עבודה זו נערכה באמצעות המתקנים של ביו רפואית הפקולטה להנדסה באוניברסיטה הבינלאומית בפלורידה.

1. התקנת Electrospinning אספן <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> חותכים את רדיד האלומיניום לתוך חתיכה מלבנית. </li><li style=";text-align:right;direction:rtl"> מקפלים את החתיכה מלבנית לרצועה מלבנית, ולצרף אותו בניצב ללוחית מתכת שטוחה עם קלטת (איור 1). הערה: גודלו של שטיח הסיבים תלוי באורך וברוחב הרצועה. כך, ניתן להתאים את ממדי הרצועה לפי צורך. </li></ol> 2. פולימרית פתרון הכנה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מערבבים גליצרול וחומצת dodecanedioic (DDA) ב1:1 טוחנת בכוס ב-C ° 120 ל100 שעה להשיג פולימר PGD. </li><li style=";text-align:right;direction:rtl"> ממיסים פולי (אתילן אוקסיד) (PEO) וג&#39;לטין באתנול 65% עם יחס משקל של 1.5:3:95.5 בצינור 15 מיליליטר, להדק את הכובע ולחמם את התערובת בתנור ב 60 מעלות צלזיוס במשך שעה 1 עם ערבוב עד שזה הופך פתרון הומוגני (פתרון בסל). </li><li style=";text-align:right;direction:rtl"> לelectrospinning, לערבב פולימר PGD והפתרון הבסיסי ב04:06 יחס משקל. שים לב: יש ריכוז PGD דוהשפעה גרם בקוטר סיבים. 30% -50% PGD אחוזים מקובל לייצר סיבים ארוכים יותר מ -5 ס&quot;מ עם קוטר סיבים מוגבר. </li><li style=";text-align:right;direction:rtl"> הוספת ריבופלאבין 0.1% לפתרון פולימריים ומערבבים היטב. </li></ol> 3. Electrospinning <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להאכיל את פתרון פולימרים לתוך מזרק סטנדרטי 5 מיליליטר עם 18 G הקהה מחט פלדה אל חלד. </li><li style=";text-align:right;direction:rtl"> הכנס את המזרק לתוך משאבת מזרק. </li><li style=";text-align:right;direction:rtl"> צרף את ההובלה מקורקעת של מקור כוח במתח גבוה ללוחית המתכת ולהוביל מטען החשמלי החיובי למחט. </li><li style=";text-align:right;direction:rtl"> התאם את המרחק בין המחט ורצועת רדיד האלומיניום ל15 סנטימטר. </li><li style=";text-align:right;direction:rtl"> מקם את משאבת המזרק בזווית של כ -15 ° ביחס לאופק כדי למנוע הצטברות של הסיבים בחלק הקדמי של הרצועה. </li><li style=";text-align:right;direction:rtl"> הפעל את משאבת המזרק ולהתאים את קצב הזרימה של המשאבה ל0.6 מיליליטר / שעה. </li><li style=";text-align:right;direction:rtl"> הפעל את מקור החשמל במתח הגבוה ולהגדיר את מתח ההפעלה ל14.6 KV. </li></ol> 4.עיבוד סיבים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לאחר האיסוף יושלם, לחשוף את מחצלת סיבים לאור UV במשך 60 דקות לקישור צולב. </li><li style=";text-align:right;direction:rtl"> העבר את מחצלת הסיבים מרצועת רדיד האלומיניום לצלחת פטרי 100 מ&quot;מ, ותחשוף אותה לאור UV לעוד 20 דקות לעיקור. </li><li style=";text-align:right;direction:rtl"> בארון בטיחות ביולוגי, לחתוך את מחצלת סיבים לחתיכות עגולות באותו הגודל עם להב כירורגים ומניחים את החתיכות לתוך צלחת 24 גם. </li><li style=";text-align:right;direction:rtl"> לטיפול מראש זריעת תאים, לטבול את דגימות סיבים ב 1 מיליליטר של בופר פוספט (PBS) ולדגור על 37 מעלות צלזיוס למשך לילה. </li><li style=";text-align:right;direction:rtl"> ביום שלאחר מכן, לשאוב PBS בזהירות, להוסיף 1 מיליליטר של מדיום התמיינות (DMEM/F12, N2, וFGF2) (ראה מתכון בטבלת חומרים) זה טוב ולדגור על 37 מעלות צלזיוס במשך 3 שעות. </li><li style=";text-align:right;direction:rtl"> בינוני בידול לשאוב בזהירות, להוסיף 0.2 מיליליטר של matrigel לכל דגימת סיבים ולדגור על 37 מעלות צלזיוס במשך 30 דקות. שים לב: גם Laminin יכול לשמש לציפוי סיבים. הוספת 0.2 מיליליטר של 20 laminin מיקרוגרם / מיליליטרלסיבים ו דגירה בטמפרטורת חדר למשך 3 שעות. </li><li style=";text-align:right;direction:rtl"> מוציא בזהירות matrigel העודף מכל טוב. לשטוף עם 2 מיליליטר של מדיום בידול פעם אחת. שים לב: דגימות הסיבים מוכנות לתרבית תאים. </li></ol> 5. נייד זריעה בסיבים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוסף 1 מיליליטר של Accutase לצלחת תרבית תאי MES ודגירה של 10 דקות ב 37 ° C. </li><li style=";text-align:right;direction:rtl"> לאחר 10 דקות, תאי MES מנותקים ממנת התרבות. הוסף 4 מיליליטר של מדיום בידול לצלחת. לאסוף את תאי MES צף לתוך צינור 15 מיליליטר ותאי פיפטה מעלה ומטה כדי לשבור מושבות (כ 15x). </li><li style=";text-align:right;direction:rtl"> צנטריפוגה ב XG 400 למשך 5 דקות ותאים מחדש להשעות ב4 מיליליטר של מדיום בידול. </li><li style=";text-align:right;direction:rtl"> ספירת התאים באמצעות hemocytometer. העבר 200 μl של ההשעיה התא לתוך צינור 15 מ&quot;ל ולדלל אותו 10x עם מדיום בידול. העבר 15 μl של ההשעיה התא המדולל לתא על hemocytometer עם כיסוי להחליק במקום. רוזןהתאים בכיכר מרכז 1 מ&quot;מ וארבעת ריבועי פינת hemocytometer מתחת למיקרוסקופ. הערה: נייד לכל מיליליטר = הספירה לכל מ&quot;ר בממוצע x גורם לדילול x 10 4 </li><li style=";text-align:right;direction:rtl"> מקום כ 5 x 10 4 תאי MES על כל טוב. לאט לאט שחרר את ההשעיה התא על אמצע דגימות סיבים, במקום מחליק לצד השני של הבאר, כדי למנוע מפתרון הניקוז מחוץ למזרן הסיבים. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מיליליטר של מדיום בידול היטב כל אחד, ולשמור את הצלחת באינקובטור ב 37 ° C ו 5% CO 2 כדי לאפשר מצורף תאים, גדילה והתמיינות. </li><li style=";text-align:right;direction:rtl"> לשאוב את המדיום הישן מכל טוב ולהחליף עם 1 מיליליטר של מדיום בידול טרי בכל יום אחר. </li></ol> 6. כדאיויות תא <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לשאוב את המדיום הישן מכל טוב. </li><li style=";text-align:right;direction:rtl"> מערבבים 1/10 ה נפח של מגיב הקרינה Resazurin עם מדיום התרבות ולהוסיף 1 מיליליטר היטב כל אחד. </li><li style=";text-align:right;direction:rtl"> Incubאכלתי ב37 ° C ו 5% CO 2 למשך 4 שעות, מוגן מפני אור ישיר. </li><li style=";text-align:right;direction:rtl"> לאחר 4 שעות, להעביר 100 μl 3x של המגיב מכל טוב לצלחת 96 היטב, ולאחר מכן הדגימות מוכנות להימדד על ספקטרופוטומטר הקרינה באמצעות הגדרות מסננים 560EX nm/590EM. </li></ol> 7. Real Time PCR <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לאחר 14 ימים של תרבות, להוסיף למאגר תמוגה לדגימות ולבודד RNA המוחלט מהתאים בדגימות הסיבים. </li><li style=";text-align:right;direction:rtl"> השתמש 4 μl של רנ&quot;א הכל לסנתז cDNA ב20 קשקשי תגובת μl ידי שעתוק לאחור. </li><li style=";text-align:right;direction:rtl"> מכין את תערובת PCR תגובה בכל צינור אופטי: 10 μl מיקס מאסטר (2x), 0.2 צבע μl, 8 המים Nuclease ללא μl, cDNA μl 1, ופריימר μl 1 (צבעי יסוד המשמשים במחקר זה מופיעים בטבלה 1). </li><li style=";text-align:right;direction:rtl"> להגדיר את תכנית ה-PCR: א. דקות 95 C ° 2:20, מחזור ב 1. דקות 95 ° C 3 שניות → 60 ° C 1, 40 מחזור ג. 95 ° C שניות 15, ד המחזור 1. 60 C ° 1דקות, דואר מחזור 1. 95 ° C שניות 15, מחזור 1. בחר את שיטת C T השוואתית כדי לקבוע את רמות ביטוי הגנים יחסית. </li><li style=";text-align:right;direction:rtl"> לאחר PCR הוא סיים, לנתח את התוצאות בזמן אמת PCR עם תוכנת StepOne ולייצא את התוצאות ל-Excel. </li></ol>

<ol>
	<li>Migneco, F., Huang, Y. -. C., Birla, R. K., Hollister, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly+(glycerol-dodecanoate),+a+biodegradable+polyester+for+medical+devices+and+tissue+engineering+scaffolds.">Poly (glycerol-dodecanoate), a biodegradable polyester for medical devices and tissue engineering scaffolds.</a> Biomaterials. 30, 6479-6484 (2009).</li><li>Reneker, D. H., Yarin, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrospinning+jets+and+polymer+nanofibers.">Electrospinning jets and polymer nanofibers.</a> Polymer. 49, 2387-2425 (2008).</li><li>Wang, Y., Ameer, G. A., Sheppard, B. J., Langer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+tough+biodegradable+elastomer.">A tough biodegradable elastomer.</a> Nature biotechnology. 20, 602-606 (2002).</li><li>Panunzi, S., De Gaetano, A., Mingrone, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Approximate+linear+confidence+and+curvature+of+a+kinetic+model+of+dodecanedioic+acid+in+humans.">Approximate linear confidence and curvature of a kinetic model of dodecanedioic acid in humans.</a> American Journal of Physiology-Endocrinology And Metabolism. 289, (2005).</li><li>Park, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Apparatus+for+preparing+electrospun+nanofibers:+designing+an+electrospinning+process+for+nanofiber+fabrication.">Apparatus for preparing electrospun nanofibers: designing an electrospinning process for nanofiber fabrication.</a> Polymer Internationa l. 56, 1361-1366 (2007).</li><li>Barnes, C. P., Sell, S. A., Boland, E. D., Simpson, D. G., Bowlin, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanofiber+technology:+designing+the+next+generation+of+tissue+engineering+scaffolds.">Nanofiber technology: designing the next generation of tissue engineering scaffolds.</a> Advanced drug delivery reviews. 59, 1413-1433 (2007).</li><li>Li, W. -. J., Mauck, R. L., Tuan, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrospun+nanofibrous+scaffolds:+production,+characterization,+and+applications+for+tissue+engineering+and+drug+delivery.">Electrospun nanofibrous scaffolds: production, characterization, and applications for tissue engineering and drug delivery.</a> Journal of Biomedical Nanotechnology. 1, 259-275 (2005).</li><li>Pham, Q. P., Sharma, U., Mikos, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrospinning+of+polymeric+nanofibers+for+tissue+engineering+applications:+a+review.">Electrospinning of polymeric nanofibers for tissue engineering applications: a review.</a> Tissue engineering. 12, 1197-1211 (2006).</li><li>Lim, S. H., Mao, H. -. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrospun+scaffolds+for+stem+cell+engineering.">Electrospun scaffolds for stem cell engineering.</a> Advanced drug delivery reviews. 61, 1084-1096 (2009).</li><li>Lowery, J. L., Datta, N., Rutledge, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+fiber+diameter,+pore+size+and+seeding+method+on+growth+of+human+dermal+fibroblasts+in+electrospun+poly+(epsilon-caprolactone)+fibrous+mats.">Effect of fiber diameter, pore size and seeding method on growth of human dermal fibroblasts in electrospun poly (epsilon-caprolactone) fibrous mats.</a> Biomaterials. 31, 491-504 (2010).</li><li>Tillman, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+in+vivo+stability+of+electrospun+polycaprolactone-collagen+scaffolds+in+vascular+reconstruction.">The in vivo stability of electrospun polycaprolactone-collagen scaffolds in vascular reconstruction.</a> Biomaterials. 30, 583-588 (2009).</li><li>Ju, Y. M., Choi, J. S., Atala, A., Yoo, J. J., Lee, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bilayered+scaffold+for+engineering+cellularized+blood+vessels.">Bilayered scaffold for engineering cellularized blood vessels.</a> Biomaterials. 31, 4313-4321 (2010).</li><li>McCullen, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+collagen+polymerization+of+layered+cell-seeded+electrospun+scaffolds+for+bone+tissue+engineering+applications.">In situ collagen polymerization of layered cell-seeded electrospun scaffolds for bone tissue engineering applications.</a> Tissue Engineering Part C: Methods. 16, 1095-1105 (2010).</li></ol>

אין ניגודי האינטרסים הכריזו.

המגבלות של אספנים פשוטים או המורכבות של מסתובב אספנים שכיום משמשים לelectrospinning להגדיל את המגבלה של קבלת האורך הרצוי וגודל של שטיח סיבים עבור יישומים מסוימים. בנוסף, העברת סיבים מאספן הקרקע למנת התרבות או מצעים אחרים היא אתגר 5. בדו&quot;ח זה, אספן חדש תוכנן, עשוי בפשטות על ידי הצמדת רצועת רדיד אלומיניום לאספן מקורקע, היה יכול לקבל את מחצלות בגודל סיבים גדולות ל10 סנטימטר על 20 סנטימטר בכל פעם. איורים 1 ו -2 ממחישים את ההגדרה סכמטית נועדה בודה עד 10 ס&quot;מ סיבי electrospun ארוכים עם רוחב מזרן מבוקר. בהשפעת השדה אלקטרוסטטי בין קצה המחט והאספן, סיבי electrospun נמתחו על פני השטח שבין רצועת רדיד האלומיניום והאספן המעוגן בצורת מחצלת סיבים חלקה, שניתן להעביר בקלות למשנהו שלubstrate. סיבי electrospun לספק מבנים סיביים נקבוביים המאפשרים לתאים כדי לגשר ולצרף לסיבים מרובים בסביבה באמת תלת ממדים. מחצלות הסיבים שנוצרו במחקר זה הן גדולים מספיק כדי להפוך אותם למועמדים אידיאליים עבור מגוון רחב של יישומים, כגון ריפוי פצעים והתחדשות עצבית. יכולים להיות מותאמים בקטרים ​​סיבים על ידי שליטה במספר משתנה בהליך electrospinning. משתנה אלו כוללים ריכוז הפולימר, סדר גודל של מתח מיושם, שיעור לידת הפולימר, מרחק בין המחט לאספן, וכו &#39;6-8. במחקר זה, פתרונות הבדיקה, שחוברו עם PGD 50% וBS 50%, PGD 40% וBS 60%, PGD 30% וBS 70%, וPGD 20% וBS 80%, בהתאמה, היו מוכנים ל מה שהופך את סיבי electrospun. הפיגומים סיביים נבחנו באמצעות SEM כדי לקבוע את הקטרים ​​ומורפולוגיות של הסיבים (איור 3). כצפוי, עמ &#39;ריכוזים גבוהים PGDroduced קטרים ​​גדולים יותר של סיבי electrospun. כמו כן, זה הוא קריטי כדי להתאים את אורך הרצועה בהתאם לריכוזי PGD השונים. ריכוז PGD נמוך יותר דורש אורך רצועה קצר יותר כדי להבטיח היווצרות סיבים. מאמצים רבים נעשו כדי לחקור את ההתאמה הביולוגית של הפיגומים סיביים electrospun באמצעות הלימוד של תא התרבות 9-13. תמונות confocal מיקרוסקופ באיור 4 מראה כי התאים המצורפים עם אותות ניאון הירוקים חזקים הצביעו על הישרדות התא בסיבי PGD. בנוסף, הגדלת צפיפות התאים מיום 3 ליום 6 גם הציעה התפשטות התאים בסיבי PGD. בדיקת כדאיות תא באיור 5 אישרה גם את התוצאה הזאת. ביטוי גנים של MAP2 סימני תא העצבי וDCX הוכיח כי תאי MES היו מסוגלים להתמיין לתאים עצביים על הפיגומים (איור 6). לסיכום, פיגומים סיביים PGD יכולים לתמוך adhesio תאn והפצה, ובכך להציג את הפוטנציאל עבור יישומי הנדסת רקמה עצביים. הנה כמה קווים מנחים לפתרון בעיות כלליים: אם הסיבים שיוצאים מהמחט הוא רציפים, לחמם את הפתרון פולימריים שוב ולערבב אותו היטב או אם הסיבים הוא דבק רצועת רדיד האלומיניום ללא משיכה ללוחית המתכת, לצמצם את הרצועה אורך או להגדיל את ריכוז PGD. לפעמים גושי פולימר גדולים יוצרים בקצה המחט, כבה את מקור החשמל במתח הגבוה, לנגב אותו עם מגבת נייר, ולהפחית את שיעור המסירה של המשאבה. בנוסף, לפעמים מצטברים סיבים בקצה העליון של רצועת רדיד האלומיניום נסה לכוון את הזווית של משאבת המזרק.

Electrospinning הוא אחת מהשיטות העיבוד היעילות לייצר פיגומי גודל סיבי מיקרו לננומטר. העיקרון הבסיסי של electrospinning כרוך קונוס טיילור של פתרון שמתקיים בפתח של מחט על ידי הפעלת מתח גבוה בין קצה המחט ואספן מקורקע. כאשר הדחייה אלקטרוסטטית בפתרון מתגברת מתח הפנים, סילון נוזל טעון הוא נפלט אל מחוץ לקצה המחט, עובר דרך האוויר עם אידוי ממס, ולבסוף הופקד על האספן מקורקע. משאבת המזרק מספקת זרימה רציפה של פתרון המתעוררים מspinneret ועותקים ובכך מרובים של סיבי electrospun יכולים להיות מפוברק בתוך תקופה קצרה של זמן. במהלך עוזב spinneret להגיע לאספן, הסילון הטעון יעבור מתיחה ומצליף על פי מספר הפרמטרים הכוללים את מתח הצמיגות ופני שטח של הפתרון פולימריים, electrostatiכוח ג בפתרון, ואת האינטראקציה של השדה החשמלי החיצוני, וכו &#39;2. בתהליך electrospinning, אספן משמש כמצע מוליך שבו יכולים להיות מופקדים סיבי מיקרו לננומטר. במחקר זה, סוג חדש של אספן סיבים נועד להשיג מחצלות סיבים עם הגודל הרצוי (רוחב x אורך). באופן מסורתי, רדיד אלומיניום משמש כאספן אבל קשה להעביר את הסיבים מהמשטח השטוח למצע אחר. הקושי של קצירת מחצלת סיבים ללא פגע מאספן מסורתי היה בעיקר בשל העובדה שסיבי electrospun לצרף מאוד על פני השטח של האספן. לכן, אנחנו שונה האספן על ידי קיפול פיסת נייר אלומיניום לרצועה מלבנית והצמדתו בניצב ללוחית מתכת שטוחה. סיבי electrospun נמתחים על פני השטח שבין הקצה של הרצועה ולוחית המתכת, שניתן להעביר בקלות לsubstrat אחרתדואר. ריבית בפולימרי אלסטומרי תרמית crosslinked הוא גדל במהירות בגלל עבודתם החלוצית של קבוצתו של רוברט לנגר, שהציג את פולי (sebacate גליצרול) (PGS), פוליאסטר שהוא מקביל לגומי מגופר, ב2002 3. דומה לPGS, יש לנו פיתחנו בהצלחה פולי (גליצרול-dodecanoate) (PGD) על ידי עיבוי תרמית של גליצרול וחומצת dodecanedioic והפגינו קניין זיכרון צורה הייחודי שלה 1. שלא כמו פולי נוקשה חומרים סינטטיים (בוטיראט הידרוקסיל) או פולי (L-lactide) (moduli של יאנג של 250 מגפ&quot;ס ו660 מגפ&quot;ס, בהתאמה), PGD מפגין רכוש אלסטומרי כמו גומי, עם מודול יאנג של 1.08 מגפ&quot;ס כאשר הטמפרטורה היא מעל 37 ° C, שהוא משחק קרוב לעצבים באתר ההיקפיים (0.45 MPA). בנוסף, PGD הוא מתכלה וזמן הפירוק ניתן מכויל על ידי שינוי היחס של גליצרול וחומצת dodecanedioic. חומצת Dodecanedioic היא תת עשר פחמןעמדה עם שתי קבוצות קרבוקסיליות מסוף, HOOC (CH 2) 10 COOH. חומצות dicarboxylic אפילו ממוספרות כמו חומצת sebacic וחומצת dodecanedioic יכולות להיות מפורקות לאצטיל-CoA והזן את חומצת tricarboxylic (TCA) מחזור / (חומצת לימון). מוצר חילוף החומרים של חומצות dicarboxylic, succinyl-CoA, הוא מבשר וביניים של מחזור 4 TCA gluconeogenetic. לפיכך, חלק מהמחקרים הראו כי הם יכולים להיות מנוצלים כמצע אלטרנטיבי דלק לתזונת Enteral וparenteral, במיוחד במצבים פתולוגיים. בנוסף, PGD מפגין זיכרון צורה ייחודית משום שטמפרטורת מעבר זכוכית שלה היא 31 במעלות צלזיוס, ובכך הוא מציג תכונות מכאניות שונות בטמפרטורת חדר ובטמפרטורת גוף. לסיכום, PGD הוא מתכלה, ביולוגית, המציג תכונות אלסטיות ייחודיות עם תכונות מכאניות דומות לרקמות עצבים; ולכן, זה חומר מתאים ליישומי הנדסת רקמת עצב. בפרוטוקול זה, electrospunסיבים ארוכים המשתרעים על שטח מרבץ גדול היו מפוברק באמצעות האספן החדש תוכנן מPGD. פיגומי הסיבים יכולים לתמוך בצמיחה בתאי גזע pluripotent עכבר ובידול.

<table border="0" cellpadding="0" cellspacing="0" width="729">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Glycerol</td>
			<td style="width:175px;">Sigma-Aldrich</td>
			<td style="width:119px;">G7757</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Dodecanedioic acid</td>
			<td style="width:175px;">Sigma-Aldrich</td>
			<td style="width:119px;">D1009</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Gelatin</td>
			<td style="width:175px;">Sigma-Aldrich</td>
			<td style="width:119px;">D1890</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Poly (ehtylene oxide) (PEO)</td>
			<td style="width:175px;">Sigma-Aldrich</td>
			<td style="width:119px;">182028</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Riboflavin</td>
			<td style="width:175px;">Sigma-Aldrich</td>
			<td style="width:119px;">132350250</td>
			<td style="width:167px;">0.10%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Mouse embryonic stem cells</td>
			<td style="width:175px;">GlobalStem</td>
			<td style="width:119px;">GSC-5002</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Matrigel</td>
			<td style="width:175px;">Becton Dickinson</td>
			<td style="width:119px;">356234</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">DMEM/F12</td>
			<td style="width:175px;">Thermo Scientific</td>
			<td style="width:119px;">SH30272.02</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">N2 supplement&#160;</td>
			<td style="width:175px;">Invitrogen</td>
			<td style="width:119px;">17502048</td>
			<td style="width:167px;">1%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">FGF2</td>
			<td style="width:175px;">Stemgent</td>
			<td style="width:119px;">03-0002</td>
			<td style="width:167px;">10ng/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Accutase</td>
			<td style="width:175px;">Invitrogen</td>
			<td style="width:119px;">A11105-01</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Phosphate buffered saline (PBS)</td>
			<td style="width:175px;">Invitrogen</td>
			<td style="width:119px;">10010-031&#160;</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Resazurin fluorescence dye&#160;</td>
			<td style="width:175px;">Sigma-Aldrich</td>
			<td style="width:119px;">62758-13-8&#160;</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">SV Total RNA Isolation System</td>
			<td style="width:175px;">Promega</td>
			<td style="width:119px;">Z3100</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">GoScript Reverse Transcription System</td>
			<td style="width:175px;">Promega</td>
			<td style="width:119px;">A5000</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">GoTaq&#129; qPCR Master Mix</td>
			<td style="width:175px;">Promega</td>
			<td style="width:119px;">A6001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Syringe pump&#160;</td>
			<td style="width:175px;">Fisher scientific</td>
			<td style="width:119px;">14-831-200</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:268px;">High voltage power source&#160;</td>
			<td style="width:175px;">Spellman High Voltage Electronics Corporation</td>
			<td style="width:119px;"></td>
			<td style="width:167px;">SL30</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">UV light</td>
			<td style="width:175px;">Philips</td>
			<td style="width:119px;">308643</td>
			<td style="width:167px;">15W/G15T8</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Synergy HT Multi-Mode Microplate Reader</td>
			<td style="width:175px;">BioTek</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Perkin Elmer GeneAmp PCR System 9600</td>
			<td style="width:175px;">Perkin Elmer</td>
			<td style="width:119px;">8488</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">StepOne Real-time PCR System</td>
			<td style="width:175px;">Applied Biosystems</td>
			<td style="width:119px;">4376357</td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

electrospun fibrous scaffolds of poly(glycerol-dodecanedioate) for engineering neural tissues from mouse embryonic stem cells

עבור יישומי הנדסת רקמות, הכנת פיגומים מתכלים ביולוגית היא המשימה הרצויה אך המאתגרת ביותר. בין שיטות ייצור השונות, electrospinning הוא אחד האטרקטיבי ביותר, בשל הפשטות והרבגוניות שלו. בנוסף, nanofibers electrospun לחקות את הגודל של מטריצה ​​תאית הטבעית הבטחת תמיכה נוספת להישרדות תא וצמיחה. מחקר זה הראה את הכדאיות של הייצור של סיבים ארוכים המשתרעים על הפקדת שטח גדול יותר לפולימר מתכלה ביולוגית חדשני בשם פולי (גליצרול-dodecanoate) (PGD) 1 באמצעות אספן חדש תוכנן עבור electrospinning. PGD ​​מפגין תכונות אלסטיות ייחודיות עם תכונות מכאניות דומות לרקמות עצבים, ולכן הוא מתאים ליישומי הנדסת רקמות עצביים. הסינתזה והגדרת ייצור להכנת חומרי פיגומים סיביים הייתה פשוט, לשעתקו מאוד, ולא יקרים. בbiocompatibilityבדיקות, תאים שמקורם בתאי גזע עובריים של עכברים יכולים לדבוק ולגדול על סיבי PGD electrospun. לסיכום, פרוטוקול זה סיפק שיטת ייצור תכליתית להכנת סיבי electrospun PGD כדי לתמוך בצמיחה של תאי שושלת תאי גזע העובריים של עכברים נגזרו עצביים.

המרכיבים העיקריים של electrospinning מוצגים באיור 1. מחצלת גודל סיבים גדולה הייתה בדרך כלל שהושגה באמצעות הרצועה המצורפת בניצב רדיד האלומיניום ולוחית מתכת שטוחה. איור 2 מציג את עיצוב האספן ומחצלת electrospinning סיבים. הרוחב והאורך יכולים להיות מותאם ליישומים שונים. אורכו של הסיב עשוי פולימר עם PGD ותערובת פתרון בסיסי הוא עד 10 סנטימטר. המורפולוגיה של סיבי electrospun מוצגת באיור 3. בקטרים ​​של סיבים עשויים מ40% ריכוז PGD הם בטווח מיקרומטר. תמונות מיקרוסקופיה confocal של תאים מובחנים שמקורם בתאים בתרבית למשך 3 ו 6 ימים בסיבים MES מתוארות באיור 4. אותות הניאון הירוקים באו מביטוי יתר של חלבון פלואורסצנטי ירוק (GFP) בתאים. התוצאה של מגיב הקרינה Resazurin באיור 5 הראתה כי תאי MES לגדולn על ציפוי סיבי PGD עם matrigel וlaminin היו כדאיות תא מקבילות והיה לי התפשטות גבוהה יחסית בהשוואה לקבוצה ללא ציפוי. ביטוי גנים של סמני pluripotency ותאים עצביים היה לכמת ידי PCR בזמן אמת (איור 6). רוב התאים בתרבית MES על סיבים הביעו Oct4 סמני pluripotency, Nanog וSox2 בעוד המיעוט של תאים ביטא בתאי הגזע העצביים מסמן Pax6 וNestin. אחרי תרבות 2 שבועות, MES גדל על סיבים הראה רמות מוגברות ביטוי של סימני תא עצביים כגון MAP2 וDCX, כמו גם Oligo1 סמן oligodendrocyte וGFAP סמן astrocyte. <img alt="איור 1" fo:content-width="5in" src="/files/ftp_upload/51587/51587fig1highres.jpg" width="500" /> איור 1. Electrospinning להגדיר. הפתרון פולימריים הוא נפלט ממחט קהה. טענת מקור חשמל במתח גבוה צלחת שטוחה מתכתnd רצועת רדיד אלומיניום שביניהן סיבי מטר מיקרו ל-Nano מופקד (כחולה). <img alt="איור 2" fo:content-width="4in" src="/files/ftp_upload/51587/51587fig2highres.jpg" width="400" /> איור 2. עיצוב אספן ומחצלת electrospun סיבים. הרוחב והאורך של מחצלת הסיבים ניתן לשנות בקלות על ידי התאמת הגודל של רצועת רדיד האלומיניום. אין גבול לרוחב מזרן, והסיבים הארוכים יכולים להיות ארוכים עד 10 סנטימטר. <img alt="איור 3" fo:content-width="5in" src="/files/ftp_upload/51587/51587fig3highres.jpg" width="500" /> איור 3. SEM תמונות של electrospun של PGD ופתרון בסיסי 04:06 (w / w). הקוטר הממוצע של הסיבים הוא סביב 2 מיקרומטר. כאשר ריכוז PGD מקטין ל30%, הקוטר הממוצע של הסיבים נופל לתוך טווח ננומטר. הלבןסרגל קנה מידה מייצג 10 מיקרומטר. <img alt="איור 4" fo:content-width="4in" src="/files/ftp_upload/51587/51587fig4highres.jpg" width="400" /> איור 4. תמונות מיקרוסקופיה confocal של תאי MES הבדיל על סיבים. התאים נושאים את ה-GFP תערוכת הקרינה ירוקה בהירה כאשר נחשף לאור בכחול לטווח אולטרה סגול. מספר הגדל של תאי ניאון ירוקים ביום 6 מציין כי פיגומי הסיבים יכולים לתמוך הידבקות התא ושגשוגם. סרגל קנה המידה הלבנה מייצג 100 מיקרומטר. (יום 3 ויום 6). <img alt="איור 5" fo:content-width="6in" src="/files/ftp_upload/51587/51587fig5highres.jpg" width="500" /> איור 5. כדאיות התא של תאי MES על סיבי PGD ציפוי עם Matrigel וlaminin בבית 1, 3, ו -5 ימים, כפי שנקבע על ידי fluore Resazurinמגיב scence. תאים בתרבית על הסיבים ללא ציפוי המשמשים כביקורת (p &lt;0.05). <img alt="איור 6" fo:content-width="6in" src="/files/ftp_upload/51587/51587fig6highres.jpg" width="500" /> איור 6. ניתוח qRT-PCR של ביטוי גנים בתאי MES הבדיל על סיבי PGD. תא הסמנים העצביים ניכרו לאחר 2 שבועות, הוכיחו כי תאי MES על הפיגומים יש הבדיל לתאים עצביים. <table border="0" cellpadding="0" cellspacing="0" width="261" style=";text-align:right;direction:rtl"><tbody><tr><td> mGAPDH-L </td><td> AACTTTGGCATTGTGGAAGG </td></tr><tr><td> mGAPDH-R </td><td> ACACATTGGGGGTAGGAACA </td></tr><tr><td> mOct4-L </td><td> CACGAGTGGAAAGCAACTCA </td></tr><tr><td> mOct4-R </td><td> AGATGGTGGTCTGGCTGAAC </td></tr><tr><td> mNanog-L </td><td> AAGTACCTCAGCCTCCAGCA </td></tr><tr><td> mNanog-R </td><td> GTGCTGAGCCCTTCTGAATC </td><html></tr><tr><td> mSox2-L </td><td> CACAGTTCAGCCCTGAGTGA </td></tr><tr><td> mSox2-R </td><td> AGGCCACAACAACAACAACA </td></tr><tr><td> mPax6-L </td><td> AACAACCTGCCTATGCAACC </td></tr><tr><td> mPax6-R </td><td> ACTTGGACGGGAACTGACAC </td></tr><tr><td> mNestin-L </td><td> CCAGAGCTGGACTGGAACTC </td></tr><tr><td> mNestin-R </td><td> ACCTGCCTCTTTTGGTTCCT </td></tr><tr><td> mMAP2-L </td><td> CTTATGGGAATGTGGGATGG </td></tr><tr><td> mMAP2-R </td><td> AAAAAGTGGGCCTTGGAACT </td></tr><tr><td> mDCX-L </td><td> ATGCAGTTGTCCCTCCATTC </td></tr><tr><td> mDCX-R </td><td> ATGCCACCAAGTTGTCATCA </td></tr><tr><td> mOligo1-L </td><td> CTTGCTCTCTCCAGCCAAAC </td></tr><tr><td> mOligo1-R </td><td> GCGAGCCTGAAAAACAGAAC </td></tr><tr><td> mGFAP-L </td><td> CACGAACGAGTCCCTAGAGC </td></tr><tr><td> mGFAP-R </td><td> ATGGTGATGCGGTTTTCTTC </td></tr></tbody></table>ontent &quot;&gt; טבלת 1. רשימה של primers PCR.

Watch this Scientific Journal Video about Electrospun Fibrous Scaffolds of Polyglycerol-dodecanedioate for Engineering Neural Tissues From Mouse Embryonic Stem Cells at JoVE.com

Electrospun Fibrous Scaffolds of Polyglycerol-dodecanedioate for Engineering Neural Tissues From Mouse Embryonic Stem Cells

סינתזה וייצור של סיבי electrospun ארוכים המשתרעים על שטח גדול יותר הפקדה באמצעות אספן חדש תוכנן מפולימר מתכלה רומן בשם פולי (גליצרול-dodecanoate) (PGD) דווחה. הסיבים היו מסוגלים לתמוך בצמיחה של תאים שמקורם בתאי גזע pluripotent עכבר.

Electrospun סיבי פיגומים של פולי (גליצרול-dodecanedioate) להנדסה עצבית רקמות מתאי גזע עובריים בעכבר

For tissue engineering applications, the preparation of biodegradable and biocompatible scaffolds is the most desirable but challenging task. &#160;Among ...

electrospun-fibrous-scaffolds-poly-glycerol-dodecanedioate-for

Universidad San Sebastian

Research

JoVE Journal

Bioengineering

Electrospun Fibrous Scaffolds of Poly(glycerol-dodecanedioate) for Engineering Neural Tissues From Mouse Embryonic Stem Cells

10.8K Views.  Florida International University.  סינתזה וייצור של סיבי electrospun ארוכים המשתרעים על שטח גדול יותר הפקדה באמצעות אספן חדש תוכנן מפולימר מתכלה רומן בשם פולי (גליצרול-dodecanoate) (PGD) דווחה. הסיבים היו מסוגלים לתמוך בצמיחה של תאים שמקורם בתאי גזע pluripotent עכבר. 

Video: Electrospun Fibrous Scaffolds of Polyglycerol-dodecanedioate for Engineering Neural Tissues From Mouse Embryonic Stem Cells

Elastomeric PGS Scaffolds in Arterial Tissue Engineering

Cardiovascular disease is one of the leading cause of mortality in the US and especially, coronary artery disease increases with an aging population and increasing obesity1. Currently, bypass surgery using autologous vessels, allografts, and synthetic grafts are known as a commonly used for arterial substitutes2. However, these grafts have limited applications when an inner diameter of arteries is less than 6 mm due to low availability, thrombotic complications, compliance mismatch, and late intimal hyperplasia3,4. To overcome these limitations, tissue engineering has been successfully applied as a promising alternative to develop small-diameter arterial constructs that are nonthrombogenic, robust, and compliant. Several previous studies have developed small-diameter arterial constructs with tri-lamellar structure, excellent mechanical properties and burst pressure comparable to native arteries5,6. While high tensile strength and burst pressure by increasing collagen production from a rigid material or cell sheet scaffold, these constructs still had low elastin production and compliance, which is a major problem to cause graft failure after implantation. Considering these issues, we hypothesized that an elastometric biomaterial combined with mechanical conditioning would provide elasticity and conduct mechanical signals more efficiently to vascular cells, which increase extracellular matrix production and support cellular orientation.
The objective of this report is to introduce a fabrication technique of porous tubular scaffolds and a dynamic mechanical conditioning for applying them to arterial tissue engineering. We used a biodegradable elastomer, poly (glycerol sebacate) (PGS)7 for fabricating porous tubular scaffolds from the salt fusion method. Adult primary baboon smooth muscle cells (SMCs) were seeded on the lumen of scaffolds, which cultured in our designed pulsatile flow bioreactor for 3 weeks. PGS scaffolds had consistent thickness and randomly distributed macro- and micro-pores. Mechanical conditioning from pulsatile flow bioreactor supported SMC orientation and enhanced ECM production in scaffolds. These results suggest that elastomeric scaffolds and mechanical conditioning of bioreactor culture may be a promising method for arterial tissue engineering.

Elastomeric PGS scaffolds with vascular smooth muscle cells cultured in a pulsatile flow bioreactor may lead to promising small-diameter arterial constructs with native ECM production in a relatively short culture period.

PGS אלסטומרי פיגומים להנדסת רקמות העורקים

Cardiovascular disease is one of the leading cause of mortality in the US and especially, coronary artery disease increases with an aging population and ...

Preparation of 3D Fibrin Scaffolds for Stem Cell Culture Applications

Stem cells are found in naturally occurring 3D microenvironments in vivo, which are often referred to as the stem cell niche 1. Culturing stem cells inside of 3D biomaterial scaffolds provides a way to accurately mimic these microenvironments, providing an advantage over traditional 2D culture methods using polystyrene as well as a method for engineering replacement tissues 2. While 2D tissue culture polystrene has been used for the majority of cell culture experiments, 3D biomaterial scaffolds can more closely replicate the microenvironments found in vivo by enabling more accurate establishment of cell polarity in the environment and possessing biochemical and mechanical properties similar to soft tissue.3 A variety of naturally derived and synthetic biomaterial scaffolds have been investigated as 3D environments for supporting stem cell growth. While synthetic scaffolds can be synthesized to have a greater range of mechanical and chemical properties and often have greater reproducibility, natural biomaterials are often composed of proteins and polysaccharides found in the extracelluar matrix and as a result contain binding sites for cell adhesion and readily support cell culture. Fibrin scaffolds, produced by polymerizing the protein fibrinogen obtained from plasma, have been widely investigated for a variety of tissue engineering applications both in vitro and in vivo 4. Such scaffolds can be modified using a variety of methods to incorporate controlled release systems for delivering therapeutic factors 5. Previous work has shown that such scaffolds can be used to successfully culture embryonic stem cells and this scaffold-based culture system can be used to screen the effects of various growth factors on the differentiation of the stem cells seeded inside 6,7.
 This protocol details the process of polymerizing fibrin scaffolds from fibrinogen solutions using the enzymatic activity of thrombin. The process takes 2 days to complete, including an overnight dialysis step for the fibrinogen solution to remove citrates that inhibit polymerization. These detailed methods rely on fibrinogen concentrations determined to be optimal for embryonic and induced pluripotent stem cell culture. Other groups have further investigated fibrin scaffolds for a wide range of cell types and applications - demonstrating the versatility of this approach 8-12.

This work details the preparation of 3D fibrin scaffolds for culturing and differentiating plutipotent stem cells. Such scaffolds can be used to screen the effects of various biological compounds on stem cell behavior as well as modified to contain drug delivery systems.

הכנת 3D הפיברין פיגומים יישומים סלולריים גזע תרבות

Stem cells are found in naturally occurring 3D microenvironments in vivo, which are often referred to as the stem cell niche 1. Culturing stem cells ...

Postproduction Processing of Electrospun Fibres for Tissue Engineering

Electrospinning is a commonly used and versatile method to produce scaffolds (often biodegradable) for 3D tissue engineering.1, 2, 3 Many tissues in vivo undergo biaxial distension to varying extents such as skin, bladder, pelvic floor and even the hard palate as children grow. In producing scaffolds for these purposes there is a need to develop scaffolds of appropriate biomechanical properties (whether achieved without or with cells) and which are sterile for clinical use. The focus of this paper is not how to establish basic electrospinning parameters (as there is extensive literature on electrospinning) but on how to modify spun scaffolds post production to make them fit for tissue engineering purposes - here thickness, mechanical properties and sterilisation (required for clinical use) are considered and we also describe how cells can be cultured on scaffolds and subjected to biaxial strain to condition them for specific applications.
Electrospinning tends to produce thin sheets; as the electrospinning collector becomes coated with insulating fibres it becomes a poor conductor such that fibres no longer deposit on it. Hence we describe approaches to produce thicker structures by heat or vapour annealing increasing the strength of scaffolds but not necessarily the elasticity. Sequential spinning of scaffolds of different polymers to achieve complex scaffolds is also described. Sterilisation methodologies can adversely affect strength and elasticity of scaffolds. We compare three methods for their effects on the biomechanical properties on electrospun scaffolds of poly lactic-co-glycolic acid (PLGA).
Imaging of cells on scaffolds and assessment of production of extracellular matrix (ECM) proteins by cells on scaffolds is described. Culturing cells on scaffolds in vitro can improve scaffold strength and elasticity but the tissue engineering literature shows that cells often fail to produce appropriate ECM when cultured under static conditions. There are few commercial systems available that allow one to culture cells on scaffolds under dynamic conditioning regimes - one example is the Bose Electroforce 3100 which can be used to exert a conditioning programme on cells in scaffolds held using mechanical grips within a media filled chamber.4 An approach to a budget cell culture bioreactor for controlled distortion in 2 dimensions is described. We show that cells can be induced to produce elastin under these conditions. Finally assessment of the biomechanical properties of processed scaffolds cultured with or without cells is described.

Electrospun scaffolds can be processed post production for tissue engineering applications. Here we describe methods for spinning complex scaffolds (by consecutive spinning), for making thicker scaffolds (by multi-layering using heat or vapour annealing), for achieving sterility (aseptic production or sterilisation post production) and for achieving appropriate biomechanical properties.

Postproduction עיבוד Fibres Electrospun עבור הנדסת רקמות

Electrospinning is a commonly used and versatile method to produce  scaffolds (often biodegradable) for 3D tissue engineering.1, 2, 3 Many tissues in vivo ...

Engineering Skeletal Muscle Tissues from Murine Myoblast Progenitor Cells and Application of Electrical Stimulation

Engineered muscle tissues can be used for several different purposes, which include the production of tissues for use as a disease model in vitro, e.g. to study pressure ulcers, for regenerative medicine and as a meat alternative 1. The first reported 3D muscle constructs have been made many years ago and pioneers in the field are Vandenburgh and colleagues 2,3. Advances made in muscle tissue engineering are not only the result from the vast gain in knowledge of biochemical factors, stem cells and progenitor cells, but are in particular based on insights gained by researchers that physical factors play essential roles in the control of cell behavior and tissue development. State-of-the-art engineered muscle constructs currently consist of cell-populated hydrogel constructs. In our lab these generally consist of murine myoblast progenitor cells, isolated from murine hind limb muscles or a murine myoblast cell line C2C12, mixed with a mixture of collagen/Matrigel and plated between two anchoring points, mimicking the muscle ligaments. Other cells may be considered as well, e.g. alternative cell lines such as L6 rat myoblasts 4, neonatal muscle derived progenitor cells 5, cells derived from adult muscle tissues from other species such as human 6 or even induced pluripotent stem cells (iPS cells) 7. Cell contractility causes alignment of the cells along the long axis of the construct 8,9 and differentiation of the muscle progenitor cells after approximately one week of culture. Moreover, the application of electrical stimulation can enhance the process of differentiation to some extent 8. Because of its limited size (8 x 2 x 0.5 mm) the complete tissue can be analyzed using confocal microscopy to monitor e.g. viability, differentiation and cell alignment. Depending on the specific application the requirements for the engineered muscle tissue will vary; e.g. use for regenerative medicine requires the up scaling of tissue size and vascularization, while to serve as a meat alternative translation to other species is necessary.

Engineered muscle tissue has great potential in regenerative medicine, as disease model and also as an alternative source for meat. Here we describe the engineering of a muscle construct, in this case from mouse myoblast progenitor cells, and the stimulation by electrical pulses.

רקמות שריר שלד הנדסה מתאי Murine היצמדות מולידו ויישום של גירוי חשמלי

Engineered muscle tissues can be used for several different purposes, which include the production of tissues for use as a disease model in vitro, e.g. to ...

Electrospinning Growth Factor Releasing Microspheres into Fibrous Scaffolds

This procedure describes a method to fabricate a multifaceted substrate to direct nerve cell growth. This system incorporates mechanical, topographical, adhesive and chemical signals. Mechanical properties are controlled by the type of material used to fabricate the electrospun fibers. In this protocol we use 30% methacrylated Hyaluronic Acid (HA), which has a tensile modulus of ~500 Pa, to produce a soft fibrous scaffold. Electrospinning on to a rotating mandrel produces aligned fibers to create a topographical cue. Adhesion is achieved by coating the scaffold with fibronectin. The primary challenge addressed herein is providing a chemical signal throughout the depth of the scaffold for extended periods. This procedure describes fabricating&#160;poly(lactic-co-glycolic acid) (PLGA) microspheres that contain Nerve Growth Factor (NGF) and directly impregnating the scaffold with these microspheres during the electrospinning process. Due to the harsh production environment, including high sheer forces and electrical charges, protein viability is measured after production. The system provides protein release for over 60 days and has been shown to promote primary nerve cell growth.

This protocol combines electrospinning and microspheres to develop tissue engineered scaffolds to direct neurons. Nerve growth factor was encapsulated within PLGA microspheres and electrospun into Hyaluronic Acid (HA) fibrous scaffolds. The protein bioactivity was tested by seeding the scaffolds with primary chick Dorsal Root Ganglia and culturing for 4-6 days.

גורם הגדילה Electrospinning שחרור מיקרוסכמות לתוך סיביים פיגומים

This procedure describes a method to fabricate a multifaceted substrate to direct nerve cell growth.  This system incorporates mechanical, topographical, ...

Electrospun Nanofiber Scaffolds with Gradations in Fiber Organization

The goal of this protocol is to report a simple method for generating nanofiber scaffolds with gradations in fiber organization and test their possible applications in controlling cell morphology/orientation. Nanofiber organization is controlled with a new fabrication apparatus that enables the gradual decrease of fiber organization in a scaffold. Changing the alignment of fibers is achieved through decreasing deposition time of random electrospun fibers on a uniaxially aligned fiber mat. By covering the collector with a moving barrier/mask, along the same axis as fiber deposition, the organizational structure is easily controlled. For tissue engineering purposes, adipose-derived stem cells can be seeded to these scaffolds. Stem cells undergo morphological changes as a result of their position on the varied organizational structure, and can potentially differentiate into different cell types depending on their locations. Additionally, the graded organization of fibers enhances the biomimicry of nanofiber scaffolds so they more closely resemble the natural orientations of collagen nanofibers at tendon-to-bone insertion site compared to traditional scaffolds. Through nanoencapsulation, the gradated fibers also afford the possibility to construct chemical gradients in fiber scaffolds, and thereby further strengthen their potential applications in fast screening of cell-materials interaction and interfacial tissue regeneration. This technique enables the production of continuous gradient scaffolds, but it also can potentially produce fibers in discrete steps by controlling the movement of the moving barrier/mask in a discrete fashion.

Here, we present a protocol to fabricate electrospun nanofiber scaffolds with gradated organization of fibers and explore their applications in regulating cell morphology/orientation. Gradients with regard to physical and chemical properties of the nanofiber scaffolds offer a wide variety of applications in the biomedical field.

Electrospun nanofiber פיגומים עם דרגות בארגון סיבים

The goal of this protocol is to report a simple method for generating nanofiber scaffolds with gradations in fiber organization and test their possible ...

Generation of ESC-derived Mouse Airway Epithelial Cells Using Decellularized Lung Scaffolds

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and cell-matrix interactions. Due to this complexity, recapitulation of lung development in vitro to promote differentiation of stem cells to lung epithelial cells has been challenging. In this protocol, decellularized lung scaffolds are used to mimic the 3-dimensional environment of the lung and generate stem cell-derived airway epithelial cells. Mouse embryonic stem cell are first differentiated to the endoderm lineage using an embryoid body (EB) culture method with activin A. Endoderm cells are then seeded onto decellularized scaffolds and cultured at air-liquid interface for up to 21 days. This technique promotes differentiation of seeded cells to functional airway epithelial cells (ciliated cells, club cells, and basal cells) without additional growth factor supplementation. This culture setup is defined, serum-free, inexpensive, and reproducible. Although there is limited contamination from non-lung endoderm lineages in culture, this protocol only generates airway epithelial populations and does not give rise to alveolar epithelial cells. Airway epithelia generated with this protocol can be used to study cell-matrix interactions during lung organogenesis and for disease modeling or drug-discovery platforms of airway-related pathologies such as cystic fibrosis.

This protocol efficiently directs mouse embryonic stem cell-derived definitive endoderm to mature airway epithelial cells. This differentiation technique uses 3-dimensional decellularized lung scaffolds to direct lung lineage specification, in a defined, serum-free culture setting.

דור של אפיתל דרכי נשימת עכבר נגזרות ESC תאי שימוש decellularized פיגומי ריאות

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and ...

Microfluidic Bioprinting for Engineering Vascularized Tissues and Organoids

Engineering vascularized tissue constructs and organoids has been historically challenging. Here we describe a novel method based on microfluidic bioprinting to generate a scaffold with multilayer interlacing hydrogel microfibers. To achieve smooth bioprinting, a core-sheath microfluidic printhead containing a composite bioink formulation extruded from the core flow and the crosslinking solution carried by the sheath flow, was designed and fitted onto the bioprinter. By blending gelatin methacryloyl (GelMA) with alginate, a polysaccharide that undergoes instantaneous ionic crosslinking in the presence of select divalent ions, followed by a secondary photocrosslinking of the GelMA component to achieve permanent stabilization, a microfibrous scaffold could be obtained using this bioprinting strategy. Importantly, the endothelial cells encapsulated inside the bioprinted microfibers can form the lumen-like structures resembling the vasculature over the course of culture for 16 days. The endothelialized microfibrous scaffold may be further used as a vascular bed to construct a vascularized tissue through subsequent seeding of the secondary cell type into the interstitial space of the microfibers. Microfluidic bioprinting provides a generalized strategy in convenient engineering of vascularized tissues at high fidelity.

We provide a generalized protocol based on a microfluidic bioprinting strategy for engineering a microfibrous vascular bed, where a secondary cell type could be further seeded into the interstitial space of this microfibrous structure to generate vascularized tissues and organoids.

Vascularized Microfluidic Bioprinting עבור הנדסת רקמות, Organoids

Engineering vascularized tissue constructs and organoids has been historically challenging. Here we describe a novel method based on microfluidic ...

Two Methods for Decellularization of Plant Tissues for Tissue Engineering Applications

The autologous, synthetic, and animal-derived grafts currently used as scaffolds for tissue replacement have limitations due to low availability, poor biocompatibility, and cost. Plant tissues have favorable characteristics that make them uniquely suited for use as scaffolds, such as high surface area, excellent water transport and retention, interconnected porosity, preexisting vascular networks, and a wide range of mechanical properties. Two successful methods of plant decellularization for tissue engineering applications are described here. The first method is based on detergent baths to remove cellular matter, which is similar to previously established methods used to clear mammalian tissues. The second is a detergent-free method adapted from a protocol that isolates leaf vasculature and involves the use of a heated bleach and salt bath to clear the leaves and stems. Both methods yield scaffolds with comparable mechanical properties and low cellular metabolic impact, thus allowing the user to select the protocol which better suits their intended application.

Here we present, and contrast two protocols used to decellularize plant tissues: a detergent-based approach and a detergent-free approach. Both methods leave behind the extracellular matrix of the plant tissues used, which can then be utilized as scaffolds for tissue engineering applications.

שתי שיטות Decellularization של רקמות הצמח ליישומים הנדסת רקמות

The autologous, synthetic, and animal-derived grafts currently used as scaffolds for tissue replacement have limitations due to low availability, poor ...

Core/shell Printing Scaffolds For Tissue Engineering Of Tubular Structures

Three-dimensional (3D) printing of core/shell filaments allows direct fabrication of channel structures with a stable shell that is cross-linked at the interface with a liquid core. The latter is removed post-printing, leaving behind a hollow tube. Integrating an additive manufacturing technique (like the one described here with tailor-made [bio]inks, which structurally and biochemically mimic the native extracellular matrix [ECM]) is an important step towards advanced tissue engineering. However, precise fabrication of well-defined structures requires tailored fabrication strategies optimized for the material in use. Therefore, it is sensible to begin with a set-up that is customizable, simple-to-use, and compatible with a broad spectrum of materials and applications. This work presents an easy-to-manufacture core/shell nozzle with luer-compatibility to explore core/shell printing of woodpile structures, tested with a well-defined, alginate-based scaffold material formulation.

Presented here is a simple-to-use, core/shell, three-dimensional bioprinting set-up for one-step fabrication of hollow scaffolds, suitable for tissue engineering of vascular and other tubular structures.

ליבה/פגז הדפסה פיגומים קפלים להנדסת רקמות של מבנים צינורי

Three-dimensional (3D) printing of core/shell filaments allows direct fabrication of channel structures with a stable shell that is cross-linked at the ...