <img src="/files/ftp_upload/2922/2922fig2.jpg" alt="איור 2" /> 2. איור צילום מסך המציג את האות המיוצר על ידי biosensor E-DNA במהלך voltammetry גל מרובע. <img src="/files/ftp_upload/2922/2922fig3.jpg" alt="איור 3" /> 3. איור צילום מסך המציג את האותות המיוצרים על ידי biosensor E-DNA במהלך voltammetry גל מרובע, לפני ואחרי הכלאה עם אנליטי. <img src="/files/ftp_upload/2922/2922fig4.jpg" alt="איור 4" /> איור 4. איתור של נוגדנים עם biosensor פיגום. <img src="/files/ftp_upload/2922/2922fig5.jpg" alt="איור 5" /> איור 5. איתור של קוקאין או פרוקאין עם biosensor אלקטרוכימי aptamer. <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> אישית אוליגו </td><td> רצף </td><td> תגובות </td></tr><tr><td> לינארי בדיקה DNA (LP17) </td><td> 5&#39;-HS-(CH2) 6 TGGATCGGCGTTTTATT-(CH2) 7-NH-MB-3 &quot; </td><td> HPLC מטוהרים, ניתן להזמין עם אס </td></tr><tr><td> אנליטי יעד DNA </td><td> AATAAAACGCCGATCCA </td><td> ללא שינוי </td></tr><tr><td> הכרה סטרנד </td><td> 5&#39;-Antigen-TEG-CAGTGGCGTTTTATTCTTGTTACTG-3 &quot; </td><td></td></tr><tr><td> הפיגום עוגן </td><td> 5&#39;-HS-(CH 2) 6 GCAGTAACAAGAATAAAACGC CACTGC-(CH 2) 7 MB </td><td> HPLC מטוהרים, ניתן להזמין עם אס </td></tr><tr><td> A4 קוקאין aptamer </td><td> 5&#39;-HS-AGACAAGGAAAATCCTTCAATGAAGTGGGTCG-MethyleneBlue-3 &quot; </td><td> HPLC מטוהרים, ניתן להזמין עם אס </td></tr></tbody></table> טבלה 1. בדיקה ו-DNA רצפים היעד.

<ol>
	<li>Xiao, Y., Lai, R. Y., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+electrode-immobilized,+redox-modified+oligonucleotides+for+electrochemical+DNA+and+aptamer-based+sensing.">Preparation of electrode-immobilized, redox-modified oligonucleotides for electrochemical DNA and aptamer-based sensing.</a> Nat. Protocols. 2, 2875-2880 (2007).</li><li>Ricci, F., Lai, R. Y., Heeger, A. J., Plaxco, K. W., Sumner, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+Molecular+Crowding+on+the+Response+of+an+Electrochemical+DNA+Sensor.">Effect of Molecular Crowding on the Response of an Electrochemical DNA Sensor.</a> Langmuir. 23, 6827-6834 (2007).</li><li>White, R. J., Phares, N., Lubin, A. A., Xiao, Y., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+Electrochemical+Aptamer-Based+Sensors+via+Optimization+of+Probe+Packing+Density+and+Surface+Chemistry.">Optimization of Electrochemical Aptamer-Based Sensors via Optimization of Probe Packing Density and Surface Chemistry.</a> Langmuir. 24, 10513-10518 (2008).</li><li>Lubin, A. A., Vander Stoep Hunt, B., White, R. J., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+Probe+Length,+Probe+Geometry,+and+Redox-Tag+Placement+on+the+Performance+of+the+Electrochemical+E-DNA+Sensor.">Effects of Probe Length, Probe Geometry, and Redox-Tag Placement on the Performance of the Electrochemical E-DNA Sensor.</a> Analytical Chemistry. 81, 2150-2158 (2009).</li><li>Lubin, A. A., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Folding-Based+Electrochemical+Biosensors:+The+Case+for+Responsive+Nucleic+Acid+Architectures.">Folding-Based Electrochemical Biosensors: The Case for Responsive Nucleic Acid Architectures.</a> Accounts of Chemical Research. 43, 496-505 (2010).</li><li>Lubin, A. A., Lai, R. Y., Baker, B. R., Heeger, A. J., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence-Specific,+Electronic+Detection+of+Oligonucleotides+in+Blood,+Soil,+and+Foodstuffs+with+the+Reagentless,+Reusable+E-DNA+Sensor.">Sequence-Specific, Electronic Detection of Oligonucleotides in Blood, Soil, and Foodstuffs with the Reagentless, Reusable E-DNA Sensor.</a> Analytical Chemistry. 78, 5671-5677 (2006).</li><li>Cash, K. J., Ricci, F., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Electrochemical+Sensor+for+the+Detection+of+Protein?Small+Molecule+Interactions+Directly+in+Serum+and+Other+Complex+Matrices.">An Electrochemical Sensor for the Detection of Protein?Small Molecule Interactions Directly in Serum and Other Complex Matrices.</a> Journal of the American Chemical Society. 131, 6955-6957 (2009).</li><li>Baker, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Electronic,+Aptamer-Based+Small-Molecule+Sensor+for+the+Rapid,+Label-Free+Detection+of+Cocaine+in+Adulterated+Samples+and+Biological+Fluids.">An Electronic, Aptamer-Based Small-Molecule Sensor for the Rapid, Label-Free Detection of Cocaine in Adulterated Samples and Biological Fluids.</a> Journal of the American Chemical Society. 128, 3138-3139 (2006).</li><li>Ferapontova, E. E., Olsen, E. M., Gothelf, K. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA+Aptamer-Based+Electrochemical+Biosensor+for+Detection+of+Theophylline+in+Serum.">An RNA Aptamer-Based Electrochemical Biosensor for Detection of Theophylline in Serum.</a> Journal of the American Chemical Society. 130, 4256-4258 (2008).</li><li>Stojanovic, M. N., Landry, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-Based+Colorimetric+Probe+for+Cocaine.">Aptamer-Based Colorimetric Probe for Cocaine.</a> Journal of the American Chemical Society. 124, 9678-9679 (2002).</li><li>Stojanovic, M. N., Prada, P. d. e., Landry, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-Based+Folding+Fluorescent+Sensor+for+Cocaine.">Aptamer-Based Folding Fluorescent Sensor for Cocaine.</a> Journal of the American Chemical Society. 123, 4928-4931 (2001).</li><li>Cash, K. J., Heeger, A. J., Plaxco, K. W., Xiao, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+a+Reusable,+DNA+Pseudoknot-Based+Electrochemical+Sensor+for+Sequence-Specific+DNA+Detection+in+Blood+Serum.">Optimization of a Reusable, DNA Pseudoknot-Based Electrochemical Sensor for Sequence-Specific DNA Detection in Blood Serum.</a> Analytical Chemistry. 81, 656-661 (2009).</li><li>Xiao, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Electrochemical+Sensor+for+Single+Nucleotide+Polymorphism+Detection+in+Serum+Based+on+a+Triple-Stem+DNA+Probe.">An Electrochemical Sensor for Single Nucleotide Polymorphism Detection in Serum Based on a Triple-Stem DNA Probe.</a> Journal of the American Chemical Society. 131, 15311-15316 (2009).</li><li>Zuo, X., Xiao, Y., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Specificity,+Electrochemical+Sandwich+Assays+Based+on+Single+Aptamer+Sequences+and+Suitable+for+the+Direct+Detection+of+Small-Molecule+Targets+in+Blood+and+Other+Complex+Matrices.">High Specificity, Electrochemical Sandwich Assays Based on Single Aptamer Sequences and Suitable for the Direct Detection of Small-Molecule Targets in Blood and Other Complex Matrices.</a> Journal of the American Chemical Society. 131, 6944-6945 (2009).</li><li>Xia, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Electrochemical+Supersandwich+Assay+for+Sensitive+and+Selective+DNA+Detection+in+Complex+Matrices.">An Electrochemical Supersandwich Assay for Sensitive and Selective DNA Detection in Complex Matrices.</a> Journal of the American Chemical Society. 132, 14346-14348 (2010).</li><li>Patterson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+Triplex-Forming+Oligonucleotide+Probes+for+the+Reagentless,+Electrochemical+Detection+of+Double-Stranded+DNA.">Using Triplex-Forming Oligonucleotide Probes for the Reagentless, Electrochemical Detection of Double-Stranded DNA.</a> Analytical Chemistry. 82, 9109-9115 (2010).</li><li>Ferguson, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+Microfluidic+Electrochemical+DNA+Sensor.">Integrated Microfluidic Electrochemical DNA Sensor.</a> Analytical Chemistry. 81, 6503-6508 (2009).</li><li>Swensen, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous,+Real-Time+Monitoring+of+Cocaine+in+Undiluted+Blood+Serum+via+a+Microfluidic,+Electrochemical+Aptamer-Based+Sensor.">Continuous, Real-Time Monitoring of Cocaine in Undiluted Blood Serum via a Microfluidic, Electrochemical Aptamer-Based Sensor.</a> Journal of the American Chemical Society. 131, 4262-4266 (2009).</li></ol>

הערה חשובה היא שאף אחד הניסויים שתוארו לעיל יפעל כראוי אלא אם כן את האלקטרודות נוקו כראוי. הנה מדריך הנוהל שלנו ניקוי אלקטרוכימי. כאשר עובדים עם potentiostats CH מכשירים, גמר את השלבים לניקוי באמצעות סט של שלוש תוכניות מאקרו. שלב אפס (E-נקי O) לטבול את האלקטרודות 0.5MH 2 SO 4 ולחבר אותם אלקטרודות העבודה של potentiostat. כמו כן לצרף לטבול התייחסות Ag / AgCl ו לדלפק אלקטרודה פלטינה. התחל עם צעד חמצון (2 V עבור 5 ים) ולאחר מכן צעד הפחתה (0.35 V עבור 10 ות). שלב ראשון (E-נקי 1) ליזום חמצון סריקות הפחתה בתנאים חומציים זהה (0.5MH 2 SO 4) 0.35-1.5 V (20 סריקות בקצב סריקה של 4 V / s ו מרווח דגימה של 0.01 V, ואחריהם ארבעה סריקות בקצב סריקה של 0.1 V / s ו מרווח מדגם V 0.01). שלב שני (E-נקי 2) ניהול קבוצה נוספת של חמצון אלקטרוכימיים וסריקות הפחתה בתנאים חומציים (0.01 מ &#39;KCl/0.1 MH 2 SO 4) כיסוי four טווחי פוטנציאל שונים (ביצע כל בקצב סריקה של 0.1 V s 1 ו מרווח דגימה של 0.01 V עבור 10 מקטעים ): (i) טווח הפוטנציאל בין 0.2 ל V 0.75 (ii) טווח הפוטנציאל 0.2-1.0 V (iii) טווח הפוטנציאל של 0.2 עד 1.25 V; (iv) טווח הפוטנציאל 0.2-1.5 V. סוגים רבים של אלקטרודות זהב ניתן להשתמש כדי לנהל ניסויים אלו. בנוסף אלקטרודות דיסק זהב כמו המועסקים כאן, יש לנו הצלחה עם משטחים זהב microfabricated, חוטי זהב, זהב על מעגלים מודפסים. יחד עם חיישנים המתואר במאמר זה, רבים אחרים biosensor אלקטרוכימיים ארכיטקטורות DNA דווחו. זה כולל חיישנים עם pseudoknot 12, גדיל משולש 13, 14 כריך, כריך סופר 15, או 16 טריפלקס אדריכלות. בעתיד, אנו צופים כי חיישנים אלה ישמשו נקודת אבחון טיפול רפואי. הם השתלבו בהצלחה לתוך מכשירים microfluidic מספר 17,18, ומציעים יתרונות רבים על פני מערכות זיהוי אופטי אנליטי. בפרט, חיישנים אלה יכולים לתפקד עכור, סמיך מאוד אופטית אוטומטית פלורסנט דגימות.

<table border="1" style=";text-align:right;direction:rtl"><tbody><tr><th> שם מגיב </th><th> חברה </th><th> מספר קטלוגי </th><th> הערות (אופציונלי) </th></tr><tr><td> דיסק אלקטרודות זהב </td><td> CH מכשירים </td><td> CHI101 </td><td> ניתן שימוש חוזר </td></tr><tr><td> דנ&quot;א סינתטי Probe </td><td> Biosearch טכנולוגיות </td><td> מנהג </td><td></td></tr><tr><td> יעד דנ&quot;א סינתטי </td><td> סיגמא Genosys </td><td> מנהג </td><td></td></tr><tr><td> Mercaptohexanol </td><td> סיגמא אולדריץ </td><td> 725226-1G </td><td> אחסנו במקום קריר חשוך </td></tr><tr><td> פלטינום אלקטרודה </td><td> בשיא </td><td> MW-1032 </td><td> ניתן שימוש חוזר </td></tr><tr><td> Ag / AgCl הפניה </td><td> בשיא </td><td> MF-2052 </td><td> ניתן שימוש חוזר </td></tr><tr><td> ליטוש בד </td><td> החוקר </td><td> 40-7212 </td><td></td></tr><tr><td> אלומינה פולנית </td><td> החוקר </td><td> 40-6325-016 </td><td></td></tr><tr><td> פוספט שנאגרו הצפת מלוחים, pH 7.4 </td><td> סיגמא אולדריץ </td><td> P7059-1L </td><td></td></tr><tr><td> CH מכשירים 605A </td><td> CH מכשירים </td><td> 605A </td><td> השתמש בכל potentiostat </td></tr><tr><td> סרום סובך של יילוד </td><td> סיגמא אולדריץ </td><td> N4637-500ml </td><td> Stored קפוא </td></tr><tr><td> NanoDrop </td><td> פישר סיינטיפיק </td><td> ND-2000 </td><td> השתמש בכל UV-VIS </td></tr><tr><td> PCR Mix </td><td> Bio-Rad </td><td> 170-8862 </td><td> Stored קפוא </td></tr><tr><td> קוקאין </td><td> סיגמא אולדריץ </td><td> C5776 </td><td> DEA רשיון חובה </td></tr><tr><td> פרוקאין </td><td> סיגמא אולדריץ </td><td> P9879 </td><td> תחליף קוקאין </td></tr><tr><td> Anti-Flag נוגדן </td><td> סיגמא אולדריץ </td><td> F1804-1mg </td><td></td></tr></tbody></table>

fabrication of electrochemical-dna biosensors for the reagentless detection of nucleic acids, proteins and small molecules

כמו ברפואה נהוגה כיום, רופאים לשלוח דגימות למעבדה מרכזית לבדיקה ולכן צריך לחכות שעות או ימים כדי לקבל את התוצאות. חולים רבים ייטב ידי, בדיקות מהיר ליד המיטה. לשם כך במעבדה שלנו ואחרים פיתחו פלטפורמה צדדי, biosensor reagentless התומך כמותי, זיהוי reagentless, אלקטרוכימיים של חומצות גרעין (DNA, RNA), חלבונים (כולל נוגדנים) לבין מולקולות קטנות analytes ישירות בדגימות קליניות וסביבתיות לא מעובדים. בסרטון הזה, אנחנו מדגימים את ההכנה והשימוש biosensors כמה זה בכיתה &quot;E-DNA&quot;. בפרט, אנו לפברק ולהפגין חיישנים לגילוי של רצף ה-DNA היעד תערובת תגובת שרשרת פולימרז, נוגדן ל-HIV ספציפיים הקוקאין הסם. הליך הכנת דורש רק שלוש שעות של הידיים על המאמץ ואחריו הדגירה לילה, והשימוש בהם מצריך רק מספר דקות.

Watch this Scientific Journal Video about Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules at JoVE.com

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

&quot;ה-DNA&quot; חיישנים, reagentless, biosensors אלקטרוכימיים כי ביצועים טובים גם כאשר תיגר ישירות בדם מטריצות מורכבות אחרות, הותאמו זיהוי של מגוון רחב של חומצת גרעין חלבון, ו analytes מולקולה קטנה. כאן אנו מציגים הליך כללי עבור ייצור ושימוש של חיישנים כאלה.

המצאה של אלקטרוכימי-DNA Biosensors לגילוי Reagentless של חומצות, חלבונים ומולקולות קטנות גרעין

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

fabrication-electrochemical-dna-biosensors-for-reagentless-detection

Research

JoVE Journal

Bioengineering

33.0K Views.  University Of California Santa Barbara. "ה-DNA" חיישנים, reagentless, biosensors אלקטרוכימיים כי ביצועים טובים גם כאשר תיגר ישירות בדם מטריצות מורכבות אחרות, הותאמו זיהוי של מגוון רחב של חומצת גרעין חלבון, ו analytes מולקולה קטנה. כאן אנו מציגים הליך כללי עבור ייצור ושימוש של חיישנים כאלה.

Video: Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

On-chip Isotachophoresis for Separation of Ions and Purification of Nucleic Acids

Electrokinetic techniques are a staple of microscale applications because of their unique ability to perform a variety of fluidic and electrophoretic processes in simple, compact systems with no moving parts. Isotachophoresis (ITP) is a simple and very robust electrokinetic technique that can achieve million-fold preconcentration1,2 and efficient separation and extraction based on ionic mobility.3 For example, we have demonstrated the application of ITP to separation and sensitive detection of unlabeled ionic molecules (e.g. toxins, DNA, rRNA, miRNA) with little or no sample preparation4-8 and to extraction and purification of nucleic acids from complex matrices including cell culture, urine, and blood.9-12
ITP achieves focusing and separation using an applied electric field and two buffers within a fluidic channel system. For anionic analytes, the leading electrolyte (LE) buffer is chosen such that its anions have higher effective electrophoretic mobility than the anions of the trailing electrolyte (TE) buffer (Effective mobility describes the observable drift velocity of an ion and takes into account the ionization state of the ion, as described in detail by Persat et al.13). After establishing an interface between the TE and LE, an electric field is applied such that LE ions move away from the region occupied by TE ions. Sample ions of intermediate effective mobility race ahead of TE ions but cannot overtake LE ions, and so they focus at the LE-TE interface (hereafter called the "ITP interface"). Further, the TE and LE form regions of respectively low and high conductivity, which establish a steep electric field gradient at the ITP interface. This field gradient preconcentrates sample species as they focus. Proper choice of TE and LE results in focusing and purification of target species from other non-focused species and, eventually, separation and segregation of sample species.
We here review the physical principles underlying ITP and discuss two standard modes of operation: "peak" and "plateau" modes. In peak mode, relatively dilute sample ions focus together within overlapping narrow peaks at the ITP interface. In plateau mode, more abundant sample ions reach a steady-state concentration and segregate into adjoining plateau-like zones ordered by their effective mobility. Peak and plateau modes arise out of the same underlying physics, but represent distinct regimes differentiated by the initial analyte concentration and/or the amount of time allotted for sample accumulation.
We first describe in detail a model peak mode experiment and then demonstrate a peak mode assay for the extraction of nucleic acids from E. coli cell culture. We conclude by presenting a plateau mode assay, where we use a non-focusing tracer (NFT) species to visualize the separation and perform quantitation of amino acids.

Isotachophoresis (ITP) is a robust electrokinetic separation and preconcentration technique with applications ranging from toxin detection to sample preparation. We review the physical principles of ITP and the methodology of applying this technique to two specific example applications: separation and detection of small molecules and purification of nucleic acids from cell culture lysate.

על שבב Isotachophoresis להפרדה של יוני וטיהור של חומצות גרעין

Electrokinetic techniques are a staple of microscale applications because of their unique ability to perform a variety of fluidic and electrophoretic ...

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a model microorganism. The biosensor relies on direct binding of the target bacteria cells onto its surface, while no pretreatment (e.g.&#160;by cell lysis) of the studied sample is required. A mesoporous Si thin film is used as the optical transducer element of the biosensor. Under white light illumination, the porous layer displays well-resolved Fabry-P&#233;rot fringe patterns in its reflectivity spectrum. Applying a fast Fourier transform (FFT) to reflectivity data results in a single peak. Changes in the intensity of the FFT peak are monitored. Thus, target bacteria capture onto the biosensor surface, through antibody-antigen interactions, induces measurable changes in the intensity of the FFT peaks, allowing for a &#39;real time&#39; observation of bacteria attachment.
The mesoporous Si film, fabricated by an electrochemical anodization process, is conjugated with monoclonal antibodies, specific to the target bacteria. The immobilization, immunoactivity and specificity of the antibodies are confirmed by fluorescent labeling experiments. Once the biosensor is exposed to the target bacteria, the cells are directly captured onto the antibody-modified porous Si surface. These specific capturing events result in intensity changes in the thin-film optical interference spectrum of the biosensor. We demonstrate that these biosensors can detect relatively low bacteria concentrations (detection limit of 104 cells/ml) in less than an hour.

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor for rapid bacteria detection is introduced. The biosensor is based on a nanostructured porous Si, which is designed to directly capture the target bacteria cells onto its surface. We use monoclonal antibodies, immobilized onto the porous transducer, as the capture probes. Our studies demonstrate the applicability of these biosensors for the detection of low bacterial concentrations within minutes with no prior sample processing (such as cell lysis).

זיהוי אופטי של<em&gt; א coli</em&gt; חיידקים על ידי Biosensors הסיליקון Mesoporous

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a ...

Delivery of Proteins, Peptides or Cell-impermeable Small Molecules into Live Cells by Incubation with the Endosomolytic Reagent dfTAT

Macromolecular delivery strategies typically utilize the endocytic pathway as a route of cellular entry. However, endosomal entrapment severely limits the efficiency with which macromolecules penetrate the cytosolic space of cells. Recently, we have circumvented this problem by identifying the reagent dfTAT, a disulfide bond dimer of the peptide TAT labeled with the fluorophore tetramethylrhodamine. We have generated a fluorescently labeled dimer of the prototypical cell-penetrating peptide (CPP) TAT, dfTAT, which penetrates live cells and reaches the cytosolic space of cells with a particularly high efficiency. Cytosolic delivery of dfTAT is achieved in multiple cell lines, including primary cells. Moreover, delivery does not noticeably impact cell viability, proliferation or gene expression. dfTAT can deliver small molecules, peptides, antibodies, biologically active enzymes and a transcription factor. In this report, we describe the protocols involved in dfTAT synthesis and cellular delivery. The manuscript describes how to control the amount of protein delivered to the cytosolic space of cells by varying the amount of protein administered extracellularly. Finally, the current limitations of this new technology and steps involved in validating delivery are discussed. The described protocols should be extremely useful for cell-based assays as well as for the ex vivo manipulation and reprogramming of cells.

We describe how to deliver proteins and cell-impermeable small molecules into cultured mammalian cells by a simple co-incubation protocol with a reagent that causes endocytic organelles to become leaky.

משלוח של חלבונים, פפטידים או מולקולות קטנות Cell-חדיר לתאים חיים על ידי דגירה עם Endosomolytic מגיב dfTAT

Macromolecular delivery strategies typically utilize the endocytic pathway as a route of cellular entry. However, endosomal entrapment severely limits the ...

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, significantly affecting the rate of human mortality and morbidity. Conventional methods for the detection of V. parahaemolyticus such as culture-based methods, immunological assays, and molecular-based methods require complicated sample handling and are time-consuming, tedious, and costly. Recently, biosensors have proven to be a promising and comprehensive detection method with the advantages of fast detection, cost-effectiveness, and practicality. This research focuses on developing a rapid method of detecting V. parahaemolyticus with high selectivity and sensitivity using the principles of DNA hybridization. In the work, characterization of synthesized polylactic acid-stabilized gold nanoparticles (PLA-AuNPs) was achieved using X-ray Diffraction (XRD), Ultraviolet-visible Spectroscopy (UV-Vis), Transmission Electron Microscopy (TEM), Field-emission Scanning Electron Microscopy (FESEM), and Cyclic Voltammetry (CV). We also carried out further testing of stability, sensitivity, and reproducibility of the PLA-AuNPs. We found that the PLA-AuNPs formed a sound structure of stabilized nanoparticles in aqueous solution. We also observed that the sensitivity improved as a result of the smaller charge transfer resistance (Rct) value and an increase of active surface area (0.41 cm2). The development of our DNA biosensor was based on modification of a screen-printed carbon electrode (SPCE) with PLA-AuNPs and using methylene blue (MB) as the redox indicator. We assessed the immobilization and hybridization events by differential pulse voltammetry (DPV). We found that complementary, non-complementary, and mismatched oligonucleotides were specifically distinguished by the fabricated biosensor. It also showed reliably sensitive detection in cross-reactivity studies against various food-borne pathogens and in the identification of V. parahaemolyticus in fresh cockles.

A protocol for the development of an electrochemical DNA biosensor comprising a polylactic acid-stabilized, gold nanoparticles-modified, screen-printed carbon electrode to detect Vibrio parahaemolyticus is presented.

התפתחות ביוסנסור אלקטרוכימי דנ א כדי לזהות חיידק והקאה

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, ...

Visual Detection of Multiple Nucleic Acids in a Capillary Array

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently needed in disease diagnosis, microbial monitoring, genetically modified organism (GMO) detection, and forensic analysis. We have previously described the platform called CALM (Capillary Array-based Loop-mediated isothermal amplification for Multiplex visual detection of nucleic acids). Herein, we describe improved fabrication and performance processes for this platform. Here, we apply a small, ready-to-use cassette assembled by capillary array for multiplex visual detection of nucleic acids. The capillary array is pre-treated into a hydrophobic and hydrophilic pattern before fixing loop-mediated isothermal amplification (LAMP) primer sets in capillaries. After assembly of the loading adaptor, LAMP reaction mixture is loaded and isolated into each capillary, due to capillary force by a single pipetting step. The LAMP reactions are performed in parallel in the capillaries. The results are visually read out by illumination with a hand-held UV flashlight. Using this platform, we demonstrate monitoring of 8 frequently appearing elements and genes in GMO samples with high specificity and sensitivity. In summary, the platform described herein is intended to facilitate the detection of multiple nucleic acids. We believe it will be widely applicable in fields where high-throughput nucleic acid analysis is required.

This protocol describes the fabrication of a small, ready-to-use cassette that can be applied for visual detection of multiple nucleic acids in a single, test that is easy to operate. In this approach, a capillary array was used for multiplex and highly efficient detection of GMO targets.

זיהוי ויזואלי של מספר חומצות גרעין ב מערך נימי

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently ...

Development of Microfluidic Devices to Study the Elongation Capability of Tip-growing Plant Cells in Extremely Small Spaces

In vivo, tip-growing plant cells need to overcome a series of physical barriers; however, researchers lack the methodology to visualize cellular behavior in such restrictive conditions. To address this issue, we have developed growth chambers for tip-growing plant cells that contain a series of narrow, micro-fabricated gaps (~1 &#181;m) in a poly-dimethylsiloxane (PDMS) substrate. This transparent material allows the user to monitor tip elongation processes in individual cells during microgap penetration by time-lapse imaging. Using this experimental platform, we observed morphological changes in pollen tubes as they penetrated the microgap. We captured the dynamic changes in the shape of a fluorescently labeled vegetative nucleus and sperm cells in a pollen tube during this process. Furthermore, we demonstrated the capability of root hairs and moss protonemata to penetrate the 1 &#181;m gap. This in vitro platform can be used to study how individual cells respond to physically constrained spaces and may provide insights into tip-growth mechanisms.

We describe a method to investigate the capability of tip-growing plant cells, including pollen tubes, root hairs, and moss protonemata, to elongate through extremely narrow gaps (~1 &#181;m) in a microfluidic device.

פיתוח Microfluidic ללמוד את היכולת התארכות של תאי צמחים הגדלים עצה בחללים קטנים מאוד

In vivo, tip-growing plant cells need to overcome a series of physical barriers; however, researchers lack the methodology to visualize cellular behavior ...

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic regulatory circuits. The analysis of synthetic genetic regulatory networks in vivo is time consuming and suffers from a lack of environmental control, with exogenous synthetic components interacting with host processes resulting in undesired behavior. To overcome these issues, cell-free characterization of novel circuitry is becoming more prevalent. In vitro transcription and translation (IVTT) mixtures allow the regulation of the experimental environment and can be optimized for each unique system. The protocols presented here detail the fabrication of a multilayer microfluidic device that can be utilized to sustain IVTT reactions for prolonged durations. In contrast to batch reactions, where resources are depleted over time and (by-) products accumulate, the use of microfluidic devices allows the replenishment of resources as well as the removal of reaction products. In this manner, the cellular environment is emulated by maintaining an out-of-equilibrium environment in which the dynamic behavior of gene circuits can be investigated over extended periods of time. To fully exploit the multilayer microfluidic device, hardware and software have been integrated to automate the IVTT reactions. By combining IVTT reactions with the microfluidic platform presented here, it becomes possible to comprehensively analyze complex network behaviors, furthering our understanding of the mechanisms that regulate cellular processes.

The fabrication process of a PDMS-based, multilayer, microfluidic device that allows in vitro transcription and translation (IVTT) reactions to be performed over prolonged periods is described. Furthermore, a comprehensive overview of the hardware and software required to automate and maintain these reactions for prolonged durations is provided.

פלטפורמת מיקרופלואידיג רב שכבתית לצורך הובלה של ביטוי גנים ממושך ללא תא

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic ...

Self-Assembly of Gamma-Modified Peptide Nucleic Acids into Complex Nanostructures in Organic Solvent Mixtures

Current strategies in DNA and RNA nanotechnology enable the self-assembly of a variety of nucleic acid nanostructures in aqueous or substantially hydrated media. In this article, we describe detailed protocols that enable the construction of nanofiber architectures in organic solvent mixtures through the self-assembly of uniquely addressable, single-stranded, gamma-modified peptide nucleic acid (&#947;PNA) tiles. Each single-stranded tile (SST) is a 12-base &#947;PNA oligomer composed of two concatenated modular domains of 6 bases each. Each domain can bind to a mutually complimentary domain present on neighboring strands using programmed complementarity to form nanofibers that can grow to microns in length. The SST motif is made of 9 total oligomers to enable the formation of 3-helix nanofibers. In contrast with analogous DNA nanostructures, which form diameter-monodisperse structures, these &#947;PNA systems form nanofibers that bundle along their widths during self-assembly in organic solvent mixtures. Self-assembly protocols described here therefore also include a conventional surfactant, Sodium Dodecyl Sulfate (SDS), to reduce bundling effects.

This article provides protocols for the design and self-assembly of nanostructures from gamma-modified peptide nucleic acid oligomers in organic solvent mixtures.

הרכבה עצמית של חומצות פפטידיות פפטיד שעברו שינוי גמא לתוך ננו-מבנים מורכבים בתערובות ממס אורגניות

Current strategies in DNA and RNA nanotechnology enable the self-assembly of a variety of nucleic acid nanostructures in aqueous or substantially hydrated ...

The Fabrication and Operation of a Continuous Flow, Micro-Electroporation System with Permeabilization Detection

Current therapeutic innovations, such as CAR-T cell therapy, are heavily reliant on viral-mediated gene delivery. Although efficient, this technique is accompanied by high manufacturing costs, which has brought about an interest in using alternative methods for gene delivery. Electroporation is an electro-physical, non-viral approach for the intracellular delivery of genes and other exogenous materials. Upon the application of an electric field, the cell membrane temporarily allows molecular delivery into the cell. Typically, electroporation is performed on the macroscale to process large numbers of cells. However, this approach requires extensive empirical protocol development, which is costly when working with primary and difficult-to-transfect cell types. Lengthy protocol development, coupled with the requirement of large voltages to achieve sufficient electric-field strengths to permeabilize the cells, has led to the development of micro-scale electroporation devices. These micro-electroporation devices are manufactured using common microfabrication techniques and allow for greater experimental control with the potential to maintain high throughput capabilities. This work builds off a microfluidic-electroporation technology capable of detecting the level of cell membrane permeabilization at a single-cell level under continuous flow. However, this technology was limited to 4 cells processed per second, and thus a new approach for increasing the system throughput is proposed and presented here. This new technique, denoted as cell-population-based feedback control, considers the cell permeabilization response to a variety of electroporation pulsing conditions and determines the best-suited electroporation pulse conditions for the cell type under test. A higher-throughput mode is then used, where this 'optimal' pulse is applied to the cell suspension in transit. The steps for fabricating the device, setting up and running the microfluidic experiments, and analyzing the results are presented in detail. Finally, this micro-electroporation technology is demonstrated by delivering a DNA plasmid encoding for green fluorescent protein (GFP) into HEK293 cells.

This protocol describes the microfabrication techniques required to build a lab-on-a-chip, microfluidic electroporation device. The experimental setup performs controlled, single-cell-level transfections in a continuous flow and can be extended to higher throughputs with population-based control. An analysis is provided showcasing the ability to electrically monitor the degree of cell membrane permeabilization in real-time.

ייצור והפעלה של זרימה רציפה, מערכת מיקרו-אלקטרופורציה עם זיהוי חלחול

Current therapeutic innovations, such as CAR-T cell therapy, are heavily reliant on viral-mediated gene delivery. Although efficient, this technique is ...

Experimental and Data Analysis Workflow for Soft Matter Nanoindentation

Nanoindentation refers to a class of experimental techniques where a micrometric force probe is used to quantify the local mechanical properties of soft biomaterials and cells. This approach has gained a central role in the fields of mechanobiology, biomaterials design&#160;and tissue engineering, to obtain a proper mechanical characterization of soft materials with a resolution comparable to the size of single cells (&#956;m). The most popular strategy to acquire such experimental data is to employ an atomic force microscope (AFM); while this instrument offers an unprecedented resolution in force (down to pN) and space (sub-nm), its usability is often limited by its complexity that prevents routine measurements of integral indicators of mechanical properties, such as Young&#39;s Modulus (E). A new generation of nanoindenters, such as those based on optical fiber sensing technology, has recently gained popularity for its ease of integration while allowing to apply sub-nN forces with &#181;m spatial resolution, therefore being suitable to probe local mechanical properties of hydrogels and cells.
In this protocol, a step-by-step guide detailing the experimental procedure to acquire nanoindentation data on hydrogels and cells using a commercially available ferrule-top optical fiber sensing nanoindenter is presented. Whereas some steps are specific to the instrument used herein, the proposed protocol can be taken as a guide for other nanoindentation devices, granted some steps are adapted according to the manufacturer&#39;s guidelines. Further, a new open-source Python software equipped with a user-friendly graphical user interface for the analysis of nanoindentation data is presented, which allows for screening of incorrectly acquired curves, data filtering, computation of the contact point through different numerical procedures, the conventional computation of E, as well as a more advanced analysis particularly suited for single-cell nanoindentation data.

The protocol presents a complete workflow for soft material nanoindentation experiments, including hydrogels and cells. First, the experimental steps to acquire force spectroscopy data are detailed; then, the analysis of such data is detailed through a newly developed open-source Python software, which is free to download from GitHub.

זרימת עבודה ניסיונית וניתוח נתונים עבור ננו-אינדנציה של חומר רך

Nanoindentation refers to a class of experimental techniques where a micrometric force probe is used to quantify the local mechanical properties of soft ...