המחברים רוצה להכיר את התמיכה של מלזיה Universiti Putra.

הערה: כל ריאגנטים כימי וביוכימי כדי לשמש צריך להיות של כיתה אנליטית, ללא טיהור נוסף. להכין את כל הפתרונות באמצעות מים יונים סטרילי. אוטוקלב כל כלי זכוכית לפני העיקור.
התראה: אנא השתמש כל נוהלי בטיחות המתאים בעת ביצוע פעילויות מעבדה, כולל את השימוש הנדסה פקדים (fume הוד, הכפפות), ציוד מגן אישי (בטיחות משקפיים, כפפות, חלוק המעבדה, מכנסיים באורך מלא, סגורות נעלי).
1. ייצור, אפיון של שינוי אלקטרודה באמצעות ה-PLA-AuNPs
<ol><li>
הכנה ואפיון של ה-PLA-AuNPs
	<ol>
<li>להוסיף 10 מ של הפתרון סודיום ציטרט (38.8 מ מ) ל- 100 מ של רותחים chloroauric מימית תמיסה חומצית (1 מ מ) ובמהירות תירגע עד טמפרטורת הסביבה. לבחון את השינויים בצבע בפתרון AuNPs מוכן אשר מתחיל כמו צהוב, שינויים שחור ומסתיים לבסוף כמו אדום רובי כהה.</li>
		<li>מניחים את כדורי ה-PLA תבנית מפלדת לתהליך ההיתוך ומחממים אותם בטמפרטורה של 190 מעלות במשך 10 דקות אחרי ההליך הקשה: שים אותם תחת לחץ של MPa 2.2 עבור 1 דקות כחלק הכנת גיליון ה-PLA. הגיליון PLA יהיה מוכן לשימוש לאחר קירור במשך כ-3 שעות.</li>
		<li>לערבב נמרצות, להמיס 0.68 מ ג של הסדינים PLA ב 5 מ של כלורופורם בטמפרטורת החדר. מערבבים ה-PLA מומס עם 10 מ"ל של הפתרון AuNPs בעבר מוכן ומערבבים homogeneously זה בטמפרטורת החדר. תערובות הומוגנית אז יכול להיות denoted כמו ה-PLA-AuNPs, מאופיין באמצעות UV-Vis, XRD, TEM, ו- FESEM עם EDX.</li>
	</ol>
</li>
	<li>
הכנה ואפיון של פחמן המסך המודפס ששונה אלקטרודה הערה: SPCE השתמשו במחקר זה כוללת מערכת 3-אלקטרודה: אלקטרודה מונה אלקטרודה עבודה של פחמן, אלקטרודה הפניה Ag/AgCl.<ol>
<li>במהירות פיפטה 25 µL של פתרון הומוגני של ה-PLA-AuNPs על גבי SPCE ולאחר מכן אוויר יבש זה עבור 24 שעות לפני השימוש.</li>
		<li>Electrochemically לאפיין את האלקטרודות ששונה, SPCE/ה-PLA-AuNPs, בפרו אשלגני (K3[Fe(CN)6]3 -/4 -) כדי למדוד את שטח פעיל, ספקטרוסקופיה עכבה אלקטרוכימי, הדיר, הפארמצבטית, יציבות30.</li>
	</ol>
</li>
</ol>2. פיתוח ביוסנסור אלקטרוכימי DNA
<ol><li>
בדיקה הכנה הערה: הרצף של בדיקה ssDNA ו- DNA משלימים נבחרו בהתבסס על מידע של המרכז הארצי עבור מסד הנתונים ביוטכנולוגיה מידע (NCBI).<ol>
<li>לרכוש oligonucleotides סינתטי (20-מר ssDNA בדיקה, DNA משלימים 20-mer, 20-מר לא תואמים DNA ו 21-מר-משלימה דנ א) אבקת lyophilized ממעבדות מסחרי, בהתבסס על רצפי הבאים: thiolated ssDNA בדיקה: יונקות - / 5ThioMC6-D/CGGATTATGCAGAAGCACTG - 3′ DNA משלימים: יונקות - CAGTGCTTCTGCATAATCCG - 3′ DNA שאינם תואמים אחד-בסיס: יונקות - CAGTGCTTCTGC ṪTAATCCG - 3′ 3-בסיס DNA שאינם תואמים: יונקות - CAGTGCTTCT Ċ ṪṪTAATCCG - 3′ DNA שאינם משלימים: יונקות - CGCACAAGGCTCGACGGCTGA - 3′</li>
		<li>להכין מלאי פתרונות של כל oligonucleotides (100 מיקרומטר) באמצעות סטרילי טה פתרון (10 מ מ טריס-HCl, 1 מ"מ EDTA, pH 7.5), מחולק לחלקים אנליטית. לשמור את זה ב-4 ° C ולאחר מכן בצע את דילולים המתאים רק לפני השימוש.</li>
	</ol>
</li>
	<li>
אופטימיזציה של קיבעון של הכלאה הערה: SPCE שופרת PLA-AuNPs, מסומן בתור SPCE/ה-PLA-AuNPs, נעשה שימוש במחקר זה, שיטת הליהוק טיפה שימש כדי להפוך את ה-DNA הנייח הכלאה.<ol>
<li>ראשית, לשתק 25 µL של thiolated ssDNA בדיקה על ה-PLA/SPCE-AuNPs, ואז האוויר יבש זה עבור 24 שעות בטמפרטורת החדר, לאחר מכן זה להיות סוף סוף מסומן בתור SPCE/ה-PLA-AuNPs/ssDNA. לקבוע אופטימיזציה של התנאי הנייח באמצעות שלושה גורמים: הריכוז של ssDNA (החל 0.2 1.4 µM), זמן (החל מ-30 ועד 210 דקות), טמפרטורה (החל מ- 25 ועד 75 ° C).</li>
		<li>פיפטה 25 µL של ה-DNA משלימים על פני השטח של SPCE/ה-PLA-AuNPs/ssDNA כדי לבצע את האירוע הכלאה לאחר מכן זה יכול להיות סוף סוף מסומן בתור SPCE/ה-PLA-AuNPs/dsDNA. לקבוע אופטימיזציה של התנאי הכלאה באמצעות שני גורמים של זמן (החל מ-5 עד 30 דקות) וטמפרטורה (החל מ- 25 ועד 75 ° C).</li>
		<li>לטבול את קיבוע של אלקטרודות hybridized ב- 20 מיקרומטר MB עבור 30 דקות להסיר את ה-DNA הלא ספציפית הספוחה ו MB עודף על ידי כביסה עם 0.5 M ABS/20 מ מ NaCl (pH 4.5) ולאחר מכן שטיפה בעזרת יונים מים. מדד השיא הנוכחי של הפחתת MB DPV בטכניקה. לבצע את המדידה DPV באמצעות 0.1 M PBS (pH 7) המכיל אין מחוון.</li>
	</ol>
</li>
	<li>
אפיון החיישן DNA מפוברק
	<ol>
<li>לטבול את SPCE/ה-PLA-AuNPs ב- 20 מיקרומטר MB במשך 30 דקות, לשטוף עם 0.5 M ABS/20 מ מ NaCl (pH 4.5) ולאחר מכן לשטוף עם מים יונים לפני מדידה. בצע הליך דומה עבור כל האינטראקציות לרבות בדיקת DNA, DNA משלימים, DNA שאינם תואמים, דגימות די אן איי שאינם משלימים.</li>
		<li>למדוד ההפחתה אלקטרוכימי. הערה: מדדנו DPV באמצעות ממשק התוכנה של Autolab מיוצרים באופן מסחרי. המדידות DPV MB להפחתת אלקטרוכימי בנטילת פוטנציאלי ועד-V 0.5 0.25 V, בצעד פוטנציאלי של 0.005 V, אפנון משרעת של 0.05 V, ושיעור סריקה של 7.73 mVs-1 ב- PBS 0.1 M (pH 7), המכיל אין מחוון. סלקטיביות, רגישות, הפארמצבטית, יציבות החום של החיישן DNA מפוברק נחקרו בהמשך. התוצאות המדווחות הוצגו מדידות ערך רשע ב משכפל שלוש.</li>
	</ol>
</li>
</ol>3. אימות של החיישן מפוברק הדנ א באמצעות דוגמאות אמיתיות
<ol><li>הכנה של זני חיידקים
	<ol>
<li>בחר דגימות בקטריאליות בהתבסס על שלהם זיהום משמעותי של מאכלי ים31,32 . הערה: נ' parahaemolyticus וגם הפניה זנים 8 אחרים זני חיידקים (קמפילובקטר jejuni ליסטריה, סלמונלה typhimurium, סלמונלה דלקת מעיים, דלקת ריאות קלבסיאלה, Escherichia coli O157:H7, Bacillus קובו, ויבריו alginolyticus) של והקאה נפוצות הפתוגן הועסקו לשם אימות ביוסנסור אלקטרוכימי DNA במחקר זה.</li>
		<li>התנהגות שגרתית תת תרבות של זני חיידקים על אגר בהתאמה שלהם כל שבועיים כדי לשמור על יכולת הקיום שלהם, עיין טבלה 1 עבור תנאים תרבות.</li>
		<li>לשמור על שימור לטווח ארוך זני חיידקים ב שלהם broths גדל בהתאמה המכיל 20% (v/v) גליצרול ב-80 מעלות צלזיוס כפי גליצרול מגן על חיידקים על ידי מניעת היווצרות של גבישי קרח אשר יכולים לגרום להם נזק במהלך תהליך ההקפאה. בשלב הבא, לחסן לולאה של תא החיידק משומרת תרבות במניות גליצרול לתוך broths בהתאמה. דגירה את broths על פי טמפרטורה וזמן צמיחה בהתאמה שלהם בעת הצורך להחיות את החיידקים.</li>
		<li>לקבוע את הכמות נ' parahaemolyticus תאים באמצעות טכניקה של צלחת כפולה33, תקן ושיטה ידועה לספירת מיקרואורגניזמים נגזר סדרת דילולים.<ol>
<li>תרבות נ' parahaemolyticus ב Trypticase סויה מרק (TSB + 3% NaCl) ב 37 מעלות צלזיוס במצב חזק 140-סל ד. לאחר מכן, להעביר 1 מ"ל של התרבות תאי חיידקים לתוך 9 מיליליטר TSB + 3% NaCl להשיג גורם לדילול 10-1 .</li>
		</ol>
</li>
		<li>חזור על שלב זה תשע פעמים כדי לקבל סדרה מלאה של גורם לדילול-10 עד 10. הבא, התפשטה 0.1 מ"ל של כל גורם לדילול (החל מ 10-1 כדי 10-10) על צלחת אגר סלקטיבי של ויבריו המושבה ספירה, בהתאמה. דגירה הלוחות מודגרות ב 37 מעלות צלזיוס במשך 24 שעות ביממה.</li>
		<li>השתמש מונה המושבה כדי לספור מושבות בודדות, ואז חזרה-לחשב (ספירת הסכום CFU/pipetted x פקטור דילול) כדי לקבל יחידת המושבה יוצרי לאדם צפיפות מיליליטר (מ"ל CFU-1). שואבים את הריכוז של המושבה יוצרי יחידות (CFUs) ב השעיות התא חיידקים מן העלילה כיול של mL CFU-1 נגד ספיגת.</li>
	</ol></li>
	<li>הכנת וזמינותו PCR
	<ol>
<li>תמצית הדנ א בעקבות ששונה מבושלים הליך פירוק34. עם הנץ החמה בקטריאלי בודדים זן במדיה אגר, לחסן אותו בתקשורת מרק, ואחריו המקננת זה על מצבו היחסי צמיחה, סל"ד 140 רועד תנאי.</li>
		<li>Pipette תרבות 1 מ"ל של מרק לתוך שפופרת צנטרפוגה מיקרו. Centrifuge זה-4830-g ו- 4 מעלות צלזיוס במשך 1 דקה להשיג כדורי. השתמש בערך 500 µL מאגר טה סטרילי re-השעיה עם בגדר. להחזיק ההשעיה וכתוצאה מכך במשך 10 דקות על 98 ± 2 ° C בתוך גוש חימום, מיד תרגעו ב-18 מעלות צלזיוס למשך 10 דקות lyse התאים ולשחרר את ה-DNA.</li>
		<li>Centrifuge ה-DNA גנומי-4830-g ו- 4 מעלות צלזיוס למשך 3 דקות לקבל השעיה ברורה ולשמור את תגובת שיקוע ב-20 ° C לשימוש נוסף. השתמש מדידה biophotometer עם הקליטה UV באורך-גל של 260 ננומטר (כמו חומצות גרעין קליטת אורך הגל של אור) וגם ב אורך גל של 280 ננומטר (כמו החלבונים סופגי אורך הגל של אור) כדי לקבוע את הריכוז ואת טוהר חילוץ דנ א גנומי ולאחר מכן לזהות את כל זני באמצעות מבחני הביוכימי רגיל35 ואימות אותם על ידי מטוסי אף-16 rRNA ג'ין רצף36. לבסוף, denature ה-DNA גנומי ב 92 מעלות צלזיוס למשך 2 דקות, לצנן את זה במהירות במי קרח לפני היישום החיישן.</li>
		<li>נוסף לאשר הנוכחות נ' parahaemolyticus באמצעות PCR למקד את הגן toxR. ביצוע הליך זה thermocycler באמצעות זוג פריימר (5'-GTCTTCTGACGCAATCGTTG-3' ו 5'-ATACGAGTGGTTGCTGTCATG-3'). למטב את הגברה PCR נפח התגובה הכולל של 25 µL המורכב במים סטריליים (15.5 µL), מאגר (5 µL), פריימר (1 µL, 10 מיקרומטר), dNTP מיקס (1 µL), תבנית ה-DNA (2 µL) ו- Taq DNA פולימראז (0.2 µL, 10 x).</li>
		<li>מערבבים את רכיבי היטב, לארגן הגברה PCR של הרצף היעד ב- thermocycler מתוכנת מחזורים של הגברה. במחקר שלנו, בכל מחזור כללה שלושה שלבים תגובות כלומר., דנטורציה הראשונית (94 ° C, 3 דקות) ואחריו 30 מחזורי דנטורציה (94 ° C, 1 דקות), חישול (63 ° C, כ- 1.5 דקות) והסיומת (72 ° C, כ- 1.5 דקות), ואחריו הסיומת הסופי (72 ° C, 7 דקות).</li>
		<li>לקבוע את המוצרים מוגבר, הגדלים שלהם באמצעות אלקטרופורזה על 1.5% agarose ג'ל. ללכוד את התמונות ג'ל עם מערכת ג'ל המיוצר מסחרית-תיעוד.</li>
	</ol></li>
	<li>הכנת דוגמאות פשוט נתעלף
	<ol>
<li>להשיג דגימות טריות. הערה: הלב שלנו טריים (Anadara granosa) היו המתקבל בשוק רטוב Serdang, Selangor, והביא במהירות את המעבדה בתיבת קרח קריר יותר לניתוח. לחלק את הדגימות 2 קבוצות, כלומר קבוצת טיפול ללא טיפול, בהנחה כי הלב נבצרו בצורה אחידה מתחילת הקציר עד הצבתם לתוך אחסון הקרה.</li>
		<li>מראש לטפל הלב בקבוצה שטופלו על ידי אחסונם ב-20 מעלות צלזיוס במשך 24 שעות, ואחריו חשיפה לאור UV ב 20 מעלות צלזיוס במשך 4 שעות לפני מיצוי הדנ א. הערה: את טמפרטורת הקיפאון ואת חשיפה UV המשמש מבוקרת קבוצה או לפחות מגביל את צבירת באופן טבעי נ' parahaemolyticus ב הלב. אל תחיל משטר פסטור גבוה יותר של 70 מעלות צלזיוס כמו מטרת התנאי מבוקרת במחקר זה היא לחקות את המצב בפועל של הלב טריים. בינתיים, לנתח דגימות ישירות מן הקבוצה מטופל ללא כל טיפול קדם ברגע שהם מגיעים במעבדה.</li>
		<li>תת-תרבות זן של נ' parahaemolyticus בקרת האוויר 17802 ב TSB (3% NaCl). לקבוע את רמת התאים קיימא ב inoculum באמצעות ציפוי של דילולים המתאים של TSB (3% NaCl) ב- CA על מנת לקבל את inoculum של 104 CFU מ ל-1 של נ' parahaemolyticus. לשטוף כל אחרים במים מזוקקים, לקרצף אותה ללא לכלוך לפני באמצעות מלקחיים סטרילי זרימה שכבתית בארון כדי להסיר הרקמות הקליפה.</li>
		<li>Homogenize בערך 10 גרם של דגימות רקמה אחרים עם מהמגן ב- 90 מיליליטר TSB סטרילי (3% NaCl) 60 s. הוסף כמות ידועה של נ' parahaemolyticus 9 מ ל ציר מדגם הומוגני על הדגימות מחודדים. השתמש הדגימות unspiked כפקד שלילי. מעריכים את ספירת תאים של נ' parahaemolyticus עלה על הדגימות אחרים על ידי ציפוי 0.1 מ"ל של הדגימות על CA, לאחר מכן, pipetting 1 מ"ל של דגימות לתוך צינור microcentrifuge עבור ה-DNA לטעום החילוץ, כדי לשמש את ביוסנסור ואת וזמינותו PCR.</li>
		<li>תמצית ה-DNA גנומי של נ' parahaemolyticus בין דגימות מחודדים, unspiked בעקבות ששונה מבושלים הליך פירוק36. לבסוף, לקבוע את ריכוז הדנ א ואת טוהר באמצעות מדידה photometer ביו עם הקליטה UV באורך-גל של 260 ננומטר (כמו חומצות גרעין קליטת אורך הגל של אור) וגם ב אורך גל של 280 ננומטר (כמו החלבונים סופגי אורך הגל של אור).</li>
	</ol></li>
</ol>

המחברים אין לחשוף.

השלבים הקריטיים במסגרת להתפתחותן של סוג זה של ביוסנסור אלקטרוכימי הם מבחר אלמנטים המתאימים זיהוי ביולוגי המתמר (חומצת גרעין או DNA כאן); הגישה כימיים עבור בניית השכבה חישה של המתמר; התמרה חושית חומר; אופטימיזציה של ה-DNA הנייח, הכלאה; ואימות החיישן מפותחת באמצעות דוגמאות אמיתיות.
<p class="jove_cont...

נושא מרכזי של הדיון הציבורי ומדעיים בשנים האחרונות, הרעלת מזון היא מזוהה בעיקר עם שלושה סוכנים: מיקרואורגניזמים1, כימיקלים2וטפילים3. מזון מזוהם עלול לגרום לתוצאות בריאות רציניות בבני אדם, במיוחד אצל קבוצת סיכון גבוה יותר של אלה עם מערכות החיסון חלשה, נשים בהריון, קשישים, תינוקות, ילדים צעירים4. עם יותר ממיליון מקרים של שלשול אקוטי המתרחשים מדי שנה אצל ילדים מתחת לגיל 5 שנים ב אפריקה, אסיה, אמריקה הלטינית, הרעלת מזון היא מחלה הגלובלית הגדולות5,6 , הקימה ארגון הבריאות העולמי מיקרואורגניזמים כמו התורם החשוב ביותר7. ויבריו parahaemolyticus בולטת בין זנים מידבק ביותר המוכר. בדרך כלל שנמצאו לאורך החוף, estuarine, ימית סביבות8, הוא חיידק גראם שליליים, אשר הופכת לפעילה בסביבות מלח גבוהה, והוא גורם להרעלתו אנושי רציני כאשר אוכלים מבושל כראוי, כושלת או raw ימית מוצרים9. בנוסף, קיימים מצבים רפואיים אצל אנשים מסוימים להפוך אותם נוטה פצע הזיהום זיהום, ספטיסמיה או האוזן הנובעים נ' parahaemolyticus10. הגורמים התקפה אלימה של נ' parahaemolyticus hemolysins נחלקים לשני סוגים אשר לתרום בפתוגנזה המחלה: thermostable המוליזין ישירה (TDH) מקודד על ידי הגנים tdh ולאחר הקשורות TDH המוליזין מקודד על ידי גנים trh11. הקריטריונים התקפה אלימה (גנים tdh ו- trh) של parahaemolyticus (פ') נמצאים בעיקר דגימות קליניות, במקום דגימות סביבתיים.
(פ') parahaemolyticus יש את היכולת לשרוד תחת מגוון רחב של תנאים, להגיב במהירות על שינויים סביבתיים12. מנגנון התפשטות שלה מסלים את פוטנציאל הסיכון שלו ככל שלה רעילות במקביל תא המוני13. חמור מכך, שינוי האקלים מספקת חיידקים אלה בתנאים בשפע כדי להאיץ את הצמיחה שלהם האוכלוסייה תא14. בשל תדירותו גבוהה, נ' parahaemolyticus צריך להיות במעקב לאורך שרשרת אספקת המזון, במיוחד בתחום הסחר והייצור של פירות ים מאז מוצרים אלה הם שבו הם נמצאים בכמויות עצומות15,16 ברחבי העולם. כיום החיידקים מזוהות ואת וזמינותו מבודדים באמצעות מגוון של שיטות כולל בדיקות ביוכימיות, העשרה, מדיה סלקטיבי17, מקושרים-אנזים immunomagnetic sorbent (אליסה)18, הדופק-שדה בג'ל (PFGE) 19התלכדות לייטקס בדיקות, בדיקות פולימראז תגובת שרשרת (PCR)20. שיטות אלו דורשות בדרך כלל מוסמכים, מכשירים מתוחכמים וטכניקות מפרך אשר אינם מספקים מידע אודות זיהום באופן מיידי. זה קשות מגביל את הסבירות מיד גילוי זיהום מזיקים ויישומים באתר. כלי איתור מהיר עדיין מהווה אתגר יוצא מן הכלל.
Biosensing מתגלה כאופציה מבטיחה איתור והקאה פתוגנים משום שהיא מציעה לחיסכון בזמן, חסכונית, מעשית, בזמן אמת וניתוח בשיטת21,22,23,24 . עם זאת, אמנם היו תוצאות חיוביות רבות של analyte בזיהוי כל פתרון באמצעות ביולוגיים ודוגמאות מחודדים, יש עדיין חוסר מחקר חלה על דוגמאות אמיתיות או תערובות מימית או תמציות אורגניות25. לאחרונה, ביולוגיים אלקטרוכימי באמצעות זיהוי ישיר ו/או עקיף חומצה deoxyribonucleic (DNA) קיבלו תשומת לב מוגברת בקרב מדענים, עקב שלהם זיהוי ספציפי של המטרה משלימים באמצעות אירוע הכלאה26 , 27 , 28 , 29. גישות ייחודיות אלה יציבים יותר בהשוואה ביולוגיים מבוססי אנזים, ובכך מציע טכנולוגיה מבטיח המזעור, מסחור. המטרה של המחקר דיווח הנה כדי לבנות כלי מהיר יכול לזהות נ' parahaemolyticus עם סלקטיביות גבוהה, רגישות, מעשיות, המבוססת על רצף ה-DNA יחודיות במהלך הכלאה. זיהוי אסטרטגיות כוללות השילוב של חומצה מיוצב חלקיקי זהב (PLA-AuNPs) polylactic30 ואלקטרודות פחמן המסך המודפס (SPCEs) בנוכחות מחוון הכלאה, מתילן כחול (MB). הפוטנציאל של הבונה הזיהוי מפותחת הוא חקר נוסף באמצעות חיידקים דגימות די אן איי פשוט נתעלף lysate ורענן.

<table><tbody><tr><td>Acetic acid</td><td>Merck</td><td>100056</td><td></td></tr><tr><td>Chloroform</td><td>Merck</td><td>102445</td><td></td></tr><tr><td>Diaminoethane tetraacetic acid</td><td>Promega</td><td>E5134</td><td></td></tr><tr><td>Dibasic sodium phosphate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>S9763</td><td></td></tr><tr><td>Disodium hydrogen phosphate</td><td>Sigma-Aldrich</td><td>255793</td><td></td></tr><tr><td>Ethanol&amp;nbsp;</td><td>Sigma-Aldrich</td><td>16368</td><td></td></tr><tr><td>Gold (III) chloride trihydrate</td><td>Sigma-Aldrich</td><td>520918</td><td></td></tr><tr><td>Hydrochloric acid</td><td>Merck</td><td>100317</td><td></td></tr><tr><td>Methylene blue</td><td>Sigma-Aldrich</td><td>M44907</td><td></td></tr><tr><td>Monobasic sodium phosphate, monohydrate</td><td>Sigma-Aldrich</td><td>S3522</td><td></td></tr><tr><td>Phosphate-buffered saline</td><td>Sigma-Aldrich</td><td>P5119</td><td></td></tr><tr><td>Poly(lactic acid) resin, commercial grade 4042D</td><td>NatureWorks</td><td>4042D</td><td></td></tr><tr><td>Potassium chloride</td><td>R&amp;amp;M Chemicals</td><td>59435</td><td></td></tr><tr><td>Potassium dihydrogen phosphate</td><td>Sigma-Aldrich</td><td>P9791</td><td></td></tr><tr><td>Potassium hexacyanoferrate III</td><td>R&amp;amp;M Chemicals</td><td>208019</td><td></td></tr><tr><td>Sodium acetate anhydrous salt</td><td>Sigma-Aldrich</td><td>S2889</td><td></td></tr><tr><td>Sodium chloride</td><td>Sigma-Aldrich</td><td>S9888</td><td></td></tr><tr><td>Trisodium citrate</td><td>Sigma-Aldrich</td><td>S1804</td><td></td></tr><tr><td>Tris(hydroxymethyl) aminomethane</td><td>Fisher Scientific</td><td>T395-100</td><td></td></tr><tr><td>Tris-Base</td><td>Fisher Scientific</td><td>BP152-500</td><td></td></tr><tr><td>2X PCR Master Mix with Dual-Dye</td><td>Norgen Biotek</td><td>28240</td><td></td></tr><tr><td>Agarose gel</td><td>Merck</td><td>101236</td><td></td></tr><tr><td>Bolton Agar</td><td>Merck</td><td>100079</td><td></td></tr><tr><td>Bolton Broth</td><td>Merck</td><td>100079</td><td></td></tr><tr><td>CHROMagar Vibrio</td><td>CHROMagar</td><td>VB910</td><td></td></tr><tr><td>dNTPs</td><td>Promega</td><td>U1511</td><td></td></tr><tr><td>Nuclease-free water</td><td>Thermo Scientific</td><td>R0581</td><td></td></tr><tr><td>Eosin methylene blue agar&amp;nbsp;</td><td>Merck</td><td>101347</td><td></td></tr><tr><td>GelRed</td><td>Biotium</td><td>41001</td><td></td></tr><tr><td>Glycerol</td><td>Merck</td><td>104092</td><td></td></tr><tr><td>Go Taq Buffer</td><td>Promega</td><td>M7911</td><td></td></tr><tr><td>Loading dye 100 bp DNA ladder</td><td>Promega</td><td>G2101</td><td></td></tr><tr><td>Loading dye 1kb DNA ladder</td><td>Promega</td><td>G5711</td><td></td></tr><tr><td>Magnesium chloride</td><td>Promega</td><td>91176</td><td></td></tr><tr><td>Mannitol egg yolk polymyxin agar</td><td>Merck</td><td>105267</td><td></td></tr><tr><td>McConkey Agar</td><td>Merck</td><td>105465</td><td></td></tr><tr><td>Nutrient Broth</td><td>Merck</td><td>105443</td><td></td></tr><tr><td>Taq polymerase</td><td>Merck</td><td>71003</td><td></td></tr><tr><td>Trypticase Soy Broth</td><td>Merck</td><td>105459</td><td></td></tr><tr><td>Trypticase Soy Agar</td><td>Merck</td><td>105458</td><td></td></tr></tbody></table>

development of an electrochemical dna biosensor to detect a foodborne pathogen

ויבריו parahaemolyticus (V. parahaemolyticus) הוא. חיידק נפוץ והקאה אשר תורם חלק ניכר של בעיות בריאות הציבור ברחבי העולם, באופן משמעותי משפיע על הקצב של האדם תמותה ותחלואה קרדיווסקולרית. שיטות קונבנציונליות איתור נ' parahaemolyticus כגון שיטות מבוססות-תרבות, מבחני אימונולוגי מולקולרי המבוסס על שיטות דורשים טיפול מסובך לדוגמה, זמן רב, מייגע, ויקרות. לאחרונה, ביולוגיים הוכיחו להיות שיטה לזיהוי מבטיח ומקיף עם היתרונות של זיהוי מהיר, משתלמת, ו המעשיות. מחקר זה מתמקד בפיתוח שיטה מהירה של גילוי נ' parahaemolyticus סלקטיביות גבוהה ורגישות שימוש בעקרונות ה-DNA הכלאה. עבודה, אפיון polylactic מסונתז מיוצב חומצה חלקיקי זהב (PLA-AuNPs) הושג באמצעות קרני רנטגן (XRD), ספקטרוסקופיה הגלוי אולטרה סגול (UV-Vis), הילוכים מיקרוסקופ אלקטרונים (TEM), פליטת שדה מיקרוסקופ אלקטרונים סריקה (FESEM), וולטמטריה ציקלית (CV). אנחנו גם ביצעו בדיקה נוספת של יציבות, רגישות הפארמצבטית של ה-PLA-AuNPs. . מצאנו ה-PLA AuNPs נוצר מבנה הקול של חלקיקים מיוצב בתמיסה המימית. גם הבחנו כי שיפרה הרגישות כתוצאה ערך התנגדות (Rct) קטן יותר תשלום העברה, גידול של פעיל שטח (2ס מ 0.41). פיתוח ביוסנסור הדנ א שלנו מבוססת על שינוי של אלקטרודות פחמן המסך המודפס (SPCE) עם ה-PLA-AuNPs ושימוש מתילן כחול (MB) כאינדיקטור חמצון-חיזור. אנחנו לאומדן האירועים הנייח והכלאה הדופק דיפרנציאלי voltammetry (DPV). מצאנו כי משלימים, שאינם משלימים, oligonucleotides לא תואמת במיוחד היו מכובדים על ידי החיישן מפוברק. זה הראה גם זיהוי רגיש בצורה אמינה במחקרים אשיג נגד פתוגנים שונים שמקורם במזון, הזיהוי של נ' parahaemolyticus בתוך הלב טריים.

היווצרות AuNPs התגלה באמצעות בשינוי הצבע של התמיסה המימית עם סודיום ציטרט הנוכחי. זה גרם את הצבע לשנות מן צהוב בהיר אדום רובי עמוק. הדור של ה-PLA-AuNPs אושרה של ספקטרום UV-vis (איור 1) שבו הצמיחה של הפסגה תהודה (SPR) משטח פלזמון נמצאה כ 540 nm. היווצרות ואת קיומו של ה-PLA-AuNPs ה...

Watch this Scientific Journal Video about Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen at JoVE.com

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

התפתחות ביוסנסור אלקטרוכימי דנ א כדי לזהות חיידק והקאה

פרוטוקול לפיתוח ביוסנסור אלקטרוכימי DNA הכוללת של אלקטרודות פחמן חלקיקי-לאחרונה, המסך המודפס מיוצב חומצה, זהב polylactic לזהות ויבריו parahaemolyticus מוצג.

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, ...

development-an-electrochemical-dna-biosensor-to-detect-foodborne

Research

JoVE Journal

Bioengineering

13.0K Views.  Universiti Putra Malaysia. פרוטוקול לפיתוח ביוסנסור אלקטרוכימי DNA הכוללת של אלקטרודות פחמן חלקיקי-לאחרונה, המסך המודפס מיוצב חומצה, זהב polylactic לזהות ויבריו parahaemolyticus מוצג.

Video: Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

המצאה של אלקטרוכימי-DNA Biosensors לגילוי Reagentless של חומצות, חלבונים ומולקולות קטנות גרעין

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

Bacterial Detection & Identification Using Electrochemical Sensors

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

גילוי חיידקים וזיהוי באמצעות חיישנים אלקטרוכימיים

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

זיהוי של חיידקים באמצעות DNAzymes Fluorogenic

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

Immunology and Infection

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a model microorganism. The biosensor relies on direct binding of the target bacteria cells onto its surface, while no pretreatment (e.g.&#160;by cell lysis) of the studied sample is required. A mesoporous Si thin film is used as the optical transducer element of the biosensor. Under white light illumination, the porous layer displays well-resolved Fabry-P&#233;rot fringe patterns in its reflectivity spectrum. Applying a fast Fourier transform (FFT) to reflectivity data results in a single peak. Changes in the intensity of the FFT peak are monitored. Thus, target bacteria capture onto the biosensor surface, through antibody-antigen interactions, induces measurable changes in the intensity of the FFT peaks, allowing for a &#39;real time&#39; observation of bacteria attachment.
The mesoporous Si film, fabricated by an electrochemical anodization process, is conjugated with monoclonal antibodies, specific to the target bacteria. The immobilization, immunoactivity and specificity of the antibodies are confirmed by fluorescent labeling experiments. Once the biosensor is exposed to the target bacteria, the cells are directly captured onto the antibody-modified porous Si surface. These specific capturing events result in intensity changes in the thin-film optical interference spectrum of the biosensor. We demonstrate that these biosensors can detect relatively low bacteria concentrations (detection limit of 104 cells/ml) in less than an hour.

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor for rapid bacteria detection is introduced. The biosensor is based on a nanostructured porous Si, which is designed to directly capture the target bacteria cells onto its surface. We use monoclonal antibodies, immobilized onto the porous transducer, as the capture probes. Our studies demonstrate the applicability of these biosensors for the detection of low bacterial concentrations within minutes with no prior sample processing (such as cell lysis).

זיהוי אופטי של<em&gt; א coli</em&gt; חיידקים על ידי Biosensors הסיליקון Mesoporous

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a ...

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration of pre-processing steps. Utilizing these devices towards the analysis of DNA hybridization events is important because it offers a technology for real time assessment of biomarkers at the point-of-care for various diseases. However, when the device footprint decreases the dominance of various physical phenomena increases. These phenomena influence the fabrication precision and operation reliability of the device. Therefore, there is a great need to accurately fabricate and operate these devices in a reproducible manner in order to improve the overall performance. Here, we describe the protocols and the methods used for the fabrication and the operation of a microfluidic-based electrochemical biochip for accurate analysis of DNA hybridization events. The biochip is composed of two parts: a microfluidic chip with three parallel micro-channels made of polydimethylsiloxane (PDMS), and a 3 x 3 arrayed electrochemical micro-chip. The DNA hybridization events are detected using electrochemical impedance spectroscopy (EIS) analysis. The EIS analysis enables monitoring variations of the properties of the electrochemical system that are dominant at these length scales. With the ability to monitor changes of both charge transfer and diffusional resistance with the biosensor, we demonstrate the selectivity to complementary ssDNA targets, a calculated detection limit of 3.8 nM, and a 13% cross-reactivity with other non-complementary ssDNA following 20 min&#160;of incubation. This methodology can improve the performance of miniaturized devices by elucidating on the behavior of diffusion at the micro-scale regime and by enabling the study of DNA hybridization events.

We present a microfluidic-based electrochemical biochip for DNA hybridization detection. Following ssDNA probe functionalization, the specificity, sensitivity, and detection limit are studied with complementary and non-complementary ssDNA targets. Results illustrate the influence of the DNA hybridization events on the electrochemical system, with a detection limit of 3.8 nM.

Biochip אלקטרוכימי מבוסס Microfluidic לניתוח הכלאה DNA ללא תווית

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

ELIME (Enzyme Linked Immuno Magnetic Electrochemical) Method for Mycotoxin Detection

Immunoassays are a valid alternative to the more expensive and time consuming quantitative HPLC or GC1, 2 methods for the screening detection of hazardous mycotoxins in food commodities. In this protocol we show how to fabricate and interrogate an electrochemical competitive Enzyme linked immunomagnetic assay based on the use of magnetic beads as solid support for the immunochemical chain3 and screen printed electrodes as sensing platform.
Our method aims to determine the total amount of HT-2 and T-2 toxins, mycotoxins belonging to the trichothecenes family and of great concern for human health4. The use of an antibody clone with a cross reactivity of 100% towards HT-2 and T-2 allows to simultaneously detect both toxins with similar sensitivity5.
The first step of our assay is the coating step where we immobilize HT2-KLH conjugate toxin on the surface of magnetic beads. After a blocking step, necessary to avoid non-specific absorptions, the addition of a monoclonal antibody allows the competition between immobilized HT-2 and free HT-2 or T-2 present in the sample or dissolved in a standard solution.
At the end of the competition step, the amount of monoclonal antibody linked to the immobilized HT-2 will be inversely proportional to the amount of toxin in the sample solution.
A secondary antibody labeled with alkaline phosphatase (AP) is used to reveal the binding between the specific antibody and the immobilized HT-2. The final measurement step is performed by dropping an aliquot of magnetic bead suspension, corresponding to a specific sample/standard solution, on the surface of a screen-printed working electrode; magnetic beads are immobilized and concentrated by means of a magnet placed precisely under the screen-printed electrode. After two minutes of incubation between magnetic beads and a substrate for AP, the enzymatic product is detected by Differential Pulse Voltammetry (DPV) using a portable instrument (PalmSens) also able to initiate automatically eight measurements within an interval of few seconds.

ELIME Enzyme Linked Immuno Magnetic Electrochemical Method for Mycotoxin Detection

A protocol to detect trichothecenes (mycotoxins of concern for human health) using a newly developed screening method based on a competitive immunochemical method and a final electrochemical detection is demonstrated.

ELIME (אנזימים מקושרים חיסונית מגנטי אלקטרוכימי) שיטת איתור Mycotoxin

Immunoassays are a valid alternative to the more expensive and time consuming quantitative HPLC or GC1, 2 methods for the screening detection of hazardous ...

Biology

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and water-screening methods used currently. While conventional bacterial detection methods, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assays (ELISA) can specifically detect pathogenic contaminants, they require extensive sample preparation and lengthy waiting periods. In addition, these practices demand sophisticated laboratory instruments and settings, and must be executed by trained professionals. Herein, a protocol is proposed for a simpler diagnostic technique that features the unique combination of magnetic and fluorescent parameters in a nanoparticle-based platform. The proposed multiparametric magneto-fluorescent nanosensors (MFnS) can detect E. coli O157:H7 contamination with as little as 1 colony-forming unit present in solution within less than 1 h. Furthermore, the ability of MFnS to remain highly functional in complex media such as milk and lake water has been verified. Additional specificity assays were also used to demonstrate the ability of MFnS to only detect the specific target bacteria, even in the presence of similar bacterial species. The pairing of magnetic and fluorescent modalities allows for the detection and quantification of pathogen contamination in a wide range of concentrations, exhibiting its high performance in both early- and late-stage contamination detection. The effectiveness, affordability, and portability of the MFnS make them an ideal candidate for point-of-care screening for bacterial contaminants in a wide range of settings, from aquatic reservoirs to commercially packaged foods.

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

The overall goal of this protocol is to synthesize functional nanosensors for the portable, cost-effective, and rapid detection of specifically targeted pathogenic bacteria through a combination of magnetic relaxation and fluorescence emission modalities.

והקאה הפתוגן הקרנה באמצעות מגנטו-פלורסנט ננו-חיישן: איתור מהיר של e. Coli O157:H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and ...

Electrowetting-based Digital Microfluidics Platform for Automated Enzyme-linked Immunosorbent Assay

Electrowetting is the effect by which the contact angle of a droplet exposed to a surface charge is modified. Electrowetting-on-dielectric (EWOD) exploits the dielectric properties of thin insulator films to enhance the charge density and hence boost the electrowetting effect. The presence of charges results in an electrically induced spreading of the droplet which permits purposeful manipulation across a hydrophobic surface. Here, we demonstrate EWOD-based protocol for sample processing and detection of four categories of antigens, using an automated surface actuation platform, via two variations of an Enzyme-Linked Immunosorbent Assay (ELISA) methods. The ELISA is performed on magnetic beads with immobilized primary antibodies which can be selected to target a specific antigen. An antibody conjugated to HRP binds to the antigen and is mixed with H2O2/Luminol for quantification of the captured pathogens. Assay completion times of between 6 and 10 min were achieved, whilst minuscule volumes of reagents were utilized.

Electrowetting-based digital microfluidic is a technique that utilizes a voltage-driven change in the apparent contact angle of a microliter-volume droplet to facilitate its manipulation. Combining this with functionalized magnetic beads enables the integration of multiple laboratory unit operations for sample preparation and identification of pathogens using Enzyme-linked Immunosorbent Assay (ELISA).

האלקטרו-מערכות מבוססות-פלטפורמת מיקרופלואידיקה דיגיטלית עבור מערכת חיסונית אוטומטית מקושרת אנזימים

Electrowetting is the effect by which the contact angle of a droplet exposed to a surface charge is modified. Electrowetting-on-dielectric (EWOD) exploits ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

פלטפורמה תפוקה גבוהה להקרנה של סלמונלה spp /שיגלה spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...

Colorimetric Detection of Bacteria Using Litmus Test

There are increasing demands for simple but still effective methods that can be used to detect specific pathogens for point-of-care or field applications. Such methods need to be user-friendly and produce reliable results that can be easily interpreted by both specialists and non-professionals. The litmus test for pH is simple, quick, and effective as it reports the pH of a test sample via a simple color change. We have developed an approach to take advantage of the litmus test for bacterial detection. The method exploits a bacterium-specific RNA-cleaving DNAzyme to achieve two functions: recognizing a bacterium of interest and providing a mechanism to control the activity of urease. Through the use of magnetic beads immobilized with a DNAzyme-urease conjugate, the presence of bacteria in a test sample is relayed to the release of urease from beads to solution. The released urease is transferred to a test solution to hydrolyze urea into ammonia, resulting in an increase of pH that can be visualized using the classic litmus test.

We describe a protocol for colorimetric detection of E. coli using a modified litmus test that takes advantage of an RNA-cleaving DNAzyme, urease, and magnetic beads.

איתור מדד-צבע של חיידקים באמצעות מבחן לקמוס

There are increasing demands for simple but still effective methods that can be used to detect specific pathogens for point-of-care or field applications. ...