עבודה זו נתמכה על ידי מענקי CRUK 15,043 וCRUK 14251. אנו מודים דניאל Wetterskog וקה Kei הו לקבלת סיוע טכני וקריאה ביקורתית של כתב היד.

1. ניסיוני הפרעות ותיוג תא לסמני תגובה (מסך ההפוך Transfection siRNA) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בפיפטה ברדס רקמת סטרילית תרבות 70 μl של 200 ננומטר siRNA במאגר 1x siRNA בבארות של צלחת סטרילי, רגיל 96 גם. לדלל שומנים transfection לתוך 40 כרכים של תקשורת סרום ללא DMEM ולוותר 105 μl לכל siRNA המכיל גם. הערה: דילול 262.5 שומנים μl ל10.5 מיליליטר של סרום ללא DMEM מניבה תערובת אמן מתאימה לצלחת גם 96 כל siRNA, ומספקת 2.6 μl של שומנים בדם בכל טוב. שימוש של 200 ננומטר ריכוז מתחיל siRNA בשלב זה יספק ריכוז עבודה של 20 ננומטר בשלב 1.3, אבל נהלים יעבדו לעבודת ריכוזים עד 5 ננומטר, עם הריכוז מתחיל המותאם בהתאם (כלומר 50 ננומטר). ריכוז עבודה נמוך יותר עשוי להפחית ציונים חיוביים כוזבים מחוץ היעד, למרות שהם יכולים להפחית את עוצמת תגובה על-היעד, שהוביל לגידול של-targe בt שיעורים שליליים כוזבים. </li><li style=";text-align:right;direction:rtl"> מערבבים את הצלחת על ידי רטט עדין לעשר דקות בטמפרטורת חדר. תת-לחלק את 175 μl וכתוצאה מכך לשלוש 50 μl משכפל ליעד על תרבות שטופלה, 96-גם צלחת עם בסיס שקוף אטומה, רקמה. </li><li style=";text-align:right;direction:rtl"> transfect הפוך על ידי מחלק 8,000 תאים לכל גם ב150 DMEM μl המכיל 10% בסרום ישירות על מתחמי שומני siRNA 50 μl. תאי מעי גס אנושיים השימוש HCT116 יציבות להביע סמן GFP מתויג דיווח על פעילות CDK2 5,8. ללא ערבוב נוסף הוא הכרחי. חותם את הצלחת עם קרום לנשימה סטרילי, דבק לשלוט לחות ולמנוע &#39;קצה הלוואי&#39; הצלחת ומניח את הצלחת לתוך חממת humidified על 37 מעלות צלזיוס, 5% CO 2 במשך 48 שעות. </li><li style=";text-align:right;direction:rtl"> לשאוב את התקשורת באופן שסכום שייר קטן של תקשורת נשאר בבארות. תקן את התאים על ידי הוספה של 4% פורמלדהיד נאגר 100 μl לכל היטב דגירה במנדף במשך 10 דקות בחדר temperature. </li><li style=";text-align:right;direction:rtl"> הסר את פתרון התיקון על ידי aspirating הצלחת. בשלב זה או להפסיק את הניסוי על ידי שטיפת הצלחת שלוש פעמים עם 100 מלוח μl פוספט שנאגרו (PBS) ולאחר מכן לאחסן אטום, תחת של PBS 100 μl בחושך על 4 מעלות צלזיוס עד שבוע, או להמשיך ב permeabilization של התאים. הערה: אנו ממליצים צלחות עיבוד בהקדם האפשרי לאחר קיבוע, ובאופן כללי מעדיפים אחסון של צלחות מעובד באופן מלא. חומרים משמרים Biocidal כגון תימרוסל, אזיד הנתרן, או חלופות מסחריות ניתן להוסיף כדי למנוע צמיחת micoroganismal. תוספת של מעכבי phosphatase עוזרת לשמר phospho-epitopes, ואמצעים אחרים כדי לשמר מדינות שינוי החלבון עשוי להיות שימושי בהקשרים רלוונטיים assay </li><li style=";text-align:right;direction:rtl"> הסר PBS מהצלחת וpermeabilize התאים על ידי הוספה של פתרון permeabilization 100 μl. דגירה של 10 דקות בטמפרטורת חדר בלי לרעוד. לשאוב את פתרון permeabilization באמצעות multichפיפטה annel. חזור על פעולה זו שלוש פעמים. </li><li style=";text-align:right;direction:rtl"> חסום את התאים על ידי הוספת 100 פתרון לחסום μl לכל גם במשך 30 דקות בטמפרטורת חדר. הסר את הפתרון לחסום ידי aspirating הצלחת, אז לחקור עם 50 μl של נוגדן RB1 P-S780 אנטי דילול 500 פי בפתרון לחסום עבור שעה 2 בחושך בטמפרטורת חדר. </li><li style=";text-align:right;direction:rtl"> לשטוף את הצלחת שלוש פעמים עם 100 פתרון לשטוף צלחת μl, עוזב את הפתרון בצלחת במשך 5 דקות בכל פעם. לחקור את צלחת הלילה בחושך על 4 מעלות צלזיוס עם 50 נוגדנים משני 1000 פי דילול μl fluorescently מתויג בפתרון לחסום בתוספת 2 מיקרומטר של צבע DNA הכרומטין הספציפי Bisbenzimide. לשטוף את הצלחת שלוש פעמים כמו קודם וחנות אטומה, מתחת ל -100 μl PBS בחושך על 4 מעלות צלזיוס. תמונת הצלחת בתוך שבועיים. </li></ol> 2. הדמיה וסגמנטציה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמש במיקרוסקופ פלואורסצנטי confocal או ספינינג-הדיסק עם מטרת 20X לקחת נפרד 16-בתים, תמונות TIFF בגווני אפור בשלושה ערוצים המקבילים לצבע DNA, GFP וfluorophores חיסוני מכתים. ללכוד רבים סטי תמונה שאינן חופפים, המכונה כאן מסגרות, לתמונה כ 1,000-2,000 תאים לכל טוב. </li><li style=";text-align:right;direction:rtl"> שם קבצי התמונה באופן שיטתי, כך שכל שם קובץ הוא שילוב ייחודי של &#39;שם ניסוי &quot;,&quot; גם את כתובת&#39;, &#39;מספר מסגרת&#39; ו &#39;מזהה ערוץ&#39;, בסדר זה ​​(איור 3). נתוני דוגמא הסט משתמש &quot;כחול&quot; (צביעת הכרומטין DNA) או &quot;הירוק&quot; (GFP) או &quot;אדום&quot; (fluorophore המוכתם החיסונית) כמזהי ערוץ. מזהה את כתובת היטב, מספר מסגרת וערוץ הנוסף על המכונה תמונה מטה. השתמש בסמל התחתון כדי למנוע metadata היטב והמסגרת מבלבל. </li><li style=";text-align:right;direction:rtl"> שם קבצים עם אלמנטי metadata הבאים לפי הסדר שצוין. זה הכרחי על מנת להבטיח שהצעדים התוכנה הבאים לקורערכות קבוצת ctly של תמונות לצורך הניתוח. </li><li style=";text-align:right;direction:rtl"> להוריד ולהתקין את Profiler נייד התוכנה החופשית, פעיל פרל Edition הקהילה, סביבת R סטטיסטית תכנות וRStudio. קבל את כל אפשרויות ברירת המחדל במהלך התקנה; משתמשי PC התקנת Perl Active צריכים לאפשר לכל האפשרויות הנוגעות לPATH, עמותת סיומת קובץ ומיפוי תסריט שבו תתבקש לעשות זאת. פרל הפעיל הוא אופציונאלי עבור משתמשי מקינטוש, אבל הם אחרת יצטרכו להפעיל את תסריט פרל בשלב 3.2 משורת פקודת המסוף ולא באמצעות לחיצה על סמל. </li><li style=";text-align:right;direction:rtl"> פתח את תוכנת Profiler הסלולרי, לחץ על &#39;קובץ&#39;, &#39;יבוא צינור&#39; אז &#39;מקובץ&#39; ובחר את קובץ 3_channels_pipeline.cppipe (האיורים S1A &amp; S1B). הקובץ מכיל הוראות הדרושות לתוכנה לפרש metadata קובץ תמונה משם הקובץ מתואר הכנס. Profiler תא עכשיו מתייחס תמונות, תמציות DNA גרעיני ועוצמות נוגדן מהESE ומשתמש בערוץ ה- GFP כדי לחשב את היחס של גרעין לעומת עוצמת ציטופלסמה עבור כל תא זוהו (איורים 4 ו -5). </li><li style=";text-align:right;direction:rtl"> לחץ על &quot;הגדרות הפלט צפה בכפתור בפינה השמאלית התחתונה של חלון Profiler הסלולרי. בחלק העליון של המסך החדש הן תיבות טקסט שכותרתו &quot;תיקיית ברירת מחדל של קלט &#39;ו&#39; תיקיית פלט ברירת מחדל &#39;. אחד בכל פעם, לחץ על התיקייה-סמלים בצד הימין של תיבות אלה ובחר את המיקום של קבצי תמונה לניתוח והיעד לנתונים שחולצו, בהתאמה (איור S1C). </li><li style=";text-align:right;direction:rtl"> בגין ניתוח תמונה על ידי לחיצה על הכפתור &quot;התמונות לנתח&quot; בפינה השמאלית התחתונה של Profiler הסלולרי. בחלק התחתון של המסך לצפות בזמן שנותר להפקת נתונים, &#39;ניתוח Stop&#39; ולחצני &#39;השהה&#39;. אם נדרש להשהות את הניתוח על ידי בחירה בלחצן &#39;השהה&#39; בכל עת, אשר היא שימושיבעת צפייה בתמונות שנתחה (מתואר בשלב 2.8). </li><li style=";text-align:right;direction:rtl"> לחלופין, לפתוח את החלונות לכל אחד משלבי ניתוח תמונה על ידי לחיצה על עין-הסמלים בפנל על השמאל הקיצוני של חלון התכנית (איור S1D). שים לב לחלון &#39;IdentifyPrimaryObjects&#39; ואלה עבור &#39;אובייקטים תיכונית&#39; &#39;משני&#39; ולבדוק שההגדרות הנוכחיות בProfiler הסלולרי לבצע פילוח תמונה מתאים (ראו תרשים 1 ודיון לקבלת ייעוץ על שינוי הגדרות אלה). </li><li style=";text-align:right;direction:rtl"> לחץ על &#39;אישור&#39; בתיבת ההודעה שתופיע כאשר הניתוח הוא מלא. עבור אל &#39;תיקיית ברירת המחדל של הפלט&#39; המיקום שבו כל קבצי נתונים עם התוצאות נשמרים כמופרדים בפסיקים-ערך (csv) קבצים (איור S2A). </li></ol> 3. הפקת נתונים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מצא את הקובץ החדש &#39;Nuclei.csv&#39;, אשר נכלל ביןפלט מProfiler הסלולרי. קובץ זה מכיל נתונים תא יחידים לעוצמת ניאון נוגדן גרעיני, עוצמת DNA גרעינית וערכי GFP-CDK2 יחס כתב (איורים 6 א &amp; S2A). הערה: מעבדות שונות רוצה לעבד את זה סוג של נתונים כדי שיתאימו לאופי של מבחני שלהם. הציע לנתונים הנוכחיים הוא gating של תאים מכל מצב טיפול על פי נתוני הנוגדן וערכי כתב GFP-CDK2 באמצעות סקריפט Perl מסופק 2_gate_classifier.pl &#39;. </li><li style=";text-align:right;direction:rtl"> העתק את קובץ התסריט פרל מסופק 2_gate_classifier.pl &#39;לאותה התיקייה כקובץ נתונים&#39; Nuclei.csv &#39;(איור S2A). לחץ לחיצה כפולה על הסמל לתסריט פרל ו, כאשר תתבקשו לעשות זאת, הקלד את השם המלא של קובץ הנתונים ואחריו את שם קובץ &#39;.csv&#39; לקובץ שבו התאים הם להיות מגודרות ולבסוף ערכי השער לנוגדןהקרינה ונתונים כתב GFP-CDK2. הערה: כיצד לקבוע את הגדרות בעיקר שער ולהחיל אלה לניתוח של הנתונים בהמשך בסעיף נציג נתונים ואיור 6 (כדי לנתח את נתוני שימוש מסופק 0.004 &#39;ו&#39; 1.5 &#39;, בהתאמה). משתמשי מקינטוש צריכים להריץ את הסקריפט פרל משורת פקודת המסוף על ידי הקלדה: &quot;פרל 2_gate_classifier.pl &#39;. </li><li style=";text-align:right;direction:rtl"> שים לב לקובץ החדש שנוצר המשלב את ערכי assay התא בודדים גלם מנתוני Profiler הסלולרי המקוריים עם תוויות תת-אוכלוסייה שמראים איך כל תא מכל הטוב מבצע נגד שני השערים (איור 6 ג). </li><li style=";text-align:right;direction:rtl"> העלילה נתונים עבור כל תנאי ניסוי באמצעות התוויות תת-אוכלוסיית תא בודדת על ידי פתיחת תוכנת RStudio. לחץ על &#39;קובץ&#39; ו &#39;פתח קובץ&#39;, ולאחר מכן בחר את הקובץ &#39;analysis.r&#39; סיפק. שים לב לפקודות לעלילת 6B דמויות, <strong&gt; 7 ו -8 בחלון השמאלי העליון של RStudio (איור S2B). בחלון השמאלי העליון, בין סימנים ציטוט כפולים על קווים 5 ו -6, הקלד את כתובת המחשב של התיקייה המכילה את הנתונים מגודרות. מוסיף את אות כונן ואת שמו של הקובץ עצמו, בהתאמה (לדוגמא, &quot;C: / תיקיית ניתוח / פלט ניתוח&quot; ו- &quot;nuclei_gated.csv&quot;). הערה: אם RStudio משמש בפעם הראשונה על מחשב נתון, חבילת גרפיקת ר &#39;ggplot2&#39; תצטרך להיות מותקנת ראשון. זהו צעד רק פעם אחת להתקנה חדשה של RStudio, לאחר שצעד זה הופך להיות מיותר. כדי להתקין &#39;ggplot2&#39;, לחץ על הכרטיסייה בשם &#39;חבילות&#39; מעל החלון בפינה הימנית התחתונה של RStudio, לחץ על הכפתור &#39;חבילות התקנה&#39; שמופיע מתחת לזה. חלון חדש יופיע. &quot;Ggplot2 &#39;סוג (ציטוטי השמטה) לים&#39; חבילות &#39;קצב בחלון חדש זה, ולבסוף לחץ על הכפתור &#39;תקן&#39; כדי לסגור את החלון, להתקין את פונקציות ggplot2 הכרחיות ולחזור לחלון הראשי RStudio להמשיך מצעד 3.6. </li><li style=";text-align:right;direction:rtl"> קווי גולת כותרת 1 עד 17 בחלון השמאלי העליון של RStudio, לאחר מכן לחצו על הכפתור &quot;הפעל&quot;. זה ייכנס לנתוני הניסוי, ערכי סף ופרטי מיקום טוב לR (איור S2C). R כעת באופן זמני להחזיק את הנתונים הרלוונטיים לקשירת קשר. </li><li style=";text-align:right;direction:rtl"> סמן בלוקים בודדים של הקוד שנותר מתחת לקו 17 וליצור עלילות המקבילה על ידי לחיצה על הכפתור &quot;הפעל&quot; כמו קודם. שים לב למגרשים בחלון בפינה הימנית התחתונה של RStudio ולשמור את המספר של פורמטים ידי לחיצה על הכפתור &quot;היצוא&quot; (איור S2D). </li><li style=";text-align:right;direction:rtl"> בעת סגירת RStudio, לחץ על &#39;אל תשמור&#39; כאשר תתבקשו לעשות זאת. זה מונע בלבול בשימוש הבא של RStudio, אשר אחרת יקיים נתוניםמהפגישה הקודמת. </li></ol>

<ol>
	<li>Carpenter, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CellProfiler:+image+analysis+software+for+identifying+and+quantifying+cell+phenotypes.">CellProfiler: image analysis software for identifying and quantifying cell phenotypes.</a> Genome Biol. 7 (10), 100 (2006).</li><li>Khan, A., Eldaly, H., Rajpoot, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+gamma-gaussian+mixture+model+for+detection+of+mitotic+cells+in+breast+cancer+histopathology+images.">A gamma-gaussian mixture model for detection of mitotic cells in breast cancer histopathology images.</a> J Pathol Inform. 4, 11 (2013).</li><li>Selzer, P., Beibel, M., Gubler, H., Parker, C. N., Gabriel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+multivariate+data+analysis+strategies+for+high-content+screening.">Comparison of multivariate data analysis strategies for high-content screening.</a> J Biomol Screen. 16 (3), 338-347 (2011).</li><li>Lyman, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+content,+high-throughput+analysis+of+cell+cycle+perturbations+induced+by+the+HSP90+inhibitor+XL888.">High content, high-throughput analysis of cell cycle perturbations induced by the HSP90 inhibitor XL888.</a> PLoS One. 6 (3), e17692 (2011).</li><li>Richardson, E., Stockwell, S. R., Li, H., Aherne, W., Cuomo, M. E., Mittnacht, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism-based+screen+establishes+signalling+framework+for+DNA+damage-associated+G1+checkpoint+response.">Mechanism-based screen establishes signalling framework for DNA damage-associated G1 checkpoint response.</a> PLoS One. 7 (2), e17692 (2012).</li><li>Heynen-Genel, S., Pache, L., Chanda, S. K., Rosen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+and+high-content+screening+for+target+discovery+and+deconvolution.">Functional genomic and high-content screening for target discovery and deconvolution.</a> Expert Opin Drug Discov. 7 (10), 955-968 (2012).</li><li>Krausz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-content+siRNA+screening.">High-content siRNA screening.</a> Mol Biosyst. 3 (4), 232-240 (2007).</li><li>Gu, J., Xia, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+Cycle-dependent+Regulation+of+a+Human+DNA+Helicase+That+Localizes+in.">Cell Cycle-dependent Regulation of a Human DNA Helicase That Localizes in.</a> DNA Damage Foci. Mol Biol Cell. 15 (7), 3320-3332 (2004).</li><li>Mittnacht, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+pRB+phosphorylation.">Control of pRB phosphorylation.</a> Curr Opin Genet Dev. 8 (1), 21-27 (1998).</li><li>Mittnacht, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+retinoblastoma+protein--from+bench+to+bedside.">The retinoblastoma protein--from bench to bedside.</a> Eur J Cell Biol. 84 (2-3), 97-107 (2005).</li><li>Nybo, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP+imaging+in+fixed+cells.">GFP imaging in fixed cells.</a> BioTechniques. 52 (6), 359-360 (2012).</li><li>Schwartz, R. L., Foy, B. D., Phoenix, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Learning Perl - Making Easy Things Easy and Hard Things Possible. , 1-363 (2011).</li><li>Wickham, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> ggplot2: Elegant Graphics for Data Analysis. , 978-970 (2009).</li></ol>

יש לי המחברים אין לחשוף

העבודה המתוארת מהווה הליך perturbance multiwell של תאים באמצעות siRNA, איתור סמן לאחר מכן ולבסוף להשתמש בשורה של צעדים-נתמך תוכנה כדי להקל על חילוץ של נתונים כמותיים מתמונות מיקרוסקופ פלואורסצנטי וכתוצאה מכך. הגישה מתמקדת באספקת ערך עוצמת גרעינית וcytoplasmic לתאים בודדים, שבה יש יישום מעשי נרחב ביישומים מבוססי תאים רבים. נתוני הדוגמא משמשים כאן נוצרו בהגדרת מסך siRNA שבו שני מבחני ניאון למעבר מחזור תא שלב G1 נבדקים וקורלציה חזרה למדד biophysical ישיר יותר של תוכן DNA הגרעיני. השימוש בכתם DNA ניאון כדי DNA הגרעיני תמונה הוא צעד הכרחי בתהליך פילוח תמונה כפי שהיא מאפשרת זיהוי של תאים בודדים ו&#39;מסכת הגרעינים &quot;וכתוצאה מכך משמשת כנקודת ההתחלה לזהות cytoplasmi המקבילאזורי ג. כתב CDK2 מתויג GFP, אשר באו לידי ביטוי ביציבות בתאים, מעניק משתנה עדיין גבוה באופן עקבי מאשר אות רקע בציטופלסמה שבאמצעותו ניתן התווה תא זה. אותו צינור הניתוח צריך להיות ישים לניתוח של אירועי טרנסלוקציה החלבון באמצעות כתבים אחרים מתאימים צמוד הקרינה ותגובתם לperturbance. כמו כן, החלפת כתב GFP-CDK2 עם צבעי ניאון ציטופלסמה הספציפית תאפשר השימוש האלטרנטיבי של אלגוריתם זה כדי למדוד את הממדים של ציטופלסמה וגדלים היחסי של תאים בתמונות. שיקול נוסף בעיצוב אסטרטגית פילוח התמונה המתוארת כאן הוא השימוש בProfiler הסלולרי כדי לספק ערכי עוצמה משולבים לכימות DNA. שילוב של עוצמת ערכים עבור DNA הגרעיני נתונים צביעה מאפשרים לשינויים אפשריים בגודל גרעין, ומייצג התאמה קרובה לפרופילי הכימות ראולpropidium יודיד מוכתם FACS נתונים. עם זאת, עוצמת משולבת לא יכולה לספק אמצעים מתאימים כדי להעריך את תפקוד חלבון שבו ריכוז ממוצע, שהודגם על ידי עוצמת הקרינה ממוצעת של אנטיגן, הוא יותר מבחינה ביולוגית רלוונטי מהסכום הכולל המשולב של חלבון (וקרינה קשורה) בתוך תא תא. לכן אומר ערכי עוצמה שמשו לP-S780 RB1 ונתונים GFP. האפשרות לשנות בין שני המצבים (כלומר או משולב) של הערכת נתונים נמצא בלוח &#39;ExportToSpreadsheet&#39; של תוכנת Profiler הסלולרי. הגדרות הניתוח בקובץ 3_channels_pipeline.cppipe מותאמות לתמונות בערכת נתוני דוגמא. ניתוח של ערכות תמונות חדשות עם פרוטוקול זה יחייב את שמות הקבצים לאמץ את המוסכמה למתן שמות שתוארה לעיל (איור 3). כמו כן, רגישות ערכים כדי להתאים את הבהירות של הכתמה גרעינית DNA ומפתנים לרקעעוצמות בסטי התמונה החדשות ייתכן שתצטרכנה להיות מותאמות בתוך הגדרות Profiler הסלולרי. בהתחשב בתפקיד המרכזי צביעת DNA מחזיק לבניית מסכות פילוח תמונה השונות, היישום של הגדרות רגישות נכונות לערוץ זה הוא מפתח לניתוח המוצלח של נתוני תמונה חדשים עם תוכנת Profiler הסלולרי. הגדרות Profiler הסלולרי סיפק קובץ (3_channels_pipeline.cppipe) מכיל הערות על הפרמטרים הכי שימושי לעתים קרובות להתאמת הניתוח לנתונים חדשים. הערות אלו הן בתיבת הטקסט בחלק העליון של המסך בחלון הראשי של תא Profiler ותכלולנה הדרכה על שינוי הגדרות הרגישות והתאמת מספר הערוצים להיות מנותח. כנגדו כתב אישום בסעיף 2.8 לפרוטוקול, כדי לבדוק את הגדרות לנתוני תמונה חדשות זה עשוי להיות נחוץ כדי לבחון את פילוח התמונה במהלך ניתוח תמונה על ידי לחיצה פתוחה הסמלים &#39;עין&#39; לכל אחת מ&#39;זיהוי אובייקטים ... &quot;צעדי פרוטוקול (איור S1D </strong&gt;). בפרט, להדמיה של נתוני תמונה באמצעות &#39;IdentifyPrimaryOjects &quot;תציג אם מסכת הגרעינים מזוהה בצורה נכונה מתמונות של צביעת DNA. על Profiler Cell דף התוכנה למודול &#39;IdentifyPrimaryOjects&#39; הוא גורם תיקון סף. התאמת ניסוי והטעייה של ערך זה תהיה לתקן את רוב השגיאות בזיהוי גרעיניות. הערכים לאזן את ערוץ DNA נגד עוצמת הרקע לכל תמונה. ערכי גורם תיקון סף הציר סביב 1, שבו גדול יותר מזה הוא יותר מחמיר (טוב לתמונות ברורות) ופחות מ -1 מקל (מתאימה לתמונות עם פחות ניגוד בין מכתים ורקע). תפוקת הגלם של נתוני תא בודדים מProfiler Cell ניתן לנתח במובנים שונים כדי להתאים לצרכימים של מחקרים אחרים. מוצג כאן הוא השימוש בתסריט פרל ליישם שערים לשניים מהפרמטרים שנמדדו לכל תא במטרה לסייע לחילוץ מגמות ביולוגיות מהנתוניםהיתר ד הצלבה של תת-האוכלוסיות המזוהות עם מדידות נוספות. למרות שזה אפשרי במידה שווה לכלול אלמנטים של gating במסגרת Profiler הסלולרי, התוואי החלופי המשמש כאן מספק גמישות ומהירות גדולות יותר, במיוחד אם ערכות נתונים גדולות צריכים להיות מוערכות. השלב האיטי ביותר בשלבי רכישת פוסט דימוי של הפרוטוקול הנוכחי הוא הריצה של תוכנת Profiler הסלולרי. מאבחן תא כאן מנוהל ללא הטלת שערים לייצר סט נתונים גולמי מגודרת un אשר ניתן reanalyzed עם תסריט פרל שלאחר מכן במהירות רבה יותר ובמידת צורך, איטרטיבי עם ערכי שער שונים. לא כל המחקרים תדעו מראש את ערכי השער המתאימים כמו זה עשויים להשתנות עם חומרים כימיים על כל קבוצת נתונה של נתונים, ובאופן פוטנציאלי לאורך זמן. זהו, אם כן, מומלץ ליצור היסטוגרמות המתארת ​​את התפלגות הנתונים הגולמית המתקבלת מהתא Profiler עבור פקדים חיוביים ותאי דגם מוטרדים על מנת לזהות valu שער המתאיםes לפרמטרים של עניין. סקריפטים Perl נכתבים לקבל מבנה טור מוגדר בנוקשות של נתונים מProfiler הסלולרי ועלולים להפסיק לעבוד אם משתמש משנה את מספר פלט פרמטרים על ידי Profiler הסלולרי באמצעות ההגדרות &#39;ExportToSpreadsheet&#39;. כדי לעזור ליישם שינוי של הגדרות הערות כלולות בתוך קבצי תסריט פרל. כדי לראות אלה להציג את התסריט בעורך טקסט, רצוי עורך הטקסט של מתכנת מוגדר אלמנטי פרל קוד צבע (למשל, http://www.activestate.com/komodo-edit). הערות אלו מציינות היכן להתאים את התסריט להסתגל לשינויים בנתונים בפורמט. בדומה לתסריטי Perl, קובץ R-הקוד שסופק (analysis.r), המכיל את ההוראות לקשירת קשר הדמויות מנתונים ניתוח התמונה, ניתן לקרוא בעורך טקסט או תוכנת RStudio לראות הערות נוספות על שימוש והסתגלות. ניתן להוסיף הערות אלו עם פרטים על ביטויים רגילים ופרל &lt;sup&gt; 12 והחבילה ggplot2 13 לR, אשר שניהם מהווים את הבסיס לאופן שבו נתונים הוא לקריאה, מבואר וזממו, בהתאמה. מחקרים חדשים באמצעות מיקרוסקופ פלואורסצנטי, כמו גם הנתונים גולמיים שהופקדו עם פרסומי קוד פתוחים נוחות לשיטות ניתוח כגון אלה שתוארו כאן. טבעו של נתונים גבוה תוכן משאיל את עצמו לניתוח רקורסיבית עם דגשים אנליטית שונים בהתאם לתחומי המחקר של כל צופה נתון. למרות השאלות שיכולים להישאל של נתונים מוגבלים על ידי הבדיקות המשמשות במקור, נתוני תמונה יכולים להיות לעתים קרובות reanalyzed משמעותי מעבר להיקף של המחקרים שחוללו אותם.

העבודה מוצגת כאן מתארת ​​את השימוש בתוכנת Profiler הסלולרי הזמינים באופן חופשי לבצע פילוח מודרך אלגוריתם של תמונות מיקרוסקופ פלואורסצנטי של תאים חסיד לזהות תאים בודדים ואזורי subcellular מוגדרים. גישה זו, המכונה פילוח תמונה, מאפשרת הניתוח רב-פרמטרית הבא של תאי הדמיה על ידי כימותי סמנים שכותרתו fluorescently מקומיים לכל תא או אזור subcellular (המכונה אובייקטים מפולחים כ). עבודה זו מהווה בסיס למאפשר ניתוח גבוה תוכן, והוא נועד לשמש ככלי שיכול להיות מפותח יותר ושונה כדי שיתאים לרב-פרמטרית, תא בודד מנתח במעבדות ללא גישה למכשירים גבוהים תוכן מיוחדים או תוכנת קניינית. הקבצים מצורפים לכתב יד זה כוללים מערך בדיקה של הנתונים רלוונטיים תמונת גלם, הגדרות אלגוריתם ותסריטים התומכים על מנת ליצור את הניתוח שתואר. F הגדרות אלגוריתם מסופקתאו Profiler הסלולרי מותאם לנתונים הדוגמא להגדיר ופרטי סעיף הדיון מה התאמות עשויות להיות נחוצות כדי לאפשר שימוש בנתוני תמונה ממחקרים אחרים. ברגע שנתונים כמותיים כבר הופקו באמצעות Profiler הסלולרי, ייתכן שיש לי מעבדות שונות יש דרישות שונות לאופן שימוש במידע שהוצג על ידי ערכי תא הבודדים בנתונים הגולמיים; המוצג כאן הוא גישה אחת על ידי שעיר מוחלים על הנתונים הגולמיים עבור כל assay. שימוש בשערים אלה, נתונים הופכים למונחים בינארי של תגובה, המאפשרים הדמיה של מגמות המקשרות טיפולים שונים עם תת-האוכלוסיות של תאים עוברים תגובה שהוגדרה על ידי השערים. השערים נקבעים בהתבסס על תצפיות של הפצות הנתונים המתקבלות לבקרות שליליות וחיוביות מתאימות לכל מדידה רלוונטית. השימוש בשערים הוא רק דוגמא אחת של איך לנהל את מדידות גלם, המבוסס על התאים. כמו כן מוצג כאן הוא השימוש בעוצמת DNA הגרעיניasurements בצורתם הגולמית כטווח רציף של ערכים בשילוב עם נתונים מגודרות. גישות אחרות לניהול נתונים ניתוח תמונה צריכה להיחשב, בהתאם לאופי של המחקר; חלופות סטטיסטיות לשימוש בשערים לשיוך תאים לאוכלוסיות דווחו 2 ושיטתי השוואות של אסטרטגיות כדי לסכם נתונים גבוה תוכן במספר גדול של פרמטרים דווח 3. ניתוחים גבוהים תוכן של נתוני תמונה מצאו שימוש במחקרים סלולריים של סמים-תגובה, הפוך גנטיקה ולחץ סביבתי איתות 4-6. הכשרון של ניתוח גבוה תוכן נובע מהעובדה שהניתוח האלגוריתמי של נתוני מיקרוסקופ פלואורסצנטי מאפשר פרמטרים כמותיים ומרחב כדי להיחשב בו-זמנית על פני תאים בודדים 7. בדרך זו, תוצאות סלולריות למבחנים מרובים יכולות להיות התנהגות מוצלבים, ההפרש של assay-דניתן לעקוב תת-אוכלוסיות תאי efined בתוך תנאים ומבחנים ניסיוניים יכולים לכלול בחינה של משתנים מורפולוגיים. העבודה האסטרטגיות וניתוח שנדונה כאן, כמו לגישות גבוהה תוכן אחרים, הם מסוגלים לספק נתונים מרובבים המצליבים לתאים בודדים. מחקרי חליפת שיטות גבוהים תוכן שיוצרים תמונות מיקרוסקופ פלואורסצנטי וחלים על ניתוח של נתונים הנעים בין עשרות תמונות שהופקו במיקרוסקופיה הקרינה מבוססת קונבנציונלית תפוקה נמוכה ועד לאלף תמונות שהופק באמצעות פלטפורמות גבוהות הקרנת תוכן אוטומטית. העבודה באה לידי ביטוי כאן עם נתוני דוגמא שממבחנים נפרדים הנמדדים במונחים של שני עוצמות גרעיניות ניאון סמן או טרנסלוקציה הגרעינית / cytoplasmic של חלבון כתב ניאון, בהתאמה. העבודה היא גמישה שבמבחנים אלה יכולים להיחשב בנפרד או בשילוב בהתאם EACh נתון שאלת מחקר על ידי חוקרים שונים. נתוני הדוגמא מיוצרים כחלק מניסוי התערבות RNA (RNAi) (איור 1). oligonucleotides הקטן מפריע RNA (siRNA) משמש למציאת חלבונים ספציפיים בתאי סרטן מעי גס האנושי HCT116 שגורמים לשינויים לשני כתבי ניאון של פעילות cyclin-dependent kinase (CDK). זירחון CDK6 תלוי של החלבון הגרעיני רטינובלסטומה בסרין 780 (RB1 P-S780) מוערך על ידי צביעת נוגדן. באותם תאים, כתב חלבון מתויג ניאון ירוק של פעילות CDK2 (כתב GFP-CDK2) מוערך על ידי הגרעין שלה ליחס cytoplasmic בי בהעדר פעילות CDK2 הכתב מתגורר בגרעין ועל הסעות הפעלת CDK2 לתוך הציטופלסמה 8. בנוסף, ה- DNA הגרעיני של כל תא מוכתם באמצעות צבע intercalating-DNA, Bisbenzimide, המשמש כאמצעי לזיהוי תאים ולהגדיר גבולות גרעינים בתמונות, כמו גםמדד sa של שפע DNA מתן מידע על עמדת מחזור התא של התא (איור 2). הפעילויות של CDK6 וCDK2 הן לגילוי תאי מעבר מG1 לשלב S של מחזור התא 5 ולהצליח בכל 9,10 אחר, וככזה, קרובה התאמה בין שני הכתבים בתאים בודדים צפויה. בסיס נתוני ההפגנה משמשים כאן כדוגמא מנתח את ההשפעה של siRNA מטרות CDK6, חלבון רטינובלסטומה (RB1) ושליטה ללא מיקוד שלילית (טבלת 1). מציאה של CDK6 צריכה לעורר שתי ירידה של epitope RB1 P-S780 והצטברות של תאים בשלב G1 של מחזור התא. מציאה RB1 משמשת כביקורת מגיב להספציפיות של נוגדן phospho-S780. תמונות מיקרוסקופ פלואורסצנטי מפורמלין קבועות 11, תאים בתרבית רקמת HCT116 מוכתמים fluorescently משמשים לניתוח תמונה אלגוריתמי. נתונים המספריים שנוצר לאחר מכן נעשה שימוש להפניה מקושרת הכתבים ולאמוד את ההשפעה של המדינות השונות מציאה. גודל הפוטנציאל של נתונים המיוצרים על ידי סוג זה של ניתוח יכול להוות אתגר לכלי ניתוח רגילים. לדוגמא, את נתוני תא הבודדים יכולים להיות גדולים יותר מאשר כמה תוכנות גיליון אלקטרוני תהיה להתאים. הוצאות כוללים סקריפטים Perl אשר מבצעים עיבוד פשוט, מאוד-חוזר על עצמו, בפיקוח של הנתונים כדי לסייע ניתוח של מערכי נתונים גדולים. סקריפטים Perl נכתבים במיוחד עבור קבצי פלט המיוצרים על ידי התאים Profiler, בעת עיבוד קבצי תמונה עם אמנת קובץ שמות ספציפית (איור 3), ולאפשר למספרים משתנה של שדות לכל גם לשימוש בניתוח. היא לעתים קרובות חשובה לנתונים assay תא בודד שער כדי לעקוב אחר מגמות בתת אוכלוסיות של תאי 5 ומוצגים כאן הוא השימוש בתסריט פרל לדגל כל תא המבוסס על שער שנקבע מראש סט לכל סוג assay. כמו כן, נכללים סקריפטים Perl אופציונלייםשיסכם את תוצאת נתונים לבארות בודדות (או תנאים), ומספק: אחוז התאים בתוך שער הסט והערכים הממוצעים של ציוני assay גלם. הדרך השנייה, הומוגנית יותר של הצגת הנתונים, תקפה שבו תגובות רוב התאים בתוך היטב או כל להשפיע. כאמור לעיל, הערכה כזו היא פחות שימושית מזה מוענק על ידי gating נתוני תא הבודד שבי התגובה מוגבלת לקבוצת משנה של תאים בתוך אוכלוסייה. השירות של זרימת העבודה המתוארת אינו מוגבל להפרעות על ידי siRNA או מבחני הסמן תיארו. מחקרים השתמשו בגישה זו לassay תגובות בניסויים בתרבית רקמה באמצעות שילובים של siRNA, מעכבים כימיים וטיפול בקרינה, ולהערכה של סמנים אחרים מאשר CDK6 ופעילות CDK2 5. מבחינה מושגית, האסטרטגיה הניסיונית מאפשרת מגוון רחב של אזורי subcellular ביולוגיים שימושיים להיות רשום באופן אוטומטיבתאים בודדים הנמצאים בתמונות מיקרוסקופ פלואורסצנטי. ככזה, גישה זו יכולה להניב מידע כמותי, נתונים ריבוב חושף ביולוגי שעלולים להחמיץ באמצעות טכניקות המתמקדות באוכלוסיות ולא תאים בודדים. עם שינויים קלים, העבודה הגישה וניתוח שתוארה יכולה להניב נתונים כמותיים תא, פרט לכל יציאות הקרינה מבוססת assay ותגובות תא-ביולוגי, שבו הערכה כמותית של תוכן DNA, כימות של הקרינה גרעינית או cytoplasmic או הטלטלות של סמנים בין אלה שני תאים בנפרד או באופן ריבוב הוא עניין. דרישות הוצאה לאור נוטות יותר ויותר לכיוון הגשת נתונים בגלוי הנגיש גלם, גישה ולהיכרות עם כלים חינמיים לניתוח תמונה מיקרוסקופית כגון אלה שתוארו כאן גם יהיו עניין ישיר למעבדות מחפשים לנתח מחדש נתונים שפורסמו.

<table border="0" cellpadding="0" cellspacing="0" width="604">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:103px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">AllStars negative control siRNA</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right" style="width:119px;">1027280</td>
			<td style="width:167px;">Negative control siRNA.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CDK6 siRNA</td>
			<td style="width:103px;">Dharmacon/ Custom synthesis</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">Antisense sequence: 5&#39; CUCUAGGCCAGUCUUCUUCUU</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">RB1 siRNA</td>
			<td style="width:103px;">Dharmacon/ Custom synthesis</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">Antisense sequence: 5&#39; GGUUCAACUACGCGUGUAATT</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">5x siRNA buffer</td>
			<td style="width:103px;">Thermo Scientific</td>
			<td>B-002000-UB-100</td>
			<td style="width:167px;">To be diluted with nuclease-free, non-DEPC treated water.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Nulcease-free water (non-DEPC)</td>
			<td style="width:103px;">Applied Biosystems</td>
			<td>AM9937</td>
			<td style="width:167px;">For dilution of siRNA buffer.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hiperfect</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right">301705</td>
			<td style="width:167px;">Transfection lipid.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">DMEM</td>
			<td style="width:103px;">Life Technologies</td>
			<td align="right">41966052</td>
			<td style="width:167px;">Pyruvate and high-glucose supplemented tissue culture media.</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">96 well tissue culture plate</td>
			<td style="width:103px;">Falcon</td>
			<td align="right">3072</td>
			<td style="width:167px;">Plain, 96-well tissue culture plate for the parallel, compartmentalized mixing of transfection complexes.</td>
		</tr>
		<tr height="189">
			<td height="189" style="height:189px;width:216px;">Packard Viewplate</td>
			<td style="width:103px;">Perkin Elmer LAS</td>
			<td align="right">6005182</td>
			<td style="width:167px;">96 well TC plate with optical base on which cells are transfected, grown, fixed and eventually imaged. Supplied with opaque, adhesive plate seals, which are used during storage of used plates.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Breathable membrane</td>
			<td style="width:103px;">Alpha Labs</td>
			<td style="width:119px;">LW2783</td>
			<td style="width:167px;">Sterile, gas-permeable, adhesive membrane.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Neutral buffered formalin, 10%</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td>HT5012-1CS</td>
			<td style="width:167px;">10% Formalin (4% formaldehyde) fixative used neat in protocol.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Triton X-100</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td>X100PC</td>
			<td>Non-ionic detergent</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Tris</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td style="width:119px;">T1503</td>
			<td style="width:167px;">Trizma base (tris(hydroxymethyl)aminomethane)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tween 20</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td style="width:119px;">P2287</td>
			<td style="width:167px;">For plate wash solution.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anti-P-S780 RB1 antibody</td>
			<td style="width:103px;">Abcam</td>
			<td>ab32513</td>
			<td>Rabbit monoclonal</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">AlexaFluor647 Anti-rabbit</td>
			<td style="width:103px;">Invitrogen</td>
			<td>A21245</td>
			<td style="width:167px;">Highly cross-adsorbed, fluorescently labelled secondary antibody.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Hoechst 33342 (Bisbenzimide)</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td>B2261</td>
			<td style="width:167px;">Fluorescent, chromatin-intercalating, DNA dye.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Permeabilization solution</td>
			<td style="width:103px;">NA</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">0.1% Triton X-100 in 50 mM Tris-buffered saline, pH 8.0.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Plate wash solution</td>
			<td style="width:103px;">NA</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">Tris-buffered saline containing 0.1 % Tween-20.</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Block solution</td>
			<td style="width:103px;">NA</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">5% powdered milk in Tris-buffered saline and 0.1% Tween-20. For blocking plate prior to immuno-staining and dilution of antibodies.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Cell Profiler 2.1</td>
			<td style="width:103px;">Broad Institute</td>
			<td style="width:119px;"></td>
			<td>http://www.cellprofiler.org/download.shtml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Active Perl Community Edition</td>
			<td style="width:103px;">ActiveState</td>
			<td style="width:119px;"></td>
			<td>http://www.activestate.com/activeperl/downloads</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">R programming environment</td>
			<td style="width:103px;">The R Foundation</td>
			<td style="width:119px;"></td>
			<td>http://www.r-project.org</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rstudio</td>
			<td style="width:103px;">Rstudio</td>
			<td style="width:119px;"></td>
			<td>http://www.rstudio.com/</td>
		</tr>
	</tbody>
</table>

workflow for high-content, individual cell quantification of fluorescent markers from universal microscope data, supported by open source software

התקדמות בהבנת מנגנוני הבקרה המסדירים את התנהגותם של תאים בתרבית רקמת דגמי יונקים חסיד הופכות תלויה יותר ויותר במצבים של ניתוח מתא בודד. שיטות אשר מספקות נתונים מרוכבים המשקפים את הערכים הממוצעים של סמנים ביולוגיים מאוכלוסיות תאים עלולות לאבד דינמיקה תת-אוכלוסייה המשקפת את ההטרוגניות של המערכת הביולוגית למדה. בקנה אחד עם זו, גישות מסורתיות מוחלפות על ידי, או נתמכת עם, צורות מתוחכמות יותר של assay הסלולרי שפותחו כדי לאפשר הערכה על ידי מיקרוסקופ גבוה תוכן. מבחני אלה פוטנציאל לייצר מספר רב של תמונות של סמנים ביולוגיים ניאון, אשר מופעלים על ידי המלווה את חבילות תוכנת קניינית, מאפשר למדידות רבות פרמטרית לכל תא. עם זאת, עלויות הון גבוהות יחסית והתמחות יתר של רבים מהתקנים אלה מנעו את נגישותם לחוקרים רבים. שתואר כאן הואזרימת עבודה אוניברסלית לכימות של עוצמות סמן פלואורסצנטי מרובות מאזורי subcellular הספציפיים של תאים בודדים מתאימים לשימוש עם תמונות מרוב מיקרוסקופי ניאון. מפתח לזרימת עבודה זו הוא יישום תוכנת Profiler הסלולרי זמינה באופן חופשי 1 להבחין בין תאים בודדים בתמונות האלה, קטע אותם לאזורי subcellular המוגדרים ולספק עוצמת הקרינה סמן הערכים ספציפי לאזורים אלה. חילוץ ערך עוצמת תא בודד מנתוני תמונה הוא המטרה של זרימת עבודה זו המרכזית ויהיה מאויר עם הניתוח של נתונים שליטה ממסך siRNA לרגולטורי מחסום G1 בתאים אנושיים חסיד. עם זאת, העבודה שהוצגה כאן יכולה להיות מיושמת על ניתוח של נתונים מאמצעים אחרים של הפרעת תא (לדוגמא, מסכי מתחם) וצורות אחרות של סמנים סלולריים הקרינה מבוססת וכך צריכים להיות שימושיים למגוון רחב של מעבדות.

Watch this Scientific Journal Video about Workflow for High-content, Individual Cell Quantification of Fluorescent Markers from Universal Microscope Data, Supported by Open Source Software at JoVE.com

Workflow for High-content, Individual Cell Quantification of Fluorescent Markers from Universal Microscope Data, Supported by Open Source Software

מוצגים הוא עבודה אינפורמטיקה גמישה המאפשרת ניתוח מבוסס תמונת ריבוב של תאים שכותרתו fluorescently. העבודה מכמתת סמנים גרעיניים וcytoplasmic ומחשבה טרנסלוקציה סמן בין תאים אלה. נהלים מסופקים ההפרעות של תאים באמצעות siRNA ומתודולוגיה אמינה לגילוי סמן על ידי immunofluorescence העקיף בפורמטי 96-היטב.

זרימת עבודה עבור גבוהה תוכן, כימות תא יחידה של פלורסנט סמנים מUniversal מיקרוסקופים נתונים, הנתמכים על ידי תוכנות קוד פתוחות

Advances in understanding the control mechanisms governing the behavior of cells in adherent mammalian tissue culture models are becoming increasingly ...

workflow-for-high-content-individual-cell-quantification-fluorescent

Research

JoVE Journal

Biology

12.9K Views.  UCL Cancer Institute.  מוצגים הוא עבודה אינפורמטיקה גמישה המאפשרת ניתוח מבוסס תמונת ריבוב של תאים שכותרתו fluorescently. העבודה מכמתת סמנים גרעיניים וcytoplasmic ומחשבה טרנסלוקציה סמן בין תאים אלה. נהלים מסופקים ההפרעות של תאים באמצעות siRNA ומתודולוגיה אמינה לגילוי סמן על ?...

Video: Workflow for High-content, Individual Cell Quantification of Fluorescent Markers from Universal Microscope Data, Supported by Open Source Software

A Neuronal and Astrocyte Co-Culture Assay for High Content Analysis of Neurotoxicity

High Content Analysis (HCA) assays combine cells and detection reagents with automated imaging and powerful image analysis algorithms, allowing measurement of multiple cellular phenotypes within a single assay. In this study, we utilized HCA to develop a novel assay for neurotoxicity. Neurotoxicity assessment represents an important part of drug safety evaluation, as well as being a significant focus of environmental protection efforts. Additionally, neurotoxicity is also a well-accepted in vitro marker of the development of neurodegenerative diseases such as Alzheimer's and Parkinson's diseases. Recently, the application of HCA to neuronal screening has been reported. By labeling neuronal cells with &beta;III-tubulin, HCA assays can provide high-throughput, non-subjective, quantitative measurements of parameters such as neuronal number, neurite count and neurite length, all of which can indicate neurotoxic effects. However, the role of astrocytes remains unexplored in these models. Astrocytes have an integral role in the maintenance of central nervous system (CNS) homeostasis, and are associated with both neuroprotection and neurodegradation when they are activated in response to toxic substances or disease states. GFAP is an intermediate filament protein expressed predominantly in the astrocytes of the CNS. Astrocytic activation (gliosis) leads to the upregulation of GFAP, commonly accompanied by astrocyte proliferation and hypertrophy. This process of reactive gliosis has been proposed as an early marker of damage to the nervous system. The traditional method for GFAP quantitation is by immunoassay. This approach is limited by an inability to provide information on cellular localization, morphology and cell number. We determined that HCA could be used to overcome these limitations and to simultaneously measure multiple features associated with gliosis - changes in GFAP expression, astrocyte hypertrophy, and astrocyte proliferation - within a single assay. In co-culture studies, astrocytes have been shown to protect neurons against several types of toxic insult and to critically influence neuronal survival. Recent studies have suggested that the use of astrocytes in an in vitro neurotoxicity test system may prove more relevant to human CNS structure and function than neuronal cells alone. Accordingly, we have developed an HCA assay for co-culture of neurons and astrocytes, comprised of protocols and validated, target-specific detection reagents for profiling &beta;III-tubulin and glial fibrillary acidic protein (GFAP). This assay enables simultaneous analysis of neurotoxicity, neurite outgrowth, gliosis, neuronal and astrocytic morphology and neuronal and astrocytic development in a wide variety of cellular models, representing a novel, non-subjective, high-throughput assay for neurotoxicity assessment. The assay holds great potential for enhanced detection of neurotoxicity and improved productivity in neuroscience research and drug discovery.

This article describes a novel protocol and reagent set designed for sensitive measurement of neurotoxic effects of compounds and treatments on co-cultures of neurons and astrocytes using high content analysis. Results demonstrate that high content analysis represents an exciting novel technology for neurotoxicity assessment.

עצב Astrocyte שותף תרבות Assay לניתוח תכולה גבוהה של neurotoxicity

High Content Analysis (HCA) assays combine cells and detection reagents with automated imaging and powerful image analysis algorithms, allowing ...

Imaging C. elegans Embryos using an Epifluorescent Microscope and Open Source Software

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using fluorescent-labeled reporter proteins or differential interference contrast (DIC) microscopy, allows for the examination of the temporal progression of these dynamic events which is otherwise inferred from analysis of fixed samples1,2. Moreover, the study of the developmental regulations of cellular processes necessitates conducting time-lapse experiments on an intact organism during development. The Caenorhabiditis elegans embryo is light-transparent and has a rapid, invariant developmental program with a known cell lineage3, thus providing an ideal experiment model for studying questions in cell biology4,5and development6-9. C. elegans is amendable to genetic manipulation by forward genetics (based on random mutagenesis10,11) and reverse genetics to target specific genes (based on RNAi-mediated interference and targeted mutagenesis12-15). In addition, transgenic animals can be readily created to express fluorescently tagged proteins or reporters16,17. These traits combine to make it easy to identify the genetic pathways regulating fundamental cellular and developmental processes in vivo18-21. In this protocol we present methods for live imaging of C. elegans embryos using DIC optics or GFP fluorescence on a compound epifluorescent microscope. We demonstrate the ease with which readily available microscopes, typically used for fixed sample imaging, can also be applied for time-lapse analysis using open-source software to automate the imaging process.

Imaging C. elegans Embryos using an Epifluorescent Microscope and Open Source Software

The C. elegans embryo is a powerful system for studying cell biology and development. We present a protocol for live imaging of C. elegans embryos utilizing DIC optics or fluorescence using readily available epifluorescent microscopes and open-source software.

הדמיה ג elegans עוברים באמצעות מיקרוסקופ Epifluorescent ותוכנות קוד פתוח

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using ...

A High-content Imaging Workflow to Study Grb2 Signaling Complexes by Expression Cloning

Signal transduction by growth factor receptors is essential for cells to maintain proliferation and differentiation and requires tight control. Signal transduction is initiated by binding of an external ligand to a transmembrane receptor and activation of downstream signaling cascades. A key regulator of mitogenic signaling is Grb2, a modular protein composed of an internal SH2 (Src Homology 2) domain flanked by two SH3 domains that lacks enzymatic activity. Grb2 is constitutively associated with the GTPase Son-Of-Sevenless (SOS) via its N-terminal SH3 domain. The SH2 domain of Grb2 binds to growth factor receptors at phosphorylated tyrosine residues thus coupling receptor activation to the SOS-Ras-MAP kinase signaling cascade. In addition, other roles for Grb2 as a positive or negative regulator of signaling and receptor endocytosis have been described. The modular composition of Grb2 suggests that it can dock to a variety of receptors and transduce signals along a multitude of different pathways1-3.
	Described here is a simple microscopy assay that monitors recruitment of Grb2 to the plasma membrane. It is adapted from an assay that measures changes in sub-cellular localization of green-fluorescent protein (GFP)-tagged Grb2 in response to a stimulus4-6. Plasma membrane receptors that bind Grb2 such as activated Epidermal Growth Factor Receptor (EGFR) recruit GFP-Grb2 to the plasma membrane upon cDNA expression and subsequently relocate to endosomal compartments in the cell. In order to identify in vivo protein complexes of Grb2, this technique can be used to perform a genome-wide high-content screen based on changes in Grb2 sub-cellular localization. The preparation of cDNA expression clones, transfection and image acquisition are described in detail below. Compared to other genomic methods used to identify protein interaction partners, such as yeast-two-hybrid, this technique allows the visualization of protein complexes in mammalian cells at the sub-cellular site of interaction by a simple microscopy-based assay. Hence both qualitative features, such as patterns of localization can be assessed, as well as the quantitative strength of the interaction.

A high-content screening method for the identification of novel signaling competent transmembrane receptors is described. This method is amenable to large-scale automation and allows predictions about in vivo protein binding and the sub-cellular localization of protein complexes in mammalian cells.

הדמית עבודה גבוהה תוכן ללמוד Grb2 מכלולי איתות על ידי שיבוט ביטוי

Signal  transduction by growth factor receptors is essential for cells to maintain  proliferation and differentiation and requires tight control. Signal  ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

אפיון תאי גזע עוברי האנושי על ידי הפרט כמותי RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Tracking and Quantifying Developmental Processes in C. elegans Using Open-source Tools

Quantitatively capturing developmental processes is crucial to derive mechanistic models and key to identify and describe mutant phenotypes. Here protocols are presented for preparing embryos and adult C. elegans animals for short- and long-term time-lapse microscopy and methods for tracking and quantification of developmental processes. The methods presented are all based on C. elegans strains available from the Caenorhabditis Genetics Center and on open-source software that can be easily implemented in any laboratory independently of the microscopy system used. A reconstruction of a 3D cell-shape model using the modelling software IMOD, manual tracking of fluorescently-labeled subcellular structures using the multi-purpose image analysis program Endrov, and an analysis of cortical contractile flow using PIVlab (Time-Resolved Digital Particle Image Velocimetry Tool for MATLAB) are shown. It is discussed how these methods can also be deployed to quantitatively capture other developmental processes in different models, e.g., cell tracking and lineage tracing, tracking of vesicle flow.

Tracking and Quantifying Developmental Processes in C. elegans Using Open-source Tools

Here it is shown how to track and quantify developmental processes in C. elegans. The methods presented are based on open-source tools that can be easily implemented. It is demonstrated how to reconstruct 3D cell-shape models, how to manually track subcellular structures, and how to analyze cortical contractile flow.

מעקב וכימות תהליכים התפתחותיים ב<em&gt; C. elegans</em&gt; שימוש בכלי קוד פתוח

Quantitatively capturing developmental processes is crucial to derive mechanistic models and key to identify and describe mutant phenotypes. Here ...

Open Source High Content Analysis Utilizing Automated Fluorescence Lifetime Imaging Microscopy

We present an open source high content analysis instrument utilizing automated fluorescence lifetime imaging (FLIM) for assaying protein interactions using F&#246;rster resonance energy transfer (FRET) based readouts of fixed or live cells in multiwell plates. This provides a means to screen for cell signaling processes read out using intramolecular FRET biosensors or intermolecular FRET of protein interactions such as oligomerization or heterodimerization, which can be used to identify binding partners. We describe here the functionality of this automated multiwell plate FLIM instrumentation and present exemplar data from our studies of HIV Gag protein oligomerization and a time course of a FRET biosensor in live cells. A detailed description of the practical implementation is then provided with reference to a list of hardware components and a description of the open source data acquisition software written in &#181;Manager. The application of FLIMfit, an open source MATLAB-based client for the OMERO platform, to analyze arrays of multiwell plate FLIM data is also presented. The protocols for imaging fixed and live cells are outlined and a demonstration of an automated multiwell plate FLIM experiment using cells expressing fluorescent protein-based FRET constructs is presented. This is complemented by a walk-through of the data analysis for this specific FLIM FRET data set.

We present an open source high content analysis (HCA) instrument utilizing automated fluorescence lifetime imaging (FLIM) for assaying protein interactions using F&#246;rster resonance energy transfer (FRET) based readouts. Data acquisition for this openFLIM-HCA instrument is controlled by software written in &#181;Manager and data analysis is undertaken in FLIMfit.

ניתוח תוכן גבוה קוד פתוח ניצול מיקרוסקופי הדמית חי קרינה האוטומטית

We present an open source high content analysis instrument utilizing automated fluorescence lifetime imaging (FLIM) for assaying protein interactions ...

Cellular Redox Profiling Using High-content Microscopy

Reactive oxygen species (ROS) regulate essential cellular processes including gene expression, migration, differentiation and proliferation. However, excessive ROS levels induce a state of oxidative stress, which is accompanied by irreversible oxidative damage to DNA, lipids and proteins. Thus, quantification of ROS provides a direct proxy for cellular health condition. Since mitochondria are among the major cellular sources and targets of ROS, joint analysis of mitochondrial function and ROS production in the same cells is crucial for better understanding the interconnection in pathophysiological conditions. Therefore, a high-content microscopy-based strategy was developed for simultaneous quantification of intracellular ROS levels, mitochondrial membrane potential (&#916;&#936;m) and mitochondrial morphology. It is based on automated widefield fluorescence microscopy and image analysis of living adherent cells, grown in multi-well plates, and stained with the cell-permeable fluorescent reporter molecules CM-H2DCFDA (ROS) and TMRM (&#916;&#936;m and mitochondrial morphology). In contrast with fluorimetry or flow-cytometry, this strategy allows quantification of subcellular parameters at the level of the individual cell with high spatiotemporal resolution, both before and after experimental stimulation. Importantly, the image-based nature of the method allows extracting morphological parameters in addition to signal intensities. The combined feature set is used for explorative and statistical multivariate data analysis to detect differences between subpopulations, cell types and/or treatments. Here, a detailed description of the assay is provided, along with an example experiment that proves its potential for unambiguous discrimination between cellular states after chemical perturbation.

This paper presents a high-content microscopy workflow for simultaneous quantification of intracellular ROS levels, as well as mitochondrial membrane potential and morphology &#8211; jointly referred to as mitochondrial morphofunction &#8211; in living adherent cells using the cell-permeant fluorescent reporter molecules 5-(and-6)-chloromethyl-2&#39;,7&#39;-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H2DCFDA) and tetramethylrhodamine methylester (TMRM).

התאוששות נייד באמצעות פרופילים תוכן גבוהה מיקרוסקופית

Reactive oxygen species (ROS) regulate essential cellular processes including gene expression, migration, differentiation and proliferation. However, ...

Open-source Single-particle Analysis for Super-resolution Microscopy with VirusMapper

Super-resolution fluorescence microscopy is currently revolutionizing cell biology research. Its capacity to break the resolution limit of around 300 nm allows for the routine imaging of nanoscale biological complexes and processes. This increase in resolution also means that methods popular in electron microscopy, such as single-particle analysis, can readily be applied to super-resolution fluorescence microscopy. By combining this analytical approach with super-resolution optical imaging, it becomes possible to take advantage of the molecule-specific labeling capacity of fluorescence microscopy to generate structural maps of molecular elements within a metastable structure. To this end, we have developed a novel algorithm &#8212; VirusMapper &#8212; packaged as an easy-to-use, high-performance, and high-throughput ImageJ plugin. This article presents an in-depth guide to this software, showcasing its ability to uncover novel structural features in biological molecular complexes. Here, we present how to assemble compatible data and provide a step-by-step protocol on how to use this algorithm to apply single-particle analysis to super-resolution images.

This manuscript uses the Fiji-based open-source software package VirusMapper to apply single-particle analysis to super-resolution microscopy images in order to generate precise models of nanoscale structure.

ניתוח קוד פתוח Single-חלקיק למיקרוסקופיה סופר-רזולוציה עם VirusMapper

Super-resolution fluorescence microscopy is currently revolutionizing cell biology research. Its capacity to break the resolution limit of around 300 nm ...

IR-TEx: An Open Source Data Integration Tool for Big Data Transcriptomics Designed for the Malaria Vector Anopheles gambiae

IR-TEx is an application written in Shiny (an R package) that allows exploration of the expression of (as well as assigning functions to) transcripts whose expression is associated with insecticide resistance phenotypes in Anopheles gambiae mosquitoes. The application can be used online or downloaded and used locally by anyone. The local application can be modified to add new insecticide resistance datasets generated from multiple -omics platforms. This guide demonstrates how to add new datasets and handle missing data. Furthermore, IR-TEx can be completely and easily recoded to use-omics datasets from any experimental data, making it a valuable resource to many researchers. The protocol illustrates the utility of IR-TEx in identifying new insecticide resistance candidates using the the microsomal glutathione transferase, GSTMS1, as an example. This transcript is upregulated in multiple pyrethroid resistant populations from C&#244;te D&#39;Ivoire and Burkina Faso. The identification of co-correlated transcripts provides further insight into the putative roles of this gene.

IR-TEx: An Open Source Data Integration Tool for Big Data Transcriptomics Designed for the Malaria Vector Anopheles gambiae

IR-TEx explores insecticide resistance-related transcriptional profiles in the species Anopheles gambiae. Provided here are full instructions for using the application, modifications for exploring multiple transcriptomic datasets, and using the framework to build an interactive database for collections of transcriptomic data from any organism, generated in any platform.

IR-TEx: שילוב נתונים קוד פתוח כלי אינטגרציה עבור נתונים גדולים הטרנססקריפט מיועד וקטור מלריה אנופלס gambiae

IR-TEx is an application written in Shiny (an R package) that allows exploration of the expression of (as well as assigning functions to) transcripts ...

Worm-align and Worm_CP, Two Open-Source Pipelines for Straightening and Quantification of Fluorescence Image Data Obtained from Caenorhabditis elegans

An issue often encountered when acquiring image data from fixed or anesthetized C. elegans is that worms cross and cluster with their neighbors. This problem is aggravated with increasing density of worms and creates challenges for imaging and quantification. We developed a FIJI-based workflow, Worm-align, that can be used to generate single- or multi-channel montages of user-selected, straightened and aligned worms from raw image data of C. elegans. Worm-align is a simple and user-friendly workflow that does not require prior training of either the user or the analysis algorithm. Montages generated with Worm-align can aid the visual inspection of worms, their classification and representation. In addition, the output of Worm-align can be used for subsequent quantification of fluorescence intensity in single worms, either in FIJI directly, or in other image analysis software platforms. We demonstrate this by importing the Worm-align output into Worm_CP, a pipeline that uses the open-source CellProfiler software. CellProfiler&#8217;s flexibility enables the incorporation of additional modules for high-content screening.&#160;As a practical example, we have used the pipeline on two datasets: the first dataset are images of heat shock reporter worms that express green fluorescent protein (GFP) under the control of the promoter of a heat shock inducible gene hsp-70, and the second dataset are images obtained from fixed worms, stained for fat-stores with a fluorescent dye.

Worm-align and Worm_CP, Two Open-Source Pipelines for Straightening and Quantification of Fluorescence Image Data Obtained from Caenorhabditis elegans

Worm-align/Worm_CP is a simple FIJI/CellProfiler workflow that can be used to straighten and align Caenorhabditis elegans samples and to score whole-worm image-based assays without the need for prior training steps. We have applied Worm-align/Worm_CP to the quantification of&#160;heat-shock induced expression in live animals or lipid droplets&#160;in fixed samples.

ליישר תולעת Worm_CP, שני צינורות קוד פתוח ליישור וכימות של נתוני תמונה פלואורסצנטיים המתקבלים מ- Caenorhabditis elegans

An issue often encountered when acquiring image data from fixed or anesthetized C. elegans is that worms cross and cluster with their neighbors. This ...