This work has been funded in part with Federal funds from the National Institutes of Health, Office of Director, Innovator (No.: DP2OD06514) (PCS) and from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health and Human Services, under Contracts (No:HHSN272200900018C, HHSN272200900049C and U19AI110818).

הצהרה אתיקה: חולי קדחת לסה גויסו למחקר זה באמצעות הפרוטוקולים שאושרו על ידי ועדות בבני אדם ב אוניברסיטת טוליין, אוניברסיטת הרווארד, Broad Institute, בית חולים אוניברסיטאי מומחה Irrua (ISTH), בית חולים ממשלתי Kenema (KGH), אויו המדינה משרד הבריאות, Ibadan , ניגריה משרד סיירה לאונה הבריאות. כל החולים טופלו עם תקן דומה של טיפול שהוצעו התרופה Ribavirin, אם הם החליטו להשתתף במחקר. עבור קדחת לסה (LF) חולים, טיפול עם Ribavirin בעקבות ההנחיות המומלצות כיום הוצע כלל בהקדם LF היה חשד מוצק. בשל ההתפרצות החמורה עבור אבולה וירוס המחלות (EVD), חולים לא ניתן הסכימו באמצעות הפרוטוקולים הסטנדרטיים שלנו. במקום שימוש במדגמים קליניים עודף מחולים EVD הוערך ואושרה על ידי לוחות סקירה מוסדיים בסיירה ליאון באוניברסיטת הרווארד. במשרהce של סקירה אתיקה מדעית סיירה לאונה הוועדה, משרד סיירה לאונה הבריאות והתברואה, וועדת הרווארד על השימוש בבני אדם העניקו ויתור על הסכמה שממפה להעמיד לרשות רצפים ויראלי בפומבי המתקבל דגימות המטופל ומגע שנאספו במהלך התפרצות אבולה ב סיירה לאונה. גופים אלו כמובן מאליו גם שימוש בנתונים קליניים ואפידמיולוגיים, דגימות-מזוהה דה שנאספו מכל חולי EVD חשד טיפול במהלך התגובה הפרוצה. משרד סיירה לאונה הבריאות ותברואה גם אישרה משלוחי שאינם מדבקים, שאינם ביולוגיים דגימות מסיירה לאון למכון ברוד ואוניברסיטת הרווארד ללימודי הגנומי של דגימות פרוץ. 1. DNase-טיפול של RNA לדוגמא (עד 55 μl שחולצו RNA סה&quot;כ, ~ 4 שעות) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הגדר את התגובה DNase בצלחת 96-היטב PCR על הקרח בתוך ארון בטיחות ביולוגית כמתואר בטבלה 1 </strong&gt;, שלב 1.1 (הנפח הכולל, 70 μl / טוב). הערה: תערובת אמן יכולה להיות מוכנה. </li><li style=";text-align:right;direction:rtl"> וורטקס בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. </li><li style=";text-align:right;direction:rtl"> לדגור על 37 מעלות צלזיוס למשך 30 דקות. </li><li style=";text-align:right;direction:rtl"> ניקוי באמצעות RNA מוצק שלב הפיך קיבוע (SPRI) חרוזים. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> חרוזי RNA חמים RT למשך 30 דקות. </li><li style=";text-align:right;direction:rtl"> נער בעדינות RNA חרוזי בקבוק resuspend כל חלקיקים מגנטיים שייתכן התיישבו. הוספת נפח 1.8x (126 μl) של חרוזים RNA ל RNA שטופלו DNase (70 μl), ומערבבים על ידי פיפטה 10 פעמים דגירה במשך 5 דקות ב RT (הנפח הכולל גם, 196 μl). </li><li style=";text-align:right;direction:rtl"> מניחים לתערובת בתחנת מגנטי. חכה הפתרון לנקות (5 - 10 דקות). </li><li style=";text-align:right;direction:rtl"> סור פתרון פינה ואילו בתחנה ידי פיפטה וזורק. בעוד על תחנה, לשטוף חרוזים על ידי כיסוי גלול עם אתנול 70% ו דגירת דקות 1. הסר אתנול עם פיפטה וזורק. חזור עבור סכום כולל של שני שוטף. הערה: שימוש טרי 70% בדיוק et מוכןhanol הוא קריטי, כמו אחוז גבוה יותר יגרום כביסה יעילה של מולקולות קטנות יותר, ואילו &lt;70% אתנול יכול לגרום לאובדן מדגם 7. </li><li style=";text-align:right;direction:rtl"> שמור הצליחו על התחנה ולהשאיר פתוח-אוויר יבש. הערה: הקפד לאפשר חרוזים להתייבש לחלוטין עד חרוזים להתחיל לפצח. </li><li style=";text-align:right;direction:rtl"> הוסף 55 μl מים nuclease חינם לצלחת כדי elute רנ&quot;א. הסר את הצלחת מהתחנה לערבב את החרוזים ומים ידי pipetting ביסודיות. הערה: לחילופין, להשתמש פחות מים (≤ 10 μl) על מנת לרכז את RNA מוחלט. </li><li style=";text-align:right;direction:rtl"> מניחים צלחת בחזרה על התחנה. חכה עד פתרון מנקה להעביר על ידי פיפטה צינור בורג מכסה חדש עבור אחסון לטווח ארוך (-80 ° C). מניחים 5 RNA μl בניו 96-גם צלחת PCR עבור דלדול (שלב. 2.4). </li><li style=";text-align:right;direction:rtl"> אופציונלי:. שמור לדלל 1 μl ב 19 מים μl (1:20) עבור qRT-PCR של rRNA (למשל, 18S, 28S rRNA) (לוח 2) וסמנים ויראלי 5 &lt;/ Li&gt; </ol></li></ol> 2. דלדול סלקטיבי של RNA ריבוזומלי והספק ממדגם RNA ויראלי (~ 4 שעות) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הפוך הכלאה 5x ו 10x מאגרים התגובה RNase H, ו nuclease ללא מים עם הספק acrylamide ליניארית כמתואר בטבלה 1. </li><li style=";text-align:right;direction:rtl"> הגדרת התגובה הכלאה ידי שילוב RNA עם oligos דלדול rRNA (טבלה 3) ו אוליגו (DT) על קרח בצלחת 96-היטב PCR כמתואר בטבלה 1. הערה: תערובת אמן יכולה להיות מוכנה. 50 femtograms (FG) של רנ&quot;א ייחודי (ERCCs 8) ניתן להוסיף למעקב הן את תהליך רצף ויראלי זיהום צולב מדד פוטנציאל לקרוא. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> וורטקס בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. לדגור על 95 מעלות צלזיוס למשך 2 דקות, ramping האיטי עד 45 מעלות צלזיוס ב -0.1 מעלות צלזיוס לכל שניות. השהה את thermocycler על 45 מעלות צלזיוס. </li></ol></li><li style=";text-align:right;direction:rtl"> הגדרת תערובת התגובה RNase H על הקרח כמו לתארד בטבלה 1, אז מחממים על 45 מעלות צלזיוס למשך 2 דקות. הערה: תערובת אמן יכולה להיות מוכנה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מוסיף את התערובת המחוממת מראש RNase H תגובת ההכלאה בצלחת תוך שמירה על צלחת thermocycler ב 45 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> מערבבים היטב על ידי pipetting עדין 6 - 8 פעמים. לדגור על 45 מעלות צלזיוס במשך 30 דקות אחרות. מניחים על קרח. </li></ol></li><li style=";text-align:right;direction:rtl"> הגדר את תערובת התגובה DNase על הקרח כמתואר בטבלה 1 הערה:. תערובת אמן יכול להיות מוכן. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוסף את התגובה H RNase בצלחת, מערבולת בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. לדגור על 37 מעלות צלזיוס למשך 30 דקות. </li><li style=";text-align:right;direction:rtl"> בקצות DNase ידי הוספת 5 μl 0.5 M EDTA. וורטקס בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. </li></ol></li><li style=";text-align:right;direction:rtl"> ניקוי באמצעות חרוזים RNA (ראה שלב 1.3) באמצעות נפח 1.8x (144 μl) חרוזים. Elute ב 11 μl של מים nuclease חינם. הערה: בקירור בטוח, חנות מדולדלת RNדגימה ב -80 ° C O / N. </li></ol> 3. סינתזה cDNA (~ 6 שעות) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מערבבים rRNA / RNA מדולדל המוביל עם פריימרים אקראיים על קרח בצלחת 96-היטב PCR כמתואר בטבלה 1, מערבולת בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מחממים את התערובת עד 70 מעלות צלזיוס למשך 10 דקות ב thermocycler. מיד לאחר denaturation חום, למקם את הרנ&quot;א על ​​קרח 1 - 5 דקות. אל תאפשרו RNA לעמוד (אפילו על הקרח) למשך זמן ארוך יותר מ -5 דקות לפני התגובה הראשונה גדיל. </li></ol></li><li style=";text-align:right;direction:rtl"> הגדרת גדיל הראשונה תערובת התגובה סינתזה על הקרח כמתואר בטבלה 1. הערה: לערבב מנהל עשוי להיות מוכן. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוסף RNA / תערובת פריימר אקראית בצלחת, מערבולת בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. לדגור על 22 - C ° 25 במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> לדגור על 55 מעלות צלזיוס באינקובטור באוויר במשך 60 דקות. מניחים את הצלחת על הקרח כדי לסיים את התגובה. לֹאדואר: השימוש באינקובטור אוויר מומלץ ליצור התחממות הדרגתית של התגובה הראשונה גדיל שבמהלכו לחשל פריימרים ואת הגדיל הראשון מתחיל להאריך. </li></ol></li><li style=";text-align:right;direction:rtl"> הגדרת תערובת תגובת הסינתזה שניית גדיל על קרח כמתואר בטבלה 1. הערה: לערבב מנהל עשוי להיות מוכן. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוסף סינתזת התגובה הראשונה גדיל בצלחת, מערבולת בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. דגירה עבור שעה 2 ב 16 ° C (לשמור מכסה של 25 מעלות צלזיוס). אל תאפשר לטמפרטורה לעלות מעל 16 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> מניחים את הצלחת על הקרח, אז להשבית התגובה על ידי הוספת 5 μl של 0.5 EDTA M, ומערבבים בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. </li></ol></li><li style=";text-align:right;direction:rtl"> ניקוי עם חרוזים DNA (ראה שלב 1.3 עבור פרוטוקול) באמצעות נפח 1.8x (153 μl) של חרוזים. Elute ב 9 μl של חיץ elution (EB). שמור 1 μl כימות. השתמש 1 ננוגרם של cDNA עבור subsequeצעדי NT. אם ריכוז cDNA הוא נמוך מדי כדי לזהות, השתמש 4 μl של cDNA עבור tagmentation (ראה שלב 4.1). </li><li style=";text-align:right;direction:rtl"> לקבלת בקירור בטוח, לאחסן פעמיים תקועים cDNA ב 4 ° CO / N או -20 ° C עבור אחסון לטווח ארוך. </li></ol> 4. הכנת הספרייה - בניית ספריית DNA (~ 4 שעות) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> העברת 4 μl של cDNA לצלחת 96-היטב ולשמור את cDNA הנותר עבור ניסיון שני במידת הצורך. </li><li style=";text-align:right;direction:rtl"> הגדר את התגובה tagmentation על הקרח כמתואר בטבלה 1. הערה: לערבב מנהל עשוי להיות מוכן. כדי להפחית את הרקע ואת העלות הכוללת, את הנפח הכולל של התגובה tagmentation מצטמצם מ -20 ל -10 μl. כפי cDNA הוא הגורם המגביל, בסך של ATM (כלומר, transposome) המשמש התגובה מצטמצם גם כדי להקטין את מספר אתרי אינטגרציה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להוסיף תערובת tagmentation כדי cDNA בצלחת, מערבולת בעדינות וביסודיות צנטריפוגות ב 280 XG (ב RT) עבור 1 דקות.לדגור על 55 מעלות צלזיוס למשך 5 דקות, להחזיק ב 10 ° C. </li><li style=";text-align:right;direction:rtl"> פעם ב 10 ° C, מיד להוסיף 2.5 μl של לנטרל Tagment הצפת (NT) לסיים את התגובה. מערבבים על ידי pipetting למעלה ולמטה, ואז צנטריפוגות ב 280 XG (ב RT) עבור 1 דקות. </li><li style=";text-align:right;direction:rtl"> לדגור על RT במשך 5 דקות. </li></ol></li><li style=";text-align:right;direction:rtl"> הגדרת תגובת הגברת PCR על קרח כמתואר בטבלה 1. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> וורטקס בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. </li><li style=";text-align:right;direction:rtl"> בצע PCR על thermocycler באמצעות בתנאים המתוארים בטבלה 1. הערה: 12 מחזורים של PCR הם הציעו עבור 1 ננוגרם של cDNA tagmented; עם זאת, דגימות קליניות ויראלי לעתים קרובות יש כמויות בלתי מורגשות של cDNA. עבור סכומים נמוכים של cDNA (&lt;1 נ&quot;ג), השתמש עד 18 מחזורים של PCR כדי ליצור ספריית מספיק עבור סידור. </li></ol></li><li style=";text-align:right;direction:rtl"> ניקוי ואיגום עבור סידור - הכנה הספרייה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תביא דגימה של עד 50 μl עם EB. </li><li style=";text-align:right;direction:rtl"> ניקוי עםחרוזי DNA (ראה שלב 1.3 עבור פרוטוקול) באמצעות נפח 0.6x חרוזים (30 μl). Elute ב 15 μl EB. </li><li style=";text-align:right;direction:rtl"> קביעת ריכוז של הספרייה (איור 3) על ידי ביצוע ניתוח באזור (150 עד 1,000 נ&quot;ב) באמצעות bioanalyzer התוכנה 9, למעט הדימרים פריימר (~ 120 נ&quot;ב) מניתוח באזור. הערה: לחילופין, qPCR יכול לשמש כדי לכמת ספריות 10. </li><li style=";text-align:right;direction:rtl"> ספריות ברכה בריכוז הטוחן הנמוך ביותר של 1 ננומטר או יותר. אם ספרייה היא מתחת ל -1 ננומטר, להוסיף נפח קטן של ספריית ברכה (~ נפח 1x של ספריות אחרות) כדי ללכוד מידע רצף מספריות אלה. </li><li style=";text-align:right;direction:rtl"> ניקוי בריכה עם חרוזים DNA 0.7x כפי שתואר לעיל (ראה שלב 2). Elute ב 15 μl EB. הערה: נפח של חרוזים יהיה תלוי בנפח הסופי של הברכה. </li><li style=";text-align:right;direction:rtl"> לנתח ברכה 9. קביעת ריכוז טוחנת ידי ביצוע ניתוח באזור (150 עד 1,000 נ&quot;ב) 9. הערה: לחילופין, qPCR יכול לשמש כדי לכמת בריכת הספרייה 10 &lt;/ Sup&gt;. </li><li style=";text-align:right;direction:rtl"> ברצף טען בריכוז הספרייה 10 בערב עד לייצר 101 נ&quot;ב, לזווג סוף קורא עם ברקוד כפול קורא 11. </li></ol></li></ol><img alt="איור 3" src="/files/ftp_upload/54117/54117fig3.jpg" /> איור 3. נבנו ספריות ממדגמים קליניים וירוס האבולה. תמונה ג&#39;ל של 4 וירוס האבולה יציג ספריות (EBOV). אזורים של הדימרים ספרייה פריימר מוצגים. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

<ol>
	<li>Stremlau, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+novel+rhabdoviruses+in+the+blood+of+healthy+individuals+from+West+Africa.">Discovery of novel rhabdoviruses in the blood of healthy individuals from West Africa.</a> PLoS Negl Trop Dis. 9, e0003631 (2015).</li><li>Gire, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+surveillance+elucidates+Ebola+virus+origin+and+transmission+during+the+2014+outbreak.">Genomic surveillance elucidates Ebola virus origin and transmission during the 2014 outbreak.</a> Science. 345, 1369-1372 (2014).</li><li>Morlan, J. D., Qu, K., Sinicropi, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+depletion+of+rRNA+enables+whole+transcriptome+profiling+of+archival+fixed+tissue.">Selective depletion of rRNA enables whole transcriptome profiling of archival fixed tissue.</a> PLoS One. 7, e42882 (2012).</li><li>Park, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ebola+Virus+Epidemiology,+Transmission,+and+Evolution+during+Seven+Months+in+Sierra+Leone.">Ebola Virus Epidemiology, Transmission, and Evolution during Seven Months in Sierra Leone.</a> Cell. 161, 1516-1526 (2015).</li><li>Andersen, K. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+Sequencing+Uncovers+Origins+and+Evolution+of+Lassa+Virus.">Clinical Sequencing Uncovers Origins and Evolution of Lassa Virus.</a> Cell. 162, 738-750 (2015).</li><li>Matranga, C. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+methods+for+unbiased+deep+sequencing+of+Lassa+and+Ebola+RNA+viruses+from+clinical+and+biological+samples.">Enhanced methods for unbiased deep sequencing of Lassa and Ebola RNA viruses from clinical and biological samples.</a> Genome Biol. 15, 519 (2014).</li><li>Tang, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Seq+analysis+to+capture+the+transcriptome+landscape+of+a+single+cell.">RNA-Seq analysis to capture the transcriptome landscape of a single cell.</a> Nat Protoc. 5, 516-535 (2010).</li><li>Jiang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+spike-in+standards+for+RNA-seq+experiments.">Synthetic spike-in standards for RNA-seq experiments.</a> Genome Res. 21, 1543-1551 (2011).</li><li>. Kapa Biosystems Available from: <a target="_blank" href="https://www.kapabiosystems.com/product-applications/products/next-generation-sequencing-2/library-quantification/">https://www.kapabiosystems.com/product-applications/products/next-generation-sequencing-2/library-quantification/</a> (2015)</li><li>. Illumina Technologies Available from: <a target="_blank" href="https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/preparing-libraries-for-sequencing-on-miseq-15039740-d.pdf">https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/preparing-libraries-for-sequencing-on-miseq-15039740-d.pdf</a> (2015)</li><li>Kircher, M., Sawyer, S., Meyer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double+indexing+overcomes+inaccuracies+in+multiplex+sequencing+on+the+Illumina+platform.">Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform.</a> Nucleic Acids Res. 40, 3 (2012).</li><li>Trombley, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+panel+of+real-time+TaqMan+polymerase+chain+reaction+assays+for+detection+and+absolute+quantification+of+filoviruses,+arenaviruses,+and+New+World+hantaviruses.">Comprehensive panel of real-time TaqMan polymerase chain reaction assays for detection and absolute quantification of filoviruses, arenaviruses, and New World hantaviruses.</a> Am J Trop Med Hyg. 82, 954-960 (2010).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serial+high-resolution+analysis+of+blood+virome+and+host+cytokines+expression+profile+of+a+patient+with+fatal+H7N9+infection+by+massively+parallel+RNA+sequencing.">Serial high-resolution analysis of blood virome and host cytokines expression profile of a patient with fatal H7N9 infection by massively parallel RNA sequencing.</a> Clin Microbiol Infect. 21, 713 (2015).</li><li>Simon-Loriere, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lineages+of+Ebola+virus+in+Guinea+during+the+2014+West+African+epidemic.">Distinct lineages of Ebola virus in Guinea during the 2014 West African epidemic.</a> Nature. 524, 102-104 (2015).</li><li>Folarin, O. A., Happi, A. N., Happi, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empowering+African+genomics+for+infectious+disease+control.">Empowering African genomics for infectious disease control.</a> Genome Biol. 15, 515 (2014).</li><li>Blainey, P. C., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+MDA+for+enumeration+of+total+nucleic+acid+contamination.">Digital MDA for enumeration of total nucleic acid contamination.</a> Nucleic Acids Res. 39, 19 (2011).</li><li>Malboeuf, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+viral+RNA+genome+sequencing+of+ultra-low+copy+samples+by+sequence-independent+amplification.">Complete viral RNA genome sequencing of ultra-low copy samples by sequence-independent amplification.</a> Nucleic Acids Res. 41, 13 (2013).</li><li>Gonzalez, I. L., Sylvester, J. E., Smith, T. F., Stambolian, D., Schmickel, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosomal+RNA+gene+sequences+and+hominoid+phylogeny.">Ribosomal RNA gene sequences and hominoid phylogeny.</a> Mol Biol Evol. 7, 203-219 (1990).</li><li>Adiconis, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+RNA+sequencing+methods+for+degraded+or+low-input+samples.">Comparative analysis of RNA sequencing methods for degraded or low-input samples.</a> Nat Methods. 10, 623-629 (2013).</li></ol>

The authors have no competing financial interests.

שהגישה המתוארת מאפשרת חזק, אוניוורסלי, רצף מהיר שמשה רצף נגיף האבולה במהלך 2,4 פרוץ 2014. על ידי צימוד דלדול סלקטיבית סינתזת cDNA עם בניית ספריית tagmentation, הפעם התהליך הכולל הופחת על ידי ~ 2 ימי משיטות קשירת מתאם קודמות. לאחרונה, פרוטוקול זה הועסק על ידי משתפי פעולה בינלאומיים ואחרים בהצלחה רבה 15,16 ו ייפרס מעבדות במערב אפריקה לתמוך מחקרים מבוססי הגנומיקה מקומיים ואבחון 17. הפרוטוקול המתואר כאן משתמש פריימרים אקראיים להכין cDNA עבור ספריות RNA-seq ויראלי. שלא כמו גישות RNA-seq ויראלי קודמות, זה לא דורש ידע אפריורי של נתוני רצף או משוכלל ונדרש זמן רב עיצוב פריימר עבור וירוס או clade ספציפי. השיטה יכולה להיות מיושמת על כל מדגם רנ&quot;א נגיפי. לדוגמה, שימש אותו כדי ליצור תוכן ויראלי משני אבולהו לסה דגימות 6. הפרוטוקול יכול לשמש גם עבור transcriptomic מארח, פרויקטי רצף metagenomic ו הפתוגן גילוי 1. שלב קריטי של הפרוטוקול הוא ממוקד עיכול H RNase, א-תפוקה גבוהה, שיטת עלות נמוכה להסרת ספק רצוי ו- RNA מארח ממדגם ויראלי. צעד הדלדול סלקטיבית של הפרוטוקול עושה שימוש מרכיבים רבים ודורש מיומנות ודיוק. זמן טיפול נוסף יש לנקוט במהלך ההתקנה הראשונית. כמו רוב דגימות סרום ופלזמה קליניות לעתים קרובות יש מעט מאוד חומר חומצות גרעין, זיהום ואובדן מדגם נפוץ. כדי למנוע בעיות אלה, טיפול מיוחד יש לנקוט בעת שימוש בפרוטוקול זה. ראשית, RNA הוא מאוד רגיש שפל; ולכן בכל התחומים צריכים להיות נקיים של nucleases. שנית, לזהות דגימות מתאימות לשימוש בפרוטוקול זה, מבחני qRT-PCR עבור שניהם RNA מארח הווירוס אמורים לשמש עבור כימות 5,6 </sup&gt;. בהשוואת קלט מסתכמת עם תוצאות רצף מן הפרוטוקול, הצלחת רצף (כלומר, דור נתונים המספיקים להרכבת ויראלי מלאה) בקורלציה עם דגימות שהכילו לפחות 100 pg RNA סך 1,000 עותקים של נגיף. יש להימנע מחשיפה שלישית, מקורות סביבתיים של חומצות גרעין. הפרוטוקול המתואר כאן נעשה בתוך ארון בטיחות ביולוג הוראות בטיחות להגבלת מזהמים סביבתיים. יתר על כן, הקבוצה ואחרים שלנו הבחינו כי אנזימים מסחריים עשויים להיות מקור נוסף של זיהום חיידקי חומצות גרעין בדגימות קלט נמוך 6,18. שימוש סביבת עבודה נקיה (למשל, מכסה מנוע PCR, ארון בטיחות ביולוגי) ובקרות שליליות (למשל, מים או חיץ) יעזרו להקל ולעקוב אחר זיהום, בהתאמה. לקבלת דוגמיות עם &lt;100 pg של רנ&quot;א הכל, רק פולי RNA המוביל (RA), לא rRNA, צריך להיות מדולדל על מנת להבטיח תוצאות רצף באיכות גבוהה תוך הגבלת הפסד של החומר. לקבלת מאודדגימות קלט נמוכות, שיטות הגברת cDNA יכולות להיות יותר מתאימות 19, למרות פולי (ע&quot;ר) מנשא להסירו לפני סינתזת cDNA. דלדול של המארח rRNA מעשירה עבור תוכן ויראלי בספריות רצף שלכם והיא חלה על אוספים דגימה שונים כולל סרום או פלזמה, וסוגים שונים של רקמות מן מכרסמים פרימטים לא אנושיים 5,6. באורגניזמים שאינם בני אדם, קריאות יישור כדי 28S rRNA שנותר לאחר דלדול, דבר המצביע 28S rRNA הוא פחות משומר בין בני האדם ומינים אחרים 6,20. בעת השימוש בשיטה זו עם בידודים שאינם בני אדם, זה עשוי להיות נחוץ כדי להשלים עם oligos DNA משלים רצפי rRNA מסתעפים של 3,21 המארח הספציפי. מאז הפרוטוקול הוא משוחד, ויראלי קורא עשוי לייצג רק חלק קטן של תוכן הספריה. למרות rRNA הוא המין הנפוץ ביותר של רנ&quot;א מארח ורק אחוז קטן של rRNA קורא (0; 1%) נמצאים לאחר דלדול סלקטיבית, כל RNA המארח האחר (למשל, mRNA) יישאר לאחר הדלדול עשוי להסביר רצף רב קורא מן המדגם. לכן &quot;oversampling&quot; (כלומר, oversequencing) ספריות פרט נדרשה על מנת לקבל כיסוי מספיק לשיחות הרכבת גרסת ויראלי. עבור מחקרים שלנו, אנו מנסים רצף ~ 20 מיליון קורא לדגימה יש מספיק עומק לניתוח של וריאנטים גנומי הקשורים ויראלי וכן תכנים metagenomic 2,5. עבור מחקרים גילוי metagenomic ו הפתוגן, חשוב לציין כי זיהום DNA המארח הוא הוסר על ידי מערכת העיכול DNase. לכן נגיפים ופתוגנים אחרים המכילים הגנום DNA עלולים ללכת לאיבוד בתהליך, אולם ביניים RNA עשויים עדיין להיות רצף.

רצף הדור הבא של וירוסים ממקורות קליניים יכול להודיע ​​הולכת האפידמיולוגיה של זיהומים, כמו גם רומן תמיכת עזרת אבחון, חיסון ופיתוח טיפולי. סינתזה cDNA באמצעות פריימרים אקראיים אפשרה זיהוי והרכבה של הגנום מ-מדביק שיתוף מסתעף, או אפילו וירוסים רומן 1,2. כמו שיטות משוחדות אחרות, מזהמים לא רצויים לכבוש רצף רב קורא על תוצאותיהן רצף שלילי. מארח פולי RNA המוביל (ע&quot;ר) הם מזהמים באוספי מדגם ויראלי רבים קיימים. הפרוטוקול מתאר דרך יעילה וחסכונית של הגנום וירוס RNA רצף עמוק מבוסס על-seq רנ&quot;א הכל משוחדת. השיטה משתמשת צעד דלדול סלקטיבית RNase H 3 להסיר ריבוזומלי מארח רצוי ו- RNA המוביל. דלדול סלקטיבי מעשיר עבור תוכן ויראלי (איור 1) ומשפר את האיכות הכוללת של נתוני רצף(איור 2) מדגים קליני. יתר על כן, tagmentation מוחל על הפרוטוקול כמו שהיא מפחיתה באופן משמעותי את זמן בניית ספרייה. שיטות אלו שימשו להפקת מערכי נתונים גדולים במהירות של הגנום וירוס אבולה לסה 2,4,5 וניתן להשתמש בו כדי ללמוד מגוון רחב של וירוסים RNA. לבסוף, הגישה אינה מוגבלת דגימות אנושיות; השירות של דלדול סלקטיבית הודגם על דגימות רקמה שנאספו מכרסמים נגועים לסה ומודלי מחל הפרימטים לא אנושי 5,6. <img alt="איור 1" src="/files/ftp_upload/54117/54117fig1.jpg" /> תוכן איור 1. סך RNA משקף העשרת תוכן וירוס לסה שימוש סלקטיבי אזילה. החל תוכן הכולל (קלט RNA) והעשרה של נגיף לסה ייחודי (LASV) קורא (תוכן הספריה) על דלדול rRNA מתשע מבודד קליניים שונים. נתון זה יש הבדל בין תמונה 6 <em&gt;. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/54117/54117fig2.jpg" /> איור 2. איכות גבוהה יותר רצף לאחר Carrier RNA אזילה. איכויות בסיס חציון מחזור רצף של פולי (ע&quot;ר) -contaminated נגיף לסה ספריות (אדום) ובקרה (לא מוביל נצפה בספרייה, שחור) מדווח QC 13. שניהם לקרוא 1 ולקרוא 2 של סוף לזווג קורא ימוזגו בקובץ BAM הספרייה ואת ציוני איכות מוצגים בכל הבסיס. נתון זה יש הבדל בין 6. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> בניית פרטי פרוטוקול RNA-seq ויראלי של ספריות ישירות חילוץRNA שנאסף דגימות קליניות וביולוגיות. כדי להבטיח ביטחונם אישי, כל בסרום ויראלי, דגימות הפלזמה ורקמות צריכות להיות מובטלות מאגרים מתאימים לפני מיצוי RNA. בחלק ערכות איון והפקה, פולי מוביל (ע&quot;ר) RNA כלול; זו תוסר במהלך שלב דלדול סלקטיבית הראשוני RNase H. בהתבסס על התאוששות מלאה, הריכוז הצפוי של RNA המוביל הוא 100 ng / μl. בפרוטוקול, 110 ng / אוליגו μl RNA dT (ריכוז המוביל 1.1x) משמש דלדול. אם פולי (ע&quot;ר) ספק אינו נוכחי במדגם, אז אוליגו (DT) לא צריך להתווסף לפני הדלדול. הפרוטוקול הבא מיועד 24 תגובות בפורמט צלחת PCR (עד 250 נפח μl). גרסה קודמת של פרוטוקול כך מדווחת Matranga, et al. 6.

<table border="0" cellpadding="0" cellspacing="0" width="965">
	<tbody>
		<tr height="30">
			<td height="30" style="height:31px;width:376px;">96-Well PCR Plates</td>
			<td style="width:183px;">VWR</td>
			<td style="width:119px;">47743-953</td>
			<td style="width:289px;"></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Strips of Eight Caps</td>
			<td>VWR</td>
			<td>47745-512</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Nuclease-free water</td>
			<td>Ambion</td>
			<td>AM9937</td>
			<td>50 ml bottle</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">TURBO DNase&#160;</td>
			<td>Ambion</td>
			<td>AM2238</td>
			<td>post RNA extraction step, 2 U/&#181;L, buffer included</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">PCR cycler</td>
			<td></td>
			<td></td>
			<td>any PCR cyclers&#160;</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Agencourt RNAClean XP SPRI beads&#160;</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63987</td>
			<td>beads for RNA cleanup</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Real Time qPCR system</td>
			<td></td>
			<td></td>
			<td>any system</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">DynaMag-96 Side Skirted Magnet</td>
			<td>Invitrogen</td>
			<td>12027</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">70% Ethanol</td>
			<td></td>
			<td></td>
			<td>prepare fresh</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">qRT-PCR primers</td>
			<td>IDT DNA</td>
			<td></td>
			<td>see Table 2</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">5M NaCl&#160;</td>
			<td>Ambion</td>
			<td>AM9760G</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">1M Tris-HCl pH 7.4&#160;</td>
			<td>Sigma</td>
			<td>T2663-1L</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">1M Tris-HCl pH 7.5&#160;</td>
			<td>Invitrogen</td>
			<td>15567-027</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">1M MgCl2&#160;</td>
			<td>Ambion</td>
			<td>AM9530G</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Linear acrylamide&#160;</td>
			<td>Ambion&#160;</td>
			<td>AM9520</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">DNA oligos covering entire rRNA region</td>
			<td>IDT DNA</td>
			<td></td>
			<td>see Table 3, order lab-ready at 100 &#181;M</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Oligo (dT)</td>
			<td>IDT DNA</td>
			<td></td>
			<td>40 nt long, desalted</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Hybridase Thermostable RNase H&#160;</td>
			<td>Epicentre</td>
			<td>H39100</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">RNase-free DNase Kit&#160;</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td>post selective depletion step</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">SUPERase-In RNase Inhibitor</td>
			<td>Ambion</td>
			<td>AM2694</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Random Primers&#160;</td>
			<td>Invitrogen</td>
			<td>48190-011</td>
			<td>mostly hexamers</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">10 mM dNTP mix</td>
			<td>New England Biolabs</td>
			<td>N0447L</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">SuperScript III Reverse Transcriptase&#160;</td>
			<td>Invitrogen</td>
			<td>18080-093</td>
			<td>with first-strand buffer, DTT</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Air Incubator</td>
			<td></td>
			<td></td>
			<td>any air incubator cyclers&#160;</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">NEBNext Second Strand Synthesis (dNTP-free) Reaction Buffer</td>
			<td>New England Biolabs</td>
			<td>B6117S</td>
			<td>10x</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">E. coli DNA Ligase&#160;</td>
			<td>New England Biolabs</td>
			<td>M0205L</td>
			<td>10 U/&#956;l</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">E. coli DNA Polymerase I&#160;</td>
			<td>New England Biolabs</td>
			<td>M0209L</td>
			<td>10 U/&#956;l</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">E. coli RNase H&#160;</td>
			<td>New England Biolabs</td>
			<td>M0297L</td>
			<td>2 U/&#956;l</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">0.5M EDTA</td>
			<td>Ambion</td>
			<td>AM9261</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Agencourt AMPure XP SPRI beads</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63881</td>
			<td>beads for DNA cleanup</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Elution Buffer&#160;</td>
			<td>Qiagen</td>
			<td></td>
			<td>10 mM Tris HCl, pH 8.5</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Quant-iT dsDNA HS Assay Kit&#160;</td>
			<td>Invitrogen</td>
			<td>Q32854</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Qubit fluorometer&#160;</td>
			<td>Invitrogen</td>
			<td>Q32857</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Nextera XT DNA Sample Prep Kit&#160;</td>
			<td>Illumina</td>
			<td>FC-131-1096</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Nextera XT DNA Index Kit&#160;</td>
			<td>Illumina</td>
			<td>FC-131-1001</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Tapestation 2200</td>
			<td>Agilent</td>
			<td>G2965AA</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">High Sensitivity D1000 reagents</td>
			<td>Agilent</td>
			<td>5067-5585</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">High Sensitivity D1000 ScreenTape</td>
			<td>Agilent</td>
			<td>5067-5584</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">BioAnalyzer 2100&#160;</td>
			<td>Agilent</td>
			<td>G2939AA</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">High Sensitivity DNA reagents</td>
			<td>Agilent</td>
			<td>5067-4626</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Library Quantification Complete kit (Universal)</td>
			<td>Kapa Biosystems</td>
			<td>KK4824</td>
			<td>alternative to tapestation, bioanalyzer for library quantification</td>
		</tr>
	</tbody>
</table>

unbiased deep sequencing of rna viruses from clinical samples

כאן אנו מתארים פרוטוקול רצף RNA הדור הבא המאפשר דה נובו אסיפות ושיחות גרסת תוך שורה של הגנום נגיפי שנאסף ממקורות קליניים וביולוגיים. השיטה היא משוחדת ואוניברסלית; היא משתמשת פריימרים אקראיים לסינתזת cDNA ואינה דורשת ידע מוקדם של תוכן רצף ויראלי. לפני בניית ספרייה, סלקטיבית RNase H מבוסס עיכול משמש כדי לרוקן RNA רצוי - כולל פולים (ע&quot;ר) מוביל ו- RNA ריבוזומלי - מן מדגם RNA ויראלי. דלדול סלקטיבי משפר הן את איכות הנתונים ומספר ייחודי קורא בספריות רצף RNA ויראלי. יתר על כן, הצעד מבוסס transposase &#39;tagmentation&#39; משמש בפרוטוקול כפי שהוא מקטין את זמן בניית ספרייה הכולל. הפרוטוקול אפשר רצף עמוק מהיר של מעל 600 לסה דגימות-כולל נגיף האבולה אוסף משני דם ורקמות מבודדות-והוא החלים רחב ללימודים הגנומיקה חיידקים אחרים.

הפרוטוקול המתואר מאפשר את הדור של רצף באיכות גבוהה קורא ממדגם רנ&quot;א נגיפיים נמוך קלט תוך העשרת תוכן ויראלי ייחודי. כפי שניתן לראות בתרשים 1, הפרוטוקול מועשר תוכן לסה וירוס ייחודי לפחות פי חמש בכל הדגימות (בהשוואה לקבוצת ביקורת הלא-מדולדל) עם לפחות ממיליון עותקים של 18S rRNA (~ 100 pg RNA סה&quot;כ). כמו כן, הצלחת רצף מתואמת גם עם כמות הנגיף בתוך מדגם נתון. שימוש qRT-PCR כתחליף כמות ויראלי, דגימות שהכילו ~ 1,000 או יותר עותקים הגנום נגיפיים לרוב נוצרו מכלולים מלאים (מידע לא מוצג). יתר על כן, דלדול של פולי (ע&quot;ר) מוביל מפחית רצפי homopolymer של A ו- T בספריות, וכתוצאה מכך הכנות מנקות והבטחת רצף באיכות טובה יותר קוראת (איור 2). ספריות סופיות ממדגמים קליניים ויראלי קלט נמוך בדרך כלל יש אורך קטע רחב בין 150 ל -1,000 נקודות בסיס(איור 3). לאחר רצף, כדי להפחית מדגם מזיהוי שגוי ו crosstalk בין ספריות בתוך ברכה 12, רק מדד קורא עם ציון איכות בסיס של 25 (שאלה 25) ולהבטיח אפס התאמות נשמרות בתהליך demultiplexing. הגנום נגיפי מורכב באמצעות צינור ביואינפורמטיקה ספציפי לאיתור וירוסים מסתעפים 2,4-6. כלים אלה זמינים ב https://github.com/broadinstitute/viral-ngs או באמצעות פלטפורמות ענן מסחריות 4. <table border="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שלב 1.1: תגובת DNase </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח לכל תגובה (μl) </td></tr><tr><td> חיץ 10x DNase </td><td> 7 </td></tr><tr><td> nuclease ללא מים </td><td> 6 </td></tr><tr><td> רנ&quot;א נגיפי שחולצו </td><td> 55 </td></tr><tr><td> DNase (2 U / &amp; #181; l) </td><td> 2 </td></tr><tr><td> נפח כולל </td><td> 70 </td></tr><tr><td> שלב 2.1: חיץ הכלאה 5x </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח עבור 1 מ&quot;ל (μl) </td></tr><tr><td> 5 M NaCl </td><td> 200 </td></tr><tr><td> 1 M טריס- HCl (pH 7.4) </td><td> 500 </td></tr><tr><td> nuclease ללא מים </td><td> 300 </td></tr><tr><td> נפח כולל </td><td> 1,000 </td></tr><tr><td> שלב 2.1: 10x RNase H התגובה חיץ </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח עבור 1 מ&quot;ל (μl) </td></tr><tr><td> 5 M NaCl </td><td> 200 </td></tr><tr><td> 1 M טריס- HCl (pH 7.5) </td><td> 500 </td></tr><tr><td> 1 M MgCl 2 </td><td> 200 </td></tr><tr><td> nuclease ללא מים </td><td> 500 </td></tr><tr><td> נפח כולל </td><td> 1,000 </td></tr><tr><td> שלב 2.1: מי wacrylamide ליניארי ה- i </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח עבור 1 מ&quot;ל חיץ (μl) </td></tr><tr><td> nuclease ללא מים </td><td> 992 </td></tr><tr><td> acrylamide ליניארית (5 מ&quot;ג / מ&quot;ל) </td><td> 8 </td></tr><tr><td> נפח כולל </td><td> 1,000 </td></tr><tr><td colspan="2"> שלב 2.2: תגובת הכלאת דלדול סלקטיבית </td></tr><tr><td> מֵגִיב </td><td> נפח לכל תגובה (μl) </td></tr><tr><td> מאגר הכלאה 5x </td><td> 2 </td></tr><tr><td> rRNA-דלדול תמהיל אוליגו (100 מיקרומטר) </td><td> 1.22 </td></tr><tr><td> אוליגו (ד) T (550 ng / μl) </td><td> 1 </td></tr><tr><td> שטופלו DNase רנ&quot;א הכל </td><td> עד 5 </td></tr><tr><td> ספייק-ב RNA (זה הוא אופציונלי) </td><td> 0.5 </td></tr><tr><td> מים (עם acrylamide ליניארי) </td><td> להביא עד 10 סה&quot;כ </td></tr><tr><td> volu סה&quot;כלִי </td><td> 10 </td></tr><tr><td colspan="2"> שלב 2.3: תגובת H RNase דלדול סלקטיבית </td></tr><tr><td> מֵגִיב </td><td> נפח לכל תגובה (μl) </td></tr><tr><td> מאגר התגובה 10x RNase H </td><td> 2 </td></tr><tr><td> מים (עם acrylamide ליניארי) </td><td> 5 </td></tr><tr><td> RNase H Thermostable (5 U / μl) </td><td> 3 </td></tr><tr><td> נפח כולל </td><td> 10 </td></tr><tr><td colspan="2"> שלב 2.4: דלדול סלקטיבית פוסט התגובה DNase </td></tr><tr><td> מֵגִיב </td><td> נפח לכל תגובה (μl) </td></tr><tr><td> 10x DNase הצפה </td><td> 7.5 </td></tr><tr><td> מים (עם acrylamide ליניארי) </td><td> 44.5 </td></tr><tr><td> מעכב RNase (20 U / μl) </td><td> 1 </td></tr><tr><td> RNase ללא DNase אני (2.72 U / μl) </td><td> 2 </td></tr&gt; <tr><td> נפח כולל (עם תגובת RNase H) </td><td> 75 </td></tr><tr><td colspan="2"> שלב 3.1: סינתזת cDNA, כלאה פריימר אקראי </td></tr><tr><td> מֵגִיב </td><td> נפח לכל תגובה (μl) </td></tr><tr><td> rRNA / מדולדל המוביל RNA </td><td> 10 </td></tr><tr><td> 3 מיקרוגרם פריימר אקראי </td><td> 1 </td></tr><tr><td> נפח כולל </td><td> 11 </td></tr><tr><td> שלב 3.2: סינתזת תגובת cDNA גדיל הראשון </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח (μl) </td></tr><tr><td> מאגר התגובה 5x ראשון סטרנד </td><td> 4 </td></tr><tr><td> 0.1 M DTT </td><td> 2 </td></tr><tr><td> לערבב 10 מ&quot;מ dNTP </td><td> 1 </td></tr><tr><td> מעכב RNase (20 U / μl) </td><td> 1 </td></tr><tr><td> טרנסקריפטאז הפוך (להוסיף אחרון) </td><td> 1 </td></tr><tr><td> נפח כולל (עם RNA לעיל) &lt;/ Td&gt; <td> 20 </td></tr><tr><td colspan="2"> שלב 3.3: סינתזת התגובה cDNA גדיל שנית </td></tr><tr><td> מֵגִיב </td><td> נפח (μl) </td></tr><tr><td> RNase ללא מים </td><td> 43 </td></tr><tr><td> 10x הצפת התגובה השנייה סטרנד </td><td> 8 </td></tr><tr><td> לערבב 10 מ&quot;מ dNTP </td><td> 3 </td></tr><tr><td> E. coli DNA האנזים (10 U / μl) </td><td> 1 </td></tr><tr><td> E. coli DNA פולימראז אני (10 U / μl) </td><td> 4 </td></tr><tr><td> E. coli RNase H (2 U / μl) </td><td> 1 </td></tr><tr><td> נפח כולל (עם 1 st גדיל תגובה) </td><td> 80 </td></tr><tr><td> שלב 4.2: תגובת Tagmentation </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח (μl) </td></tr><tr><td> Amplicon Tagment Mix (ATM) </td><td> 1 </td></tr><tr><td> Tagment DNA הצפה (TD) </t<html> ד&gt; <td> 5 </td></tr><tr><td> נפח כולל (עם cDNA) </td><td> 10 </td></tr><tr><td> שלב 4.3: תגובת הספרייה PCR </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח (μl) </td></tr><tr><td> מיקס מאסטר PCR (NPM) </td><td> 7.5 </td></tr><tr><td> פריימר מדד 1 (i7) </td><td> 2.5 </td></tr><tr><td> פריימר מדד 2 (i5) </td><td> 2.5 </td></tr><tr><td> הנפח הכולל (עם tagmented cDNA) </td><td> 25 </td></tr><tr><td> שלב 4.3.2: תנאי PCR ספרייה </td><td></td></tr><tr><td> 72 ° C, 3 דקות </td><td></td></tr><tr><td> 95 מעלות צלזיוס, 30 שניות </td><td></td></tr><tr><td colspan="2"> עד 18 מחזורי 10 שניות על 95 מעלות צלזיוס, 30 שניות על 55 מעלות צלזיוס, 30 שניות על 72 מעלות צלזיוס </td></tr><tr><td> 72 מעלות צלזיוס, 5 דקות </td><td></td></tr><tr><td> 10 ° C, לנצח </td><td></td></tr></tbody></table>FO: keep-together.within-page = &quot;1&quot;&gt; טבלה 1:. עד שנקבע התגובה מאגרים שלב-אחר-צעד שולחנות עם התוכן של כל מאגרים ותערובות התגובה. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שם אוליגו </td><td> רצף (5 &#39;ל 3&#39;) </td></tr><tr><td> אבולה KGH FW </td><td> GTCGTTCCAACAATCGAGCG </td></tr><tr><td> RV אבולה KGH </td><td> CGTCCCGTAGCTTTRGCCAT </td></tr><tr><td> אבולה KULESH FW </td><td> TCTGACATGGATTACCACAAGATC </td></tr><tr><td> RV אבולה KULESH </td><td> GGATGACTCTTTGCCGAACAATC </td></tr><tr><td> לסה SL FW </td><td> CC AAB GTA AGC CCA GCD GYA </td></tr><tr><td> RV לסה SL </td><td> AAG CCA CAG AAA RCT GGS AGC </td></tr><tr><td> 18S rRNA FW </td><td> TCCTTTAACGAGGATCCATTGG </td></tr><tr><td> RV 18S rRNA </td><td> CGAGCTTTTTAACTGCAGCAACT </td></tr></tbody></tמסוגל&gt; טבלה 2: qRT-PCR Primers רצפים Primers המשמש למדידת המארח (18S rRNA) ויראלי (אבולה לסה) תוכן.. &#39;KGH&#39; הוא בית חולים ממשלתי Kenema בסיירה לאונה, שבו פריימרים אבולה נבדקו 2. &#39;Kulesh&#39; הוא החוקר שעיצב את פריימר להגדיר 14. טבלה 3: RNA ריבוזומלי (rRNA) דלדול oligos 195 רצפים ארוכים 50-נוקלאוטיד משלים rRNA האדם דלדול סלקטיבית בשלב 6.. <a href="https://www.jove.com/files/ftp_upload/54117/Table_3.xlsx" target="_blank">אנא לחץ כאן להורדת הקובץ הזה.</a>

Watch this Scientific Journal Video about Unbiased Deep Sequencing of RNA Viruses from Clinical Samples at JoVE.com

Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

רצף עמוק משוחד של RNA וירוסי ממדגמים קליניים

Here we outline a next-generation RNA sequencing protocol that enables de novo assemblies and intra-host variant calls of viral genomes collected from ...

unbiased-deep-sequencing-of-rna-viruses-from-clinical-samples

Research

JoVE Journal

Medicine

16.8K Views.  Broad Institute of MIT and Harvard. This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

Video: Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

Isolation and Functional Characterization of Human Ventricular Cardiomyocytes from Fresh Surgical Samples

Cardiomyocytes from diseased hearts are subjected to complex remodeling processes involving changes in cell structure, excitation contraction coupling and membrane ion currents. Those changes are likely&#160;to be responsible for the increased arrhythmogenic risk and the contractile alterations leading to systolic and diastolic dysfunction in cardiac patients. However, most information on the alterations of myocyte function in cardiac diseases has come from animal models.
Here we describe and validate a protocol to isolate viable myocytes from small surgical samples of ventricular myocardium from patients undergoing cardiac surgery operations. The protocol is described in detail. Electrophysiological and intracellular calcium measurements are reported to demonstrate the feasibility of a number of single cell measurements in human ventricular cardiomyocytes obtained with this method.
The protocol reported here can be useful for future investigations of the cellular and molecular basis of functional alterations of the human heart in the presence of different cardiac diseases. Further, this method can be used to identify novel therapeutic targets at cellular level and to test the effectiveness of new compounds on human cardiomyocytes, with direct translational value.

Current knowledge on the cellular basis of cardiac diseases mostly relies on studies on animal models. Here we describe and validate a novel method to obtain single viable cardiomyocytes from small surgical samples of human ventricular myocardium. Human ventricular myocytes can be used for electrophysiological studies and drug testing.

בידוד ואפיון פונקציונלי של אדם חדרית שריר לב מדוגמאות כירורגי טריות

Cardiomyocytes from diseased hearts are subjected to complex remodeling processes involving changes in cell structure, excitation contraction coupling and ...

Isolation of Cancer Stem Cells From Human Prostate Cancer Samples

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly isolated from human tissues and serially propagated in immunodeficient mice, typically through antibody labeling of subpopulations of cells and fractionation by flow cytometry. However, the unique clinical features of prostate cancer have considerably limited the study of prostate CSCs from fresh human tumor samples. We recently reported the isolation of prostate CSCs directly from human tissues by virtue of their HLA class I (HLAI)-negative phenotype. Prostate cancer cells are harvested from surgical specimens and mechanically dissociated. A cell suspension is generated and labeled with fluorescently conjugated HLAI and stromal antibodies. Subpopulations of HLAI-negative cells are finally isolated using a flow cytometer. The principal limitation of this protocol is the frequently microscopic and multifocal nature of primary cancer in prostatectomy specimens. Nonetheless, isolated live prostate CSCs are suitable for molecular characterization and functional validation by transplantation in immunodeficient mice.

The isolation of cancer stem cells (CSCs) directly from human tissues is requisite for their biological characterization. This manuscript describes a methodology for the isolation of prostate CSCs from human tissues, while also providing tips on troubleshooting difficult steps.

בידוד של תאי גזע סרטני מדגימות אדם סרטן הערמונית

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly ...

Controlling Parkinson's Disease With Adaptive Deep Brain Stimulation

Adaptive deep brain stimulation (aDBS) has the potential to improve the treatment of Parkinson&#39;s disease by optimizing stimulation in real time according to fluctuating disease and medication state. In the present realization of adaptive DBS we record and stimulate from the DBS electrodes implanted in the subthalamic nucleus of patients with Parkinson&#39;s disease in the early post-operative period. Local field potentials are analogue filtered between 3 and 47 Hz before being passed to a data acquisition unit where they are digitally filtered again around the patient specific beta peak, rectified and smoothed to give an online reading of the beta amplitude. A threshold for beta amplitude is set heuristically, which, if crossed, passes a trigger signal to the stimulator. The stimulator then ramps up stimulation to a pre-determined clinically effective voltage over 250 msec and continues to stimulate until the beta amplitude again falls down below threshold. Stimulation continues in this manner with brief episodes of ramped DBS during periods of heightened beta power.
Clinical efficacy is assessed after a minimum period of stabilization (5 min) through the unblinded and blinded video assessment of motor function using a selection of scores from the Unified Parkinson&#39;s Rating Scale (UPDRS). Recent work has demonstrated a reduction in power consumption with aDBS as well as an improvement in clinical scores compared to conventional DBS. Chronic aDBS could now be trialed in Parkinsonism.

Adaptive deep brain stimulation (aDBS) is effective for Parkinson&#8217;s disease, improving symptoms and reducing power consumption compared to conventional deep brain stimulation (cDBS). In aDBS we track a local field potential biomarker (beta oscillatory amplitude) in real time and use this to control the timing of stimulation.

שליטה מחלת פרקינסון עם מסתגל עמוק גירוי המוח

Adaptive deep brain stimulation (aDBS) has the potential to improve the treatment of Parkinson&#39;s disease by optimizing stimulation in real time ...

Handling of the Cotton Rat in Studies for the Pre-clinical Evaluation of Oncolytic Viruses

Oncolytic viruses are a novel anticancer therapy with the ability to target tumor cells, while leaving healthy cells intact. For this strategy to be successful, recent studies have shown that involvement of the host immune system is essential. Therefore, oncolytic virotherapy should be evaluated within the context of an immunocompetent model. Furthermore, the study of antitumor therapies in tolerized animal models may better recapitulate results seen in clinical trials. Cotton rats, commonly used to study respiratory viruses, are an attractive model to study oncolytic virotherapy as syngeneic models of mammary carcinoma and osteosarcoma are well established. However, there is a lack of published information on the proper handling procedure for these highly excitable rodents. The handling and capture approach outlined minimizes animal stress to facilitate experimentation. This technique hinges upon the ability of the researcher to keep calm during handling and perform procedures in a timely fashion. Finally, we describe how to prepare cotton rat mammary tumor cells for consistent subcutaneous tumor formation, and how to perform intratumoral and intraperitoneal injections. These methods can be applied to a wide range of studies furthering the development of the cotton rat as a relevant pre-clinical model to study antitumor therapy.

Cotton rats are extremely excitable and have a strong flight-or-fight response. A handling method optimized to reduce the stress of the animals is described which will make cotton rats more accessible as a preclinical model.

טיפול של הכותנה העכברוש במחקרים להערכה טרום-הקלינית של וירוסי Oncolytic

Oncolytic viruses are a novel anticancer therapy with the ability to target tumor cells, while leaving healthy cells intact.  For this strategy to be ...

VDJ-Seq: Deep Sequencing Analysis of Rearranged Immunoglobulin Heavy Chain Gene to Reveal Clonal Evolution Patterns of B Cell Lymphoma

Understanding tumor clonality is critical to understanding the mechanisms involved in tumorigenesis and disease progression. In addition, understanding the clonal composition changes that occur within a tumor in response to certain micro-environment or treatments may lead to the design of more sophisticated and effective approaches to eradicate tumor cells. However, tracking tumor clonal sub-populations has been challenging due to the lack of distinguishable markers. To address this problem, a VDJ-seq protocol was created to trace the clonal evolution patterns of diffuse large B cell lymphoma (DLBCL) relapse by exploiting VDJ recombination and somatic hypermutation (SHM), two unique features of B cell lymphomas.
In this protocol, Next-Generation sequencing (NGS) libraries with indexing potential were constructed from amplified rearranged immunoglobulin heavy chain (IgH) VDJ region from pairs of primary diagnosis and relapse DLBCL samples. On average more than half million VDJ sequences per sample were obtained after sequencing, which contain both VDJ rearrangement and SHM information. In addition, customized bioinformatics pipelines were developed to fully utilize sequence information for the characterization of IgH-VDJ repertoire within these samples. Furthermore, the pipeline allows the reconstruction and comparison of the clonal architecture of individual tumors, which enables the examination of the clonal heterogeneity within the diagnosis tumors and deduction of clonal evolution patterns between diagnosis and relapse tumor pairs. When applying this analysis to several diagnosis-relapse pairs, we uncovered key evidence that multiple distinctive tumor evolutionary patterns could lead to DLBCL relapse. Additionally, this approach can be expanded into other clinical aspects, such as identification of minimal residual disease, monitoring relapse progress and treatment response, and investigation of immune repertoires in non-lymphoma contexts.

This protocol describes an approach to interrogate the recombined immunoglobulin heavy chain VDJ regions of lymphomas by deep-sequencing and retrieve VDJ rearrangement and somatic hypermutation status to delineate clonal architecture of individual tumor. Comparing clonal architecture between paired diagnosis and relapse samples reveals lymphoma relapse clonal evolution modes.

VDJ-Seq: ניתוח רצף עמוק של ג&#39;ין שרשרת מחדש Immunoglobulin כבד לחשוף את דפוסים משובטים אבולוציה של לימפומה B הסלולרי

Understanding tumor clonality is critical to understanding the mechanisms involved in tumorigenesis and disease progression. In addition, understanding ...

Using Saccadometry with Deep Brain Stimulation to Study Normal and Pathological Brain Function

The oculomotor system involves a large number of brain areas including parts of the basal ganglia, and various neurodegenerative diseases including Parkinson's and Huntington's can disrupt it. People with Parkinson's disease, for example, tend to have increased saccadic latencies. Consequently, the quantitative measurement of saccadic eye movements has received considerable attention as a potential biomarker for neurodegenerative conditions. A lot more can be learned about the brain in both health and disease by observing what happens to eye movements when the function of specific brain areas is perturbed. Deep brain stimulation is a surgical intervention used for the management of a range of neurological conditions including Parkinson's disease, in which stimulating electrodes are placed in specific brain areas including several sites in the basal ganglia. Eye movement measurements can then be made with the stimulator systems both off and on and the results compared. With suitable experimental design, this approach can be used to study the pathophysiology of the disease being treated, the mechanism by which DBS exerts it beneficial effects, and even aspects of normal neurophysiology.

This paper describes the use of quantitative measurement of eye movements in conjunction with stimulation of focal areas of the deep brain in order to study physiology, pathophysiology, and the mechanisms of deep brain stimulation.

שימוש Saccadometry עם דיפ גירוי המוח לחקר תפקוד מוח נורמלי ופתולוגיים

The oculomotor system involves a large number of brain areas including parts of the basal ganglia, and various neurodegenerative diseases including ...

Transarterial Administration of Oncolytic Viruses for Locoregional Therapy of Orthotopic HCC in Rats

Hepatocellular carcinoma (HCC) is a disease with limited treatment options and poor prognosis. In recent years, oncolytic virotherapies have proven themselves to be potentially powerful tools to fight malignancy. Due to the unique dual blood supply in the liver, it is possible to apply therapies locally to orthotopic liver tumors, which are predominantly fed by arterial blood flow. We have previously demonstrated that hepatic arterial delivery of oncolytic viruses results in safe and efficient transduction efficiency of multifocal HCC lesions, resulting in significant prolongation of survival in immune competent rats. This procedure closely mimics the application of transarterial embolization in patients, which is the standard palliative care provided to many HCC patients. The ability to administer tumor therapies through the hepatic artery in rats allows for a highly sophisticated preclinical model for evaluating novel viral vectors under development. Here we describe the detailed protocol for microdissection of the hepatic artery for infusion of oncolytic virus vectors to treat orthotopic HCC.

Oncolytic virotherapies are under development as novel therapeutics for the treatment of hepatocellular carcinoma (HCC). Here we describe a method for locoregional therapy of HCC via hepatic arterial administration of oncolytic virus.

Transarterial מינהל oncolytic וירוסים לטיפול Locoregional של Orthotopic HCC אצל חולדות

Hepatocellular carcinoma (HCC) is a disease with limited treatment options and poor prognosis.  In recent years, oncolytic virotherapies have proven ...

Sampling Strategies and Processing of Biobank Tissue Samples from Porcine Biomedical Models

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of genetically modified pig models, and the often-limited number of available animals of these models, establishment of (biobank) collections of adequately processed tissue samples suited for a broad spectrum of subsequent analyses methods, including analyses not specified at the time point of sampling, represent meaningful approaches to take full advantage of the translational value of the model. With respect to the peculiarities of porcine anatomy, comprehensive guidelines have recently been established for standardized generation of representative, high-quality samples from different porcine organs and tissues. These guidelines are essential prerequisites for the reproducibility of results and their comparability between different studies and investigators. The recording of basic data, such as organ weights and volumes, the determination of the sampling locations and of the numbers of tissue samples to be generated, as well as their orientation, size, processing and trimming directions, are relevant factors determining the generalizability and usability of the specimen for molecular, qualitative, and quantitative morphological analyses. Here, an illustrative, practical, step-by-step demonstration of the most important techniques for generation of representative, multi-purpose biobank specimen from porcine tissues is presented. The methods described here include determination of organ/tissue volumes and densities, the application of a volume-weighted systematic random sampling procedure for parenchymal organs by point-counting, determination of the extent of tissue shrinkage related to histological embedding of samples, and generation of randomly oriented samples for quantitative stereological analyses, such as isotropic uniform random (IUR) sections generated by the &#34;Orientator&#34; and &#34;Isector&#34; methods, and vertical uniform random (VUR) sections.

The practical application and performance of methods for generation of representative tissue samples of porcine animal models for a broad spectrum of downstream analyses in biobank projects are demonstrated, including volumetry, systematic random sampling, and differential processing of tissue samples for qualitative and quantitative morphologic and molecular analyses types.

אסטרטגיות דגימה ועיבוד של דגימות רקמה Biobank של מודלים ביו חזירי

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations often cause a distorted reading frame and premature stop codons, resulting in an almost total lack of dystrophin protein. The reading frame can be corrected using antisense oligonucleotides (AONs) that induce exon skipping. The morpholino AON viltolarsen (code name: NS-065/NCNP-01) has been shown to induce exon 53 skipping, restoring the reading frame for patients with exon 52 deletions. We recently administered NS-065/NCNP-01 intravenously to DMD patients in an exploratory investigator-initiated, first-in-human trial of NS-065/NCNP-01. In this methods article, we present the molecular characterization of dystrophin expression using Sanger sequencing, RT-PCR, and western blotting in the clinical trial. The characterization of dystrophin expression was fundamental in the study for showing the efficacy since no functional outcome tests were performed.

Here, we present the molecular characterization of dystrophin 38 expression using Sanger sequencing, RT-PCR, and western blotting in the clinical trial.

אפיון Exon דילוג יעילות בדגימות החולה DMD בניסויים קליניים של אנטיסנס אוליגונוקליאוטידים

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...

Isolation of Viable Adipocytes and Stromal Vascular Fraction from Human Visceral Adipose Tissue Suitable for RNA Analysis and Macrophage Phenotyping

Visceral adipose tissue (VAT) is an active metabolic organ composed mainly of mature adipocytes and stromal vascular fraction (SVF) cells, which release different bioactive molecules that control metabolic, hormonal, and immune processes; currently, it is unclear how these processes are regulated within the adipose tissue. Therefore, the development of methods evaluating the contribution of each cell population to the pathophysiology of adipose tissue is crucial. This protocol describes the isolation steps and provides the necessary troubleshooting guidelines for efficient isolation of viable mature adipocytes and SVF from human VAT biopsies in a single process, using a collagenase enzymatic digestion technique. Moreover, the protocol is also optimized to identify macrophage subsets and perform mature adipocyte RNA isolation for gene expression studies, which allows performing studies dissecting the interaction between these cell populations. Briefly, VAT biopsies are washed, minced mechanically, and digested to generate a single-cell suspension. After centrifugation, mature adipocytes are isolated by flotation from the SVF pellet. The RNA extraction protocol ensures a high yield of total RNA (including miRNAs) from adipocytes for downstream expression assays. Simultaneously, SVF cells are used to characterize macrophage subsets (pro- and anti-inflammatory phenotype) through flow cytometry analysis.

This protocol provides an efficient collagenase digestion method for isolation of viable adipocytes and stromal vascular fraction-SVF cells from human visceral fat in a single process, including methodology to obtain high-quality RNA from adipocytes and phenotypification of SVF-macrophages through staining of multiple membrane-bound markers for analysis by flow cytometry.

בידוד אדיפוציטים בני קיימא ומקטע כלי דם סטרומלי מרקמת השומן הקרבית האנושית המתאימה לניתוח RNA ופנוטיפ מקרופאגים

Visceral adipose tissue (VAT) is an active metabolic organ composed mainly of mature adipocytes and stromal vascular fraction (SVF) cells, which release ...