This work has been funded in part with Federal funds from the National Institutes of Health, Office of Director, Innovator (No.: DP2OD06514) (PCS) and from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health and Human Services, under Contracts (No:HHSN272200900018C, HHSN272200900049C and U19AI110818).

הצהרה אתיקה: חולי קדחת לסה גויסו למחקר זה באמצעות הפרוטוקולים שאושרו על ידי ועדות בבני אדם ב אוניברסיטת טוליין, אוניברסיטת הרווארד, Broad Institute, בית חולים אוניברסיטאי מומחה Irrua (ISTH), בית חולים ממשלתי Kenema (KGH), אויו המדינה משרד הבריאות, Ibadan , ניגריה משרד סיירה לאונה הבריאות. כל החולים טופלו עם תקן דומה של טיפול שהוצעו התרופה Ribavirin, אם הם החליטו להשתתף במחקר. עבור קדחת לסה (LF) חולים, טיפול עם Ribavirin בעקבות ההנחיות המומלצות כיום הוצע כלל בהקדם LF היה חשד מוצק. בשל ההתפרצות החמורה עבור אבולה וירוס המחלות (EVD), חולים לא ניתן הסכימו באמצעות הפרוטוקולים הסטנדרטיים שלנו. במקום שימוש במדגמים קליניים עודף מחולים EVD הוערך ואושרה על ידי לוחות סקירה מוסדיים בסיירה ליאון באוניברסיטת הרווארד. במשרהce של סקירה אתיקה מדעית סיירה לאונה הוועדה, משרד סיירה לאונה הבריאות והתברואה, וועדת הרווארד על השימוש בבני אדם העניקו ויתור על הסכמה שממפה להעמיד לרשות רצפים ויראלי בפומבי המתקבל דגימות המטופל ומגע שנאספו במהלך התפרצות אבולה ב סיירה לאונה. גופים אלו כמובן מאליו גם שימוש בנתונים קליניים ואפידמיולוגיים, דגימות-מזוהה דה שנאספו מכל חולי EVD חשד טיפול במהלך התגובה הפרוצה. משרד סיירה לאונה הבריאות ותברואה גם אישרה משלוחי שאינם מדבקים, שאינם ביולוגיים דגימות מסיירה לאון למכון ברוד ואוניברסיטת הרווארד ללימודי הגנומי של דגימות פרוץ. 1. DNase-טיפול של RNA לדוגמא (עד 55 μl שחולצו RNA סה&quot;כ, ~ 4 שעות) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הגדר את התגובה DNase בצלחת 96-היטב PCR על הקרח בתוך ארון בטיחות ביולוגית כמתואר בטבלה 1 </strong&gt;, שלב 1.1 (הנפח הכולל, 70 μl / טוב). הערה: תערובת אמן יכולה להיות מוכנה. </li><li style=";text-align:right;direction:rtl"> וורטקס בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. </li><li style=";text-align:right;direction:rtl"> לדגור על 37 מעלות צלזיוס למשך 30 דקות. </li><li style=";text-align:right;direction:rtl"> ניקוי באמצעות RNA מוצק שלב הפיך קיבוע (SPRI) חרוזים. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> חרוזי RNA חמים RT למשך 30 דקות. </li><li style=";text-align:right;direction:rtl"> נער בעדינות RNA חרוזי בקבוק resuspend כל חלקיקים מגנטיים שייתכן התיישבו. הוספת נפח 1.8x (126 μl) של חרוזים RNA ל RNA שטופלו DNase (70 μl), ומערבבים על ידי פיפטה 10 פעמים דגירה במשך 5 דקות ב RT (הנפח הכולל גם, 196 μl). </li><li style=";text-align:right;direction:rtl"> מניחים לתערובת בתחנת מגנטי. חכה הפתרון לנקות (5 - 10 דקות). </li><li style=";text-align:right;direction:rtl"> סור פתרון פינה ואילו בתחנה ידי פיפטה וזורק. בעוד על תחנה, לשטוף חרוזים על ידי כיסוי גלול עם אתנול 70% ו דגירת דקות 1. הסר אתנול עם פיפטה וזורק. חזור עבור סכום כולל של שני שוטף. הערה: שימוש טרי 70% בדיוק et מוכןhanol הוא קריטי, כמו אחוז גבוה יותר יגרום כביסה יעילה של מולקולות קטנות יותר, ואילו &lt;70% אתנול יכול לגרום לאובדן מדגם 7. </li><li style=";text-align:right;direction:rtl"> שמור הצליחו על התחנה ולהשאיר פתוח-אוויר יבש. הערה: הקפד לאפשר חרוזים להתייבש לחלוטין עד חרוזים להתחיל לפצח. </li><li style=";text-align:right;direction:rtl"> הוסף 55 μl מים nuclease חינם לצלחת כדי elute רנ&quot;א. הסר את הצלחת מהתחנה לערבב את החרוזים ומים ידי pipetting ביסודיות. הערה: לחילופין, להשתמש פחות מים (≤ 10 μl) על מנת לרכז את RNA מוחלט. </li><li style=";text-align:right;direction:rtl"> מניחים צלחת בחזרה על התחנה. חכה עד פתרון מנקה להעביר על ידי פיפטה צינור בורג מכסה חדש עבור אחסון לטווח ארוך (-80 ° C). מניחים 5 RNA μl בניו 96-גם צלחת PCR עבור דלדול (שלב. 2.4). </li><li style=";text-align:right;direction:rtl"> אופציונלי:. שמור לדלל 1 μl ב 19 מים μl (1:20) עבור qRT-PCR של rRNA (למשל, 18S, 28S rRNA) (לוח 2) וסמנים ויראלי 5 &lt;/ Li&gt; </ol></li></ol> 2. דלדול סלקטיבי של RNA ריבוזומלי והספק ממדגם RNA ויראלי (~ 4 שעות) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הפוך הכלאה 5x ו 10x מאגרים התגובה RNase H, ו nuclease ללא מים עם הספק acrylamide ליניארית כמתואר בטבלה 1. </li><li style=";text-align:right;direction:rtl"> הגדרת התגובה הכלאה ידי שילוב RNA עם oligos דלדול rRNA (טבלה 3) ו אוליגו (DT) על קרח בצלחת 96-היטב PCR כמתואר בטבלה 1. הערה: תערובת אמן יכולה להיות מוכנה. 50 femtograms (FG) של רנ&quot;א ייחודי (ERCCs 8) ניתן להוסיף למעקב הן את תהליך רצף ויראלי זיהום צולב מדד פוטנציאל לקרוא. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> וורטקס בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. לדגור על 95 מעלות צלזיוס למשך 2 דקות, ramping האיטי עד 45 מעלות צלזיוס ב -0.1 מעלות צלזיוס לכל שניות. השהה את thermocycler על 45 מעלות צלזיוס. </li></ol></li><li style=";text-align:right;direction:rtl"> הגדרת תערובת התגובה RNase H על הקרח כמו לתארד בטבלה 1, אז מחממים על 45 מעלות צלזיוס למשך 2 דקות. הערה: תערובת אמן יכולה להיות מוכנה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מוסיף את התערובת המחוממת מראש RNase H תגובת ההכלאה בצלחת תוך שמירה על צלחת thermocycler ב 45 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> מערבבים היטב על ידי pipetting עדין 6 - 8 פעמים. לדגור על 45 מעלות צלזיוס במשך 30 דקות אחרות. מניחים על קרח. </li></ol></li><li style=";text-align:right;direction:rtl"> הגדר את תערובת התגובה DNase על הקרח כמתואר בטבלה 1 הערה:. תערובת אמן יכול להיות מוכן. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוסף את התגובה H RNase בצלחת, מערבולת בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. לדגור על 37 מעלות צלזיוס למשך 30 דקות. </li><li style=";text-align:right;direction:rtl"> בקצות DNase ידי הוספת 5 μl 0.5 M EDTA. וורטקס בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. </li></ol></li><li style=";text-align:right;direction:rtl"> ניקוי באמצעות חרוזים RNA (ראה שלב 1.3) באמצעות נפח 1.8x (144 μl) חרוזים. Elute ב 11 μl של מים nuclease חינם. הערה: בקירור בטוח, חנות מדולדלת RNדגימה ב -80 ° C O / N. </li></ol> 3. סינתזה cDNA (~ 6 שעות) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מערבבים rRNA / RNA מדולדל המוביל עם פריימרים אקראיים על קרח בצלחת 96-היטב PCR כמתואר בטבלה 1, מערבולת בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מחממים את התערובת עד 70 מעלות צלזיוס למשך 10 דקות ב thermocycler. מיד לאחר denaturation חום, למקם את הרנ&quot;א על ​​קרח 1 - 5 דקות. אל תאפשרו RNA לעמוד (אפילו על הקרח) למשך זמן ארוך יותר מ -5 דקות לפני התגובה הראשונה גדיל. </li></ol></li><li style=";text-align:right;direction:rtl"> הגדרת גדיל הראשונה תערובת התגובה סינתזה על הקרח כמתואר בטבלה 1. הערה: לערבב מנהל עשוי להיות מוכן. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוסף RNA / תערובת פריימר אקראית בצלחת, מערבולת בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. לדגור על 22 - C ° 25 במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> לדגור על 55 מעלות צלזיוס באינקובטור באוויר במשך 60 דקות. מניחים את הצלחת על הקרח כדי לסיים את התגובה. לֹאדואר: השימוש באינקובטור אוויר מומלץ ליצור התחממות הדרגתית של התגובה הראשונה גדיל שבמהלכו לחשל פריימרים ואת הגדיל הראשון מתחיל להאריך. </li></ol></li><li style=";text-align:right;direction:rtl"> הגדרת תערובת תגובת הסינתזה שניית גדיל על קרח כמתואר בטבלה 1. הערה: לערבב מנהל עשוי להיות מוכן. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוסף סינתזת התגובה הראשונה גדיל בצלחת, מערבולת בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. דגירה עבור שעה 2 ב 16 ° C (לשמור מכסה של 25 מעלות צלזיוס). אל תאפשר לטמפרטורה לעלות מעל 16 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> מניחים את הצלחת על הקרח, אז להשבית התגובה על ידי הוספת 5 μl של 0.5 EDTA M, ומערבבים בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. </li></ol></li><li style=";text-align:right;direction:rtl"> ניקוי עם חרוזים DNA (ראה שלב 1.3 עבור פרוטוקול) באמצעות נפח 1.8x (153 μl) של חרוזים. Elute ב 9 μl של חיץ elution (EB). שמור 1 μl כימות. השתמש 1 ננוגרם של cDNA עבור subsequeצעדי NT. אם ריכוז cDNA הוא נמוך מדי כדי לזהות, השתמש 4 μl של cDNA עבור tagmentation (ראה שלב 4.1). </li><li style=";text-align:right;direction:rtl"> לקבלת בקירור בטוח, לאחסן פעמיים תקועים cDNA ב 4 ° CO / N או -20 ° C עבור אחסון לטווח ארוך. </li></ol> 4. הכנת הספרייה - בניית ספריית DNA (~ 4 שעות) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> העברת 4 μl של cDNA לצלחת 96-היטב ולשמור את cDNA הנותר עבור ניסיון שני במידת הצורך. </li><li style=";text-align:right;direction:rtl"> הגדר את התגובה tagmentation על הקרח כמתואר בטבלה 1. הערה: לערבב מנהל עשוי להיות מוכן. כדי להפחית את הרקע ואת העלות הכוללת, את הנפח הכולל של התגובה tagmentation מצטמצם מ -20 ל -10 μl. כפי cDNA הוא הגורם המגביל, בסך של ATM (כלומר, transposome) המשמש התגובה מצטמצם גם כדי להקטין את מספר אתרי אינטגרציה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להוסיף תערובת tagmentation כדי cDNA בצלחת, מערבולת בעדינות וביסודיות צנטריפוגות ב 280 XG (ב RT) עבור 1 דקות.לדגור על 55 מעלות צלזיוס למשך 5 דקות, להחזיק ב 10 ° C. </li><li style=";text-align:right;direction:rtl"> פעם ב 10 ° C, מיד להוסיף 2.5 μl של לנטרל Tagment הצפת (NT) לסיים את התגובה. מערבבים על ידי pipetting למעלה ולמטה, ואז צנטריפוגות ב 280 XG (ב RT) עבור 1 דקות. </li><li style=";text-align:right;direction:rtl"> לדגור על RT במשך 5 דקות. </li></ol></li><li style=";text-align:right;direction:rtl"> הגדרת תגובת הגברת PCR על קרח כמתואר בטבלה 1. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> וורטקס בעדינות וביסודיות, אז צנטריפוגות ב 280 XG ב RT עבור 1 דקות. </li><li style=";text-align:right;direction:rtl"> בצע PCR על thermocycler באמצעות בתנאים המתוארים בטבלה 1. הערה: 12 מחזורים של PCR הם הציעו עבור 1 ננוגרם של cDNA tagmented; עם זאת, דגימות קליניות ויראלי לעתים קרובות יש כמויות בלתי מורגשות של cDNA. עבור סכומים נמוכים של cDNA (&lt;1 נ&quot;ג), השתמש עד 18 מחזורים של PCR כדי ליצור ספריית מספיק עבור סידור. </li></ol></li><li style=";text-align:right;direction:rtl"> ניקוי ואיגום עבור סידור - הכנה הספרייה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תביא דגימה של עד 50 μl עם EB. </li><li style=";text-align:right;direction:rtl"> ניקוי עםחרוזי DNA (ראה שלב 1.3 עבור פרוטוקול) באמצעות נפח 0.6x חרוזים (30 μl). Elute ב 15 μl EB. </li><li style=";text-align:right;direction:rtl"> קביעת ריכוז של הספרייה (איור 3) על ידי ביצוע ניתוח באזור (150 עד 1,000 נ&quot;ב) באמצעות bioanalyzer התוכנה 9, למעט הדימרים פריימר (~ 120 נ&quot;ב) מניתוח באזור. הערה: לחילופין, qPCR יכול לשמש כדי לכמת ספריות 10. </li><li style=";text-align:right;direction:rtl"> ספריות ברכה בריכוז הטוחן הנמוך ביותר של 1 ננומטר או יותר. אם ספרייה היא מתחת ל -1 ננומטר, להוסיף נפח קטן של ספריית ברכה (~ נפח 1x של ספריות אחרות) כדי ללכוד מידע רצף מספריות אלה. </li><li style=";text-align:right;direction:rtl"> ניקוי בריכה עם חרוזים DNA 0.7x כפי שתואר לעיל (ראה שלב 2). Elute ב 15 μl EB. הערה: נפח של חרוזים יהיה תלוי בנפח הסופי של הברכה. </li><li style=";text-align:right;direction:rtl"> לנתח ברכה 9. קביעת ריכוז טוחנת ידי ביצוע ניתוח באזור (150 עד 1,000 נ&quot;ב) 9. הערה: לחילופין, qPCR יכול לשמש כדי לכמת בריכת הספרייה 10 &lt;/ Sup&gt;. </li><li style=";text-align:right;direction:rtl"> ברצף טען בריכוז הספרייה 10 בערב עד לייצר 101 נ&quot;ב, לזווג סוף קורא עם ברקוד כפול קורא 11. </li></ol></li></ol><img alt="איור 3" src="/files/ftp_upload/54117/54117fig3.jpg" /> איור 3. נבנו ספריות ממדגמים קליניים וירוס האבולה. תמונה ג&#39;ל של 4 וירוס האבולה יציג ספריות (EBOV). אזורים של הדימרים ספרייה פריימר מוצגים. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

<ol>
	<li>Stremlau, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+novel+rhabdoviruses+in+the+blood+of+healthy+individuals+from+West+Africa.">Discovery of novel rhabdoviruses in the blood of healthy individuals from West Africa.</a> PLoS Negl Trop Dis. 9, e0003631 (2015).</li><li>Gire, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+surveillance+elucidates+Ebola+virus+origin+and+transmission+during+the+2014+outbreak.">Genomic surveillance elucidates Ebola virus origin and transmission during the 2014 outbreak.</a> Science. 345, 1369-1372 (2014).</li><li>Morlan, J. D., Qu, K., Sinicropi, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+depletion+of+rRNA+enables+whole+transcriptome+profiling+of+archival+fixed+tissue.">Selective depletion of rRNA enables whole transcriptome profiling of archival fixed tissue.</a> PLoS One. 7, e42882 (2012).</li><li>Park, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ebola+Virus+Epidemiology,+Transmission,+and+Evolution+during+Seven+Months+in+Sierra+Leone.">Ebola Virus Epidemiology, Transmission, and Evolution during Seven Months in Sierra Leone.</a> Cell. 161, 1516-1526 (2015).</li><li>Andersen, K. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+Sequencing+Uncovers+Origins+and+Evolution+of+Lassa+Virus.">Clinical Sequencing Uncovers Origins and Evolution of Lassa Virus.</a> Cell. 162, 738-750 (2015).</li><li>Matranga, C. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+methods+for+unbiased+deep+sequencing+of+Lassa+and+Ebola+RNA+viruses+from+clinical+and+biological+samples.">Enhanced methods for unbiased deep sequencing of Lassa and Ebola RNA viruses from clinical and biological samples.</a> Genome Biol. 15, 519 (2014).</li><li>Tang, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Seq+analysis+to+capture+the+transcriptome+landscape+of+a+single+cell.">RNA-Seq analysis to capture the transcriptome landscape of a single cell.</a> Nat Protoc. 5, 516-535 (2010).</li><li>Jiang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+spike-in+standards+for+RNA-seq+experiments.">Synthetic spike-in standards for RNA-seq experiments.</a> Genome Res. 21, 1543-1551 (2011).</li><li>. Kapa Biosystems Available from: <a target="_blank" href="https://www.kapabiosystems.com/product-applications/products/next-generation-sequencing-2/library-quantification/">https://www.kapabiosystems.com/product-applications/products/next-generation-sequencing-2/library-quantification/</a> (2015)</li><li>. Illumina Technologies Available from: <a target="_blank" href="https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/preparing-libraries-for-sequencing-on-miseq-15039740-d.pdf">https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/preparing-libraries-for-sequencing-on-miseq-15039740-d.pdf</a> (2015)</li><li>Kircher, M., Sawyer, S., Meyer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double+indexing+overcomes+inaccuracies+in+multiplex+sequencing+on+the+Illumina+platform.">Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform.</a> Nucleic Acids Res. 40, 3 (2012).</li><li>Trombley, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+panel+of+real-time+TaqMan+polymerase+chain+reaction+assays+for+detection+and+absolute+quantification+of+filoviruses,+arenaviruses,+and+New+World+hantaviruses.">Comprehensive panel of real-time TaqMan polymerase chain reaction assays for detection and absolute quantification of filoviruses, arenaviruses, and New World hantaviruses.</a> Am J Trop Med Hyg. 82, 954-960 (2010).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serial+high-resolution+analysis+of+blood+virome+and+host+cytokines+expression+profile+of+a+patient+with+fatal+H7N9+infection+by+massively+parallel+RNA+sequencing.">Serial high-resolution analysis of blood virome and host cytokines expression profile of a patient with fatal H7N9 infection by massively parallel RNA sequencing.</a> Clin Microbiol Infect. 21, 713 (2015).</li><li>Simon-Loriere, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lineages+of+Ebola+virus+in+Guinea+during+the+2014+West+African+epidemic.">Distinct lineages of Ebola virus in Guinea during the 2014 West African epidemic.</a> Nature. 524, 102-104 (2015).</li><li>Folarin, O. A., Happi, A. N., Happi, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empowering+African+genomics+for+infectious+disease+control.">Empowering African genomics for infectious disease control.</a> Genome Biol. 15, 515 (2014).</li><li>Blainey, P. C., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+MDA+for+enumeration+of+total+nucleic+acid+contamination.">Digital MDA for enumeration of total nucleic acid contamination.</a> Nucleic Acids Res. 39, 19 (2011).</li><li>Malboeuf, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+viral+RNA+genome+sequencing+of+ultra-low+copy+samples+by+sequence-independent+amplification.">Complete viral RNA genome sequencing of ultra-low copy samples by sequence-independent amplification.</a> Nucleic Acids Res. 41, 13 (2013).</li><li>Gonzalez, I. L., Sylvester, J. E., Smith, T. F., Stambolian, D., Schmickel, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosomal+RNA+gene+sequences+and+hominoid+phylogeny.">Ribosomal RNA gene sequences and hominoid phylogeny.</a> Mol Biol Evol. 7, 203-219 (1990).</li><li>Adiconis, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+RNA+sequencing+methods+for+degraded+or+low-input+samples.">Comparative analysis of RNA sequencing methods for degraded or low-input samples.</a> Nat Methods. 10, 623-629 (2013).</li></ol>

The authors have no competing financial interests.

שהגישה המתוארת מאפשרת חזק, אוניוורסלי, רצף מהיר שמשה רצף נגיף האבולה במהלך 2,4 פרוץ 2014. על ידי צימוד דלדול סלקטיבית סינתזת cDNA עם בניית ספריית tagmentation, הפעם התהליך הכולל הופחת על ידי ~ 2 ימי משיטות קשירת מתאם קודמות. לאחרונה, פרוטוקול זה הועסק על ידי משתפי פעולה בינלאומיים ואחרים בהצלחה רבה 15,16 ו ייפרס מעבדות במערב אפריקה לתמוך מחקרים מבוססי הגנומיקה מקומיים ואבחון 17. הפרוטוקול המתואר כאן משתמש פריימרים אקראיים להכין cDNA עבור ספריות RNA-seq ויראלי. שלא כמו גישות RNA-seq ויראלי קודמות, זה לא דורש ידע אפריורי של נתוני רצף או משוכלל ונדרש זמן רב עיצוב פריימר עבור וירוס או clade ספציפי. השיטה יכולה להיות מיושמת על כל מדגם רנ&quot;א נגיפי. לדוגמה, שימש אותו כדי ליצור תוכן ויראלי משני אבולהו לסה דגימות 6. הפרוטוקול יכול לשמש גם עבור transcriptomic מארח, פרויקטי רצף metagenomic ו הפתוגן גילוי 1. שלב קריטי של הפרוטוקול הוא ממוקד עיכול H RNase, א-תפוקה גבוהה, שיטת עלות נמוכה להסרת ספק רצוי ו- RNA מארח ממדגם ויראלי. צעד הדלדול סלקטיבית של הפרוטוקול עושה שימוש מרכיבים רבים ודורש מיומנות ודיוק. זמן טיפול נוסף יש לנקוט במהלך ההתקנה הראשונית. כמו רוב דגימות סרום ופלזמה קליניות לעתים קרובות יש מעט מאוד חומר חומצות גרעין, זיהום ואובדן מדגם נפוץ. כדי למנוע בעיות אלה, טיפול מיוחד יש לנקוט בעת שימוש בפרוטוקול זה. ראשית, RNA הוא מאוד רגיש שפל; ולכן בכל התחומים צריכים להיות נקיים של nucleases. שנית, לזהות דגימות מתאימות לשימוש בפרוטוקול זה, מבחני qRT-PCR עבור שניהם RNA מארח הווירוס אמורים לשמש עבור כימות 5,6 </sup&gt;. בהשוואת קלט מסתכמת עם תוצאות רצף מן הפרוטוקול, הצלחת רצף (כלומר, דור נתונים המספיקים להרכבת ויראלי מלאה) בקורלציה עם דגימות שהכילו לפחות 100 pg RNA סך 1,000 עותקים של נגיף. יש להימנע מחשיפה שלישית, מקורות סביבתיים של חומצות גרעין. הפרוטוקול המתואר כאן נעשה בתוך ארון בטיחות ביולוג הוראות בטיחות להגבלת מזהמים סביבתיים. יתר על כן, הקבוצה ואחרים שלנו הבחינו כי אנזימים מסחריים עשויים להיות מקור נוסף של זיהום חיידקי חומצות גרעין בדגימות קלט נמוך 6,18. שימוש סביבת עבודה נקיה (למשל, מכסה מנוע PCR, ארון בטיחות ביולוגי) ובקרות שליליות (למשל, מים או חיץ) יעזרו להקל ולעקוב אחר זיהום, בהתאמה. לקבלת דוגמיות עם &lt;100 pg של רנ&quot;א הכל, רק פולי RNA המוביל (RA), לא rRNA, צריך להיות מדולדל על מנת להבטיח תוצאות רצף באיכות גבוהה תוך הגבלת הפסד של החומר. לקבלת מאודדגימות קלט נמוכות, שיטות הגברת cDNA יכולות להיות יותר מתאימות 19, למרות פולי (ע&quot;ר) מנשא להסירו לפני סינתזת cDNA. דלדול של המארח rRNA מעשירה עבור תוכן ויראלי בספריות רצף שלכם והיא חלה על אוספים דגימה שונים כולל סרום או פלזמה, וסוגים שונים של רקמות מן מכרסמים פרימטים לא אנושיים 5,6. באורגניזמים שאינם בני אדם, קריאות יישור כדי 28S rRNA שנותר לאחר דלדול, דבר המצביע 28S rRNA הוא פחות משומר בין בני האדם ומינים אחרים 6,20. בעת השימוש בשיטה זו עם בידודים שאינם בני אדם, זה עשוי להיות נחוץ כדי להשלים עם oligos DNA משלים רצפי rRNA מסתעפים של 3,21 המארח הספציפי. מאז הפרוטוקול הוא משוחד, ויראלי קורא עשוי לייצג רק חלק קטן של תוכן הספריה. למרות rRNA הוא המין הנפוץ ביותר של רנ&quot;א מארח ורק אחוז קטן של rRNA קורא (0; 1%) נמצאים לאחר דלדול סלקטיבית, כל RNA המארח האחר (למשל, mRNA) יישאר לאחר הדלדול עשוי להסביר רצף רב קורא מן המדגם. לכן &quot;oversampling&quot; (כלומר, oversequencing) ספריות פרט נדרשה על מנת לקבל כיסוי מספיק לשיחות הרכבת גרסת ויראלי. עבור מחקרים שלנו, אנו מנסים רצף ~ 20 מיליון קורא לדגימה יש מספיק עומק לניתוח של וריאנטים גנומי הקשורים ויראלי וכן תכנים metagenomic 2,5. עבור מחקרים גילוי metagenomic ו הפתוגן, חשוב לציין כי זיהום DNA המארח הוא הוסר על ידי מערכת העיכול DNase. לכן נגיפים ופתוגנים אחרים המכילים הגנום DNA עלולים ללכת לאיבוד בתהליך, אולם ביניים RNA עשויים עדיין להיות רצף.

רצף הדור הבא של וירוסים ממקורות קליניים יכול להודיע ​​הולכת האפידמיולוגיה של זיהומים, כמו גם רומן תמיכת עזרת אבחון, חיסון ופיתוח טיפולי. סינתזה cDNA באמצעות פריימרים אקראיים אפשרה זיהוי והרכבה של הגנום מ-מדביק שיתוף מסתעף, או אפילו וירוסים רומן 1,2. כמו שיטות משוחדות אחרות, מזהמים לא רצויים לכבוש רצף רב קורא על תוצאותיהן רצף שלילי. מארח פולי RNA המוביל (ע&quot;ר) הם מזהמים באוספי מדגם ויראלי רבים קיימים. הפרוטוקול מתאר דרך יעילה וחסכונית של הגנום וירוס RNA רצף עמוק מבוסס על-seq רנ&quot;א הכל משוחדת. השיטה משתמשת צעד דלדול סלקטיבית RNase H 3 להסיר ריבוזומלי מארח רצוי ו- RNA המוביל. דלדול סלקטיבי מעשיר עבור תוכן ויראלי (איור 1) ומשפר את האיכות הכוללת של נתוני רצף(איור 2) מדגים קליני. יתר על כן, tagmentation מוחל על הפרוטוקול כמו שהיא מפחיתה באופן משמעותי את זמן בניית ספרייה. שיטות אלו שימשו להפקת מערכי נתונים גדולים במהירות של הגנום וירוס אבולה לסה 2,4,5 וניתן להשתמש בו כדי ללמוד מגוון רחב של וירוסים RNA. לבסוף, הגישה אינה מוגבלת דגימות אנושיות; השירות של דלדול סלקטיבית הודגם על דגימות רקמה שנאספו מכרסמים נגועים לסה ומודלי מחל הפרימטים לא אנושי 5,6. <img alt="איור 1" src="/files/ftp_upload/54117/54117fig1.jpg" /> תוכן איור 1. סך RNA משקף העשרת תוכן וירוס לסה שימוש סלקטיבי אזילה. החל תוכן הכולל (קלט RNA) והעשרה של נגיף לסה ייחודי (LASV) קורא (תוכן הספריה) על דלדול rRNA מתשע מבודד קליניים שונים. נתון זה יש הבדל בין תמונה 6 <em&gt;. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/54117/54117fig2.jpg" /> איור 2. איכות גבוהה יותר רצף לאחר Carrier RNA אזילה. איכויות בסיס חציון מחזור רצף של פולי (ע&quot;ר) -contaminated נגיף לסה ספריות (אדום) ובקרה (לא מוביל נצפה בספרייה, שחור) מדווח QC 13. שניהם לקרוא 1 ולקרוא 2 של סוף לזווג קורא ימוזגו בקובץ BAM הספרייה ואת ציוני איכות מוצגים בכל הבסיס. נתון זה יש הבדל בין 6. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> בניית פרטי פרוטוקול RNA-seq ויראלי של ספריות ישירות חילוץRNA שנאסף דגימות קליניות וביולוגיות. כדי להבטיח ביטחונם אישי, כל בסרום ויראלי, דגימות הפלזמה ורקמות צריכות להיות מובטלות מאגרים מתאימים לפני מיצוי RNA. בחלק ערכות איון והפקה, פולי מוביל (ע&quot;ר) RNA כלול; זו תוסר במהלך שלב דלדול סלקטיבית הראשוני RNase H. בהתבסס על התאוששות מלאה, הריכוז הצפוי של RNA המוביל הוא 100 ng / μl. בפרוטוקול, 110 ng / אוליגו μl RNA dT (ריכוז המוביל 1.1x) משמש דלדול. אם פולי (ע&quot;ר) ספק אינו נוכחי במדגם, אז אוליגו (DT) לא צריך להתווסף לפני הדלדול. הפרוטוקול הבא מיועד 24 תגובות בפורמט צלחת PCR (עד 250 נפח μl). גרסה קודמת של פרוטוקול כך מדווחת Matranga, et al. 6.

<table><tbody><tr><td>96-well PCR Plates</td><td>VWR</td><td>47743-953</td><td></td></tr><tr><td>Strips of Eight Caps</td><td>VWR</td><td>47745-512</td><td></td></tr><tr><td>Nuclease-free water</td><td>Ambion</td><td>AM9937</td><td>50 ml bottle</td></tr><tr><td>TURBO DNase</td><td>Ambion</td><td>AM2238</td><td>post RNA extraction step, 2 U/&amp;micro;l, buffer included</td></tr><tr><td>PCR cycler</td><td></td><td></td><td>any PCR cyclers&amp;nbsp;</td></tr><tr><td>Agencourt RNAClean XP SPRI beads&amp;nbsp;</td><td>Beckman Coulter Genomics</td><td>A63987</td><td>beads for RNA cleanup</td></tr><tr><td>Real Time qPCR system</td><td></td><td></td><td>any system</td></tr><tr><td>DynaMag-96 Side Skirted Magnet</td><td>Invitrogen</td><td>12027</td><td></td></tr><tr><td>70% Ethanol</td><td></td><td></td><td>prepare fresh</td></tr><tr><td>qRT-PCR primers</td><td>IDT DNA</td><td></td><td>see &lt;strong&gt;Table 2&lt;/strong&gt;</td></tr><tr><td>5 M NaCl&amp;nbsp;</td><td>Ambion</td><td>AM9760G</td><td></td></tr><tr><td>1 M Tris-HCl pH 7.4&amp;nbsp;</td><td>Sigma</td><td>T2663-1L</td><td></td></tr><tr><td>1 M Tris-HCl pH 7.5&amp;nbsp;</td><td>Invitrogen</td><td>15567-027</td><td></td></tr><tr><td>1 M MgCl&lt;sub&gt;2&lt;/sub&gt;&amp;nbsp;</td><td>Ambion</td><td>AM9530G</td><td></td></tr><tr><td>Linear acrylamide&amp;nbsp;</td><td>Ambion&amp;nbsp;</td><td>AM9520</td><td></td></tr><tr><td>DNA oligos covering entire rRNA region</td><td>IDT DNA</td><td></td><td>see &lt;strong&gt;Table 3&lt;/strong&gt;, order lab-ready at 100 &amp;micro;M</td></tr><tr><td>Oligo (dT)</td><td>IDT DNA</td><td></td><td>40 nt long, desalted</td></tr><tr><td>Hybridase Thermostable RNase H&amp;nbsp;</td><td>Epicentre</td><td>H39100</td><td></td></tr><tr><td>RNase-free DNase Kit&amp;nbsp;</td><td>Qiagen</td><td>79254</td><td>post selective depletion step</td></tr><tr><td>SUPERase-In RNase Inhibitor</td><td>Ambion</td><td>AM2694</td><td></td></tr><tr><td>Random Primers&amp;nbsp;</td><td>Invitrogen</td><td>48190-011</td><td>mostly hexamers</td></tr><tr><td>10 mM dNTP mix</td><td>New England Biolabs</td><td>N0447L</td><td></td></tr><tr><td>SuperScript III Reverse Transcriptase&amp;nbsp;</td><td>Invitrogen</td><td>18080-093</td><td>with first-strand buffer, DTT</td></tr><tr><td>Air Incubator</td><td></td><td></td><td>any air incubator cyclers&amp;nbsp;</td></tr><tr><td>NEBNext Second Strand Synthesis (dNTP-free) Reaction Buffer</td><td>New England Biolabs</td><td>B6117S</td><td>10x</td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; DNA Ligase</td><td>New England Biolabs</td><td>M0205L</td><td>10 U/&amp;mu;l</td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; DNA Polymerase I&amp;nbsp;</td><td>New England Biolabs</td><td>M0209L</td><td>10 U/&amp;mu;l</td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; RNase H</td><td>New England Biolabs</td><td>M0297L</td><td>2 U/&amp;mu;l</td></tr><tr><td>0.5 M EDTA</td><td>Ambion</td><td>AM9261</td><td></td></tr><tr><td>Agencourt AMPure XP SPRI beads</td><td>Beckman Coulter Genomics</td><td>A63881</td><td>beads for DNA cleanup</td></tr><tr><td>Elution Buffer&amp;nbsp;</td><td>Qiagen</td><td></td><td>10 mM Tris HCl, pH 8.5</td></tr><tr><td>Quant-iT dsDNA HS Assay Kit&amp;nbsp;</td><td>Invitrogen</td><td>Q32854</td><td></td></tr><tr><td>Qubit fluorometer&amp;nbsp;</td><td>Invitrogen</td><td>Q32857</td><td></td></tr><tr><td>Nextera XT DNA Sample Prep Kit&amp;nbsp;</td><td>Illumina</td><td>FC-131-1096</td><td></td></tr><tr><td>Nextera XT DNA Index Kit&amp;nbsp;</td><td>Illumina</td><td>FC-131-1001</td><td></td></tr><tr><td>Tapestation 2200</td><td>Agilent</td><td>G2965AA</td><td></td></tr><tr><td>High Sensitivity D1000 reagents</td><td>Agilent</td><td>5067-5585</td><td></td></tr><tr><td>High Sensitivity D1000 ScreenTape</td><td>Agilent</td><td>5067-5584</td><td></td></tr><tr><td>BioAnalyzer 2100&amp;nbsp;</td><td>Agilent</td><td>G2939AA</td><td></td></tr><tr><td>High Sensitivity DNA reagents</td><td>Agilent</td><td>5067-4626</td><td></td></tr><tr><td>Library Quantification Complete kit (Universal)</td><td>Kapa Biosystems</td><td>KK4824</td><td>alternative to tapestation, bioanalyzer for library quantification</td></tr></tbody></table>

unbiased deep sequencing of rna viruses from clinical samples

כאן אנו מתארים פרוטוקול רצף RNA הדור הבא המאפשר דה נובו אסיפות ושיחות גרסת תוך שורה של הגנום נגיפי שנאסף ממקורות קליניים וביולוגיים. השיטה היא משוחדת ואוניברסלית; היא משתמשת פריימרים אקראיים לסינתזת cDNA ואינה דורשת ידע מוקדם של תוכן רצף ויראלי. לפני בניית ספרייה, סלקטיבית RNase H מבוסס עיכול משמש כדי לרוקן RNA רצוי - כולל פולים (ע&quot;ר) מוביל ו- RNA ריבוזומלי - מן מדגם RNA ויראלי. דלדול סלקטיבי משפר הן את איכות הנתונים ומספר ייחודי קורא בספריות רצף RNA ויראלי. יתר על כן, הצעד מבוסס transposase &#39;tagmentation&#39; משמש בפרוטוקול כפי שהוא מקטין את זמן בניית ספרייה הכולל. הפרוטוקול אפשר רצף עמוק מהיר של מעל 600 לסה דגימות-כולל נגיף האבולה אוסף משני דם ורקמות מבודדות-והוא החלים רחב ללימודים הגנומיקה חיידקים אחרים.

הפרוטוקול המתואר מאפשר את הדור של רצף באיכות גבוהה קורא ממדגם רנ&quot;א נגיפיים נמוך קלט תוך העשרת תוכן ויראלי ייחודי. כפי שניתן לראות בתרשים 1, הפרוטוקול מועשר תוכן לסה וירוס ייחודי לפחות פי חמש בכל הדגימות (בהשוואה לקבוצת ביקורת הלא-מדולדל) עם לפחות ממיליון עותקים של 18S rRNA (~ 100 pg RNA סה&quot;כ). כמו כן, הצלחת רצף מתואמת גם עם כמות הנגיף בתוך מדגם נתון. שימוש qRT-PCR כתחליף כמות ויראלי, דגימות שהכילו ~ 1,000 או יותר עותקים הגנום נגיפיים לרוב נוצרו מכלולים מלאים (מידע לא מוצג). יתר על כן, דלדול של פולי (ע&quot;ר) מוביל מפחית רצפי homopolymer של A ו- T בספריות, וכתוצאה מכך הכנות מנקות והבטחת רצף באיכות טובה יותר קוראת (איור 2). ספריות סופיות ממדגמים קליניים ויראלי קלט נמוך בדרך כלל יש אורך קטע רחב בין 150 ל -1,000 נקודות בסיס(איור 3). לאחר רצף, כדי להפחית מדגם מזיהוי שגוי ו crosstalk בין ספריות בתוך ברכה 12, רק מדד קורא עם ציון איכות בסיס של 25 (שאלה 25) ולהבטיח אפס התאמות נשמרות בתהליך demultiplexing. הגנום נגיפי מורכב באמצעות צינור ביואינפורמטיקה ספציפי לאיתור וירוסים מסתעפים 2,4-6. כלים אלה זמינים ב https://github.com/broadinstitute/viral-ngs או באמצעות פלטפורמות ענן מסחריות 4. <table border="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שלב 1.1: תגובת DNase </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח לכל תגובה (μl) </td></tr><tr><td> חיץ 10x DNase </td><td> 7 </td></tr><tr><td> nuclease ללא מים </td><td> 6 </td></tr><tr><td> רנ&quot;א נגיפי שחולצו </td><td> 55 </td></tr><tr><td> DNase (2 U / &amp; #181; l) </td><td> 2 </td></tr><tr><td> נפח כולל </td><td> 70 </td></tr><tr><td> שלב 2.1: חיץ הכלאה 5x </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח עבור 1 מ&quot;ל (μl) </td></tr><tr><td> 5 M NaCl </td><td> 200 </td></tr><tr><td> 1 M טריס- HCl (pH 7.4) </td><td> 500 </td></tr><tr><td> nuclease ללא מים </td><td> 300 </td></tr><tr><td> נפח כולל </td><td> 1,000 </td></tr><tr><td> שלב 2.1: 10x RNase H התגובה חיץ </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח עבור 1 מ&quot;ל (μl) </td></tr><tr><td> 5 M NaCl </td><td> 200 </td></tr><tr><td> 1 M טריס- HCl (pH 7.5) </td><td> 500 </td></tr><tr><td> 1 M MgCl 2 </td><td> 200 </td></tr><tr><td> nuclease ללא מים </td><td> 500 </td></tr><tr><td> נפח כולל </td><td> 1,000 </td></tr><tr><td> שלב 2.1: מי wacrylamide ליניארי ה- i </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח עבור 1 מ&quot;ל חיץ (μl) </td></tr><tr><td> nuclease ללא מים </td><td> 992 </td></tr><tr><td> acrylamide ליניארית (5 מ&quot;ג / מ&quot;ל) </td><td> 8 </td></tr><tr><td> נפח כולל </td><td> 1,000 </td></tr><tr><td colspan="2"> שלב 2.2: תגובת הכלאת דלדול סלקטיבית </td></tr><tr><td> מֵגִיב </td><td> נפח לכל תגובה (μl) </td></tr><tr><td> מאגר הכלאה 5x </td><td> 2 </td></tr><tr><td> rRNA-דלדול תמהיל אוליגו (100 מיקרומטר) </td><td> 1.22 </td></tr><tr><td> אוליגו (ד) T (550 ng / μl) </td><td> 1 </td></tr><tr><td> שטופלו DNase רנ&quot;א הכל </td><td> עד 5 </td></tr><tr><td> ספייק-ב RNA (זה הוא אופציונלי) </td><td> 0.5 </td></tr><tr><td> מים (עם acrylamide ליניארי) </td><td> להביא עד 10 סה&quot;כ </td></tr><tr><td> volu סה&quot;כלִי </td><td> 10 </td></tr><tr><td colspan="2"> שלב 2.3: תגובת H RNase דלדול סלקטיבית </td></tr><tr><td> מֵגִיב </td><td> נפח לכל תגובה (μl) </td></tr><tr><td> מאגר התגובה 10x RNase H </td><td> 2 </td></tr><tr><td> מים (עם acrylamide ליניארי) </td><td> 5 </td></tr><tr><td> RNase H Thermostable (5 U / μl) </td><td> 3 </td></tr><tr><td> נפח כולל </td><td> 10 </td></tr><tr><td colspan="2"> שלב 2.4: דלדול סלקטיבית פוסט התגובה DNase </td></tr><tr><td> מֵגִיב </td><td> נפח לכל תגובה (μl) </td></tr><tr><td> 10x DNase הצפה </td><td> 7.5 </td></tr><tr><td> מים (עם acrylamide ליניארי) </td><td> 44.5 </td></tr><tr><td> מעכב RNase (20 U / μl) </td><td> 1 </td></tr><tr><td> RNase ללא DNase אני (2.72 U / μl) </td><td> 2 </td></tr&gt; <tr><td> נפח כולל (עם תגובת RNase H) </td><td> 75 </td></tr><tr><td colspan="2"> שלב 3.1: סינתזת cDNA, כלאה פריימר אקראי </td></tr><tr><td> מֵגִיב </td><td> נפח לכל תגובה (μl) </td></tr><tr><td> rRNA / מדולדל המוביל RNA </td><td> 10 </td></tr><tr><td> 3 מיקרוגרם פריימר אקראי </td><td> 1 </td></tr><tr><td> נפח כולל </td><td> 11 </td></tr><tr><td> שלב 3.2: סינתזת תגובת cDNA גדיל הראשון </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח (μl) </td></tr><tr><td> מאגר התגובה 5x ראשון סטרנד </td><td> 4 </td></tr><tr><td> 0.1 M DTT </td><td> 2 </td></tr><tr><td> לערבב 10 מ&quot;מ dNTP </td><td> 1 </td></tr><tr><td> מעכב RNase (20 U / μl) </td><td> 1 </td></tr><tr><td> טרנסקריפטאז הפוך (להוסיף אחרון) </td><td> 1 </td></tr><tr><td> נפח כולל (עם RNA לעיל) &lt;/ Td&gt; <td> 20 </td></tr><tr><td colspan="2"> שלב 3.3: סינתזת התגובה cDNA גדיל שנית </td></tr><tr><td> מֵגִיב </td><td> נפח (μl) </td></tr><tr><td> RNase ללא מים </td><td> 43 </td></tr><tr><td> 10x הצפת התגובה השנייה סטרנד </td><td> 8 </td></tr><tr><td> לערבב 10 מ&quot;מ dNTP </td><td> 3 </td></tr><tr><td> E. coli DNA האנזים (10 U / μl) </td><td> 1 </td></tr><tr><td> E. coli DNA פולימראז אני (10 U / μl) </td><td> 4 </td></tr><tr><td> E. coli RNase H (2 U / μl) </td><td> 1 </td></tr><tr><td> נפח כולל (עם 1 st גדיל תגובה) </td><td> 80 </td></tr><tr><td> שלב 4.2: תגובת Tagmentation </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח (μl) </td></tr><tr><td> Amplicon Tagment Mix (ATM) </td><td> 1 </td></tr><tr><td> Tagment DNA הצפה (TD) </t<html> ד&gt; <td> 5 </td></tr><tr><td> נפח כולל (עם cDNA) </td><td> 10 </td></tr><tr><td> שלב 4.3: תגובת הספרייה PCR </td><td></td></tr><tr><td> מֵגִיב </td><td> נפח (μl) </td></tr><tr><td> מיקס מאסטר PCR (NPM) </td><td> 7.5 </td></tr><tr><td> פריימר מדד 1 (i7) </td><td> 2.5 </td></tr><tr><td> פריימר מדד 2 (i5) </td><td> 2.5 </td></tr><tr><td> הנפח הכולל (עם tagmented cDNA) </td><td> 25 </td></tr><tr><td> שלב 4.3.2: תנאי PCR ספרייה </td><td></td></tr><tr><td> 72 ° C, 3 דקות </td><td></td></tr><tr><td> 95 מעלות צלזיוס, 30 שניות </td><td></td></tr><tr><td colspan="2"> עד 18 מחזורי 10 שניות על 95 מעלות צלזיוס, 30 שניות על 55 מעלות צלזיוס, 30 שניות על 72 מעלות צלזיוס </td></tr><tr><td> 72 מעלות צלזיוס, 5 דקות </td><td></td></tr><tr><td> 10 ° C, לנצח </td><td></td></tr></tbody></table>FO: keep-together.within-page = &quot;1&quot;&gt; טבלה 1:. עד שנקבע התגובה מאגרים שלב-אחר-צעד שולחנות עם התוכן של כל מאגרים ותערובות התגובה. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שם אוליגו </td><td> רצף (5 &#39;ל 3&#39;) </td></tr><tr><td> אבולה KGH FW </td><td> GTCGTTCCAACAATCGAGCG </td></tr><tr><td> RV אבולה KGH </td><td> CGTCCCGTAGCTTTRGCCAT </td></tr><tr><td> אבולה KULESH FW </td><td> TCTGACATGGATTACCACAAGATC </td></tr><tr><td> RV אבולה KULESH </td><td> GGATGACTCTTTGCCGAACAATC </td></tr><tr><td> לסה SL FW </td><td> CC AAB GTA AGC CCA GCD GYA </td></tr><tr><td> RV לסה SL </td><td> AAG CCA CAG AAA RCT GGS AGC </td></tr><tr><td> 18S rRNA FW </td><td> TCCTTTAACGAGGATCCATTGG </td></tr><tr><td> RV 18S rRNA </td><td> CGAGCTTTTTAACTGCAGCAACT </td></tr></tbody></tמסוגל&gt; טבלה 2: qRT-PCR Primers רצפים Primers המשמש למדידת המארח (18S rRNA) ויראלי (אבולה לסה) תוכן.. &#39;KGH&#39; הוא בית חולים ממשלתי Kenema בסיירה לאונה, שבו פריימרים אבולה נבדקו 2. &#39;Kulesh&#39; הוא החוקר שעיצב את פריימר להגדיר 14. טבלה 3: RNA ריבוזומלי (rRNA) דלדול oligos 195 רצפים ארוכים 50-נוקלאוטיד משלים rRNA האדם דלדול סלקטיבית בשלב 6.. <a href="https://www.jove.com/files/ftp_upload/54117/Table_3.xlsx" target="_blank">אנא לחץ כאן להורדת הקובץ הזה.</a>

Watch this Scientific Journal Video about Unbiased Deep Sequencing of RNA Viruses from Clinical Samples at JoVE.com

Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

רצף עמוק משוחד של RNA וירוסי ממדגמים קליניים

Here we outline a next-generation RNA sequencing protocol that enables de novo assemblies and intra-host variant calls of viral genomes collected from ...

unbiased-deep-sequencing-of-rna-viruses-from-clinical-samples

Nanyang Technological University

Research

JoVE Journal

Medicine

16.9K Views.  Broad Institute of MIT and Harvard. This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

Video: Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

Using a Pan-Viral Microarray Assay (Virochip) to Screen Clinical Samples for Viral Pathogens

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence of novel viral pathogens, such as SARS coronavirus and 2009 pandemic H1N1 influenza virus, that are not detectable by traditional methods. To address these challenges, we have previously developed and validated a pan-viral microarray platform called the Virochip with the capacity to detect all known viruses as well as novel variants on the basis of conserved sequence homology1. Using the Virochip, we have identified the full spectrum of viruses associated with respiratory infections, including cases of unexplained critical illness in hospitalized patients, with a sensitivity equivalent to or superior to conventional clinical testing2-5. The Virochip has also been used to identify novel viruses, including the SARS coronavirus6,7, a novel rhinovirus clade5, XMRV (a retrovirus linked to prostate cancer)8, avian bornavirus (the cause of a wasting disease in parrots)9, and a novel cardiovirus in children with respiratory and diarrheal illness10. The current version of the Virochip has been ported to an Agilent microarray platform and consists of ~36,000 probes derived from over ~1,500 viruses in GenBank as of December of 2009. Here we demonstrate the steps involved in processing a Virochip assay from start to finish (~24 hour turnaround time), including sample nucleic acid extraction, PCR amplification using random primers, fluorescent dye incorporation, and microarray hybridization, scanning, and analysis.

Using a Pan-Viral Microarray Assay Virochip to Screen Clinical Samples for Viral Pathogens

The Virochip is a pan-viral microarray designed to simultaneously detect all known viruses as well as novel viruses on the basis of conserved sequence homology. Here we demonstrate how to run a Virochip assay to analyze clinical samples for the presence of both known and unknown viruses.

באמצעות assay הפאן ויראלי microarray (Virochip) אל מסך דוגמאות קליניות עבור פתוגנים ויראליים

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence ...

Immunology and Infection

Amplifying and Quantifying HIV-1 RNA in HIV Infected Individuals with Viral Loads Below the Limit of Detection by Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below 50-75 copies/ml) is necessary to gain insight to viral dynamics and virus host interactions in patients who naturally control the infection and those who are on combination antiretroviral therapy (cART). 
Here we describe how to amplify viral genomes by single genome sequencing (the SGS protocol) 13, 19 and how to accurately quantify HIV-1 RNA in patients with low viral loads (the single-copy assay (SCA) protocol) 12, 20. 
The single-copy assay is a real-time PCR assay with sensitivity depending on the volume of plasma being assayed. If a single virus genome is detected in 7 ml of plasma, then the RNA copy number is reported to be 0.3 copies/ml. The assay has an internal control testing for the efficiency of RNA extraction, and controls for possible amplification from DNA or contamination. Patient samples are measured in triplicate.
The single-genome sequencing assay (SGS), now widely used and considered to be non-labor intensive 3, 7, 12, 14, 15,is a limiting dilution assay, in which endpoint diluted cDNA product is spread over a 96-well plate. According to a Poisson distribution, when less than 1/3 of the wells give product, there is an 80% chance of the PCR product being resultant of amplification from a single cDNA molecule. SGS has the advantage over cloning of not being subjected to resampling and not being biased by PCR-introduced recombination 19. However, the amplification success of SCA and SGS depend on primer design. Both assays were developed for HIV-1 subtype B, but can be adapted for other subtypes and other regions of the genome by changing primers, probes, and standards.

Quantifying levels of HIV-1 RNA in plasma and sequencing single HIV-1 genomes from individuals with viral loads below the limit of detection (50-75 copies/ml) is difficult. Here we describe how to extract and quantify plasma viral RNA using a real time PCR assay that reliably measures HIV-1 RNA down to 0.3 copies/ml and how to amplify viral genomes by single genome sequencing, from samples with very low viral loads.

הגברה וכימות HIV-1 RNA אצל אנשים שנדבקו ב-HIV עם המון ויראלי מתחת לגבול של זיהוי על ידי מבחני קלינית רגילה

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below ...

High-throughput, Automated Extraction of DNA and RNA from Clinical Samples using TruTip Technology on Common Liquid Handling Robots

TruTip is a simple nucleic acid extraction technology whereby a porous, monolithic binding matrix is inserted into a pipette tip. The geometry of the monolith can be adapted for specific pipette tips ranging in volume from 1.0 to 5.0 ml. The large porosity of the monolith enables viscous or complex samples to readily pass through it with minimal fluidic backpressure. Bi-directional flow maximizes residence time between the monolith and sample, and enables large sample volumes to be processed within a single TruTip. The fundamental steps, irrespective of sample volume or TruTip geometry, include cell lysis, nucleic acid binding to the inner pores of the TruTip monolith, washing away unbound sample components and lysis buffers, and eluting purified and concentrated nucleic acids into an appropriate buffer. The attributes and adaptability of TruTip are demonstrated in three automated clinical sample processing protocols using an Eppendorf epMotion 5070, Hamilton STAR and STARplus liquid handling robots, including RNA isolation from nasopharyngeal aspirate, genomic DNA isolation from whole blood, and fetal DNA extraction and enrichment from large volumes of maternal plasma (respectively).

TruTip is a simple nucleic acid extraction technology whereby a porous, monolithic binding matrix is inserted into a pipette tip. Consequently, the sample preparation format is compatible with most liquid handling instruments, and can be used for many medium to high-throughput clinical applications and sample types.

הפקת תפוקה גבוהה, אוטומטית של DNA ו-RNA מדגימות קליניות באמצעות הטכנולוגיה TruTip על רובוטים טיפול נוזל נפוצים

TruTip is a simple nucleic acid extraction  technology whereby a porous, monolithic binding matrix is inserted into a  pipette tip. The geometry of the ...

Bioengineering

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, and was deployed to West Africa during the recent Ebola virus epidemic, highlighting this possibility. In addition to its practical advantages (low cost, ease of equipment transport and use), this technology also provides fundamental advantages over second-generation sequencing approaches, particularly the very long read length, ability to directly sequence RNA, and real-time availability of data. Raw read accuracy is lower than with other sequencing platforms, which represents the main limitation of this technology; however, this can be partially mitigated by the high read depth generated. Here, we present a field-compatible protocol for sequencing of the mRNAs encoding for Niemann-Pick C1, which is the cellular receptor for ebolaviruses. This protocol encompasses extraction of RNA from animal blood samples, followed by RT-PCR for target enrichment, barcoding, library preparation, and the sequencing run itself, and can be easily adapted for use with other DNA or RNA targets.

Nanopore sequencing is a novel technology that allows cost-effective sequencing in remote locations and resource-poor settings. Here, we present a protocol for sequencing of mRNAs from whole blood that is compatible with such conditions.

רצף של mRNA מתוך דם שלם באמצעות רצפי Nanopore

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...

Genetics

Validating Whole Genome Nanopore Sequencing, using Usutu Virus as an Example

Whole genome sequencing can be used to characterize and to trace viral outbreaks. Nanopore-based whole genome sequencing protocols have been described for several different viruses. These approaches utilize an overlapping amplicon-based approach which can be used to target a specific virus or group of genetically related viruses. In addition to confirmation of the virus presence, sequencing can be used for genomic epidemiology studies, to track viruses and unravel origins, reservoirs and modes of transmission. For such applications, it is crucial to understand possible effects of the error rate associated with the platform used. Routine application in clinical and public health settings require that this is documented with every important change in the protocol. Previously, a protocol for whole genome Usutu virus sequencing on the nanopore sequencing platform was validated (R9.4 flowcell) by direct comparison to Illumina sequencing. Here, we describe the method used to determine the required read coverage, using the comparison between the R10 flow cell and Illumina sequencing as an example.

We previously validated a protocol for amplicon-based whole genome Usutu virus (USUV) sequencing on a nanopore sequencing platform. Here, we describe the methods used in more detail and determine the error rate of the nanopore R10 flow cell.

אימות הגנום השלם רצף Nanopore, באמצעות וירוס אוסוטו כדוגמה

Whole genome sequencing can be used to characterize and to trace viral outbreaks. Nanopore-based whole genome sequencing protocols have been described for ...

Quantification and Whole Genome Characterization of SARS-CoV-2 RNA in Wastewater and Air Samples

Wastewater-based epidemiology has emerged as a promising and efficacious surveillance system for SARS-CoV-2 and other infectious diseases in many nations. The process typically involves wastewater concentration, nucleic acid extraction, amplification of selected genomic segments, and detection and quantification of the amplified genomic segment. This methodology can similarly be leveraged to detect and quantify infectious agents, such as SARS-CoV-2, in air samples. Initially, SARS-CoV-2 was presumed to spread primarily through close personal contact with droplets generated by an infected individual while speaking, sneezing, coughing, singing, or breathing. However, a growing number of studies have reported the presence of SARS-CoV-2 RNA in the air of healthcare facilities, establishing airborne transmission as a viable route for the virus. This study presents a composite of established protocols to facilitate environmental detection, quantification, and sequencing of viruses from both wastewater and air samples.

This protocol aims to quantify SARS-CoV-2 RNA in wastewater and air samples to be used for wastewater-based epidemiology studies and to assess the exposure risk to SARS-CoV-2 in indoor and outdoor aerosols. This protocol also describes a tiled amplicon long-template sequencing approach for SARS-CoV-2 whole genome characterization.

כימות ואפיון גנום שלם של RNA SARS-CoV-2 בדגימות שפכים ואוויר

Wastewater-based epidemiology has emerged as a promising and efficacious surveillance system for SARS-CoV-2 and other infectious diseases in many nations. ...

Environment

High-throughput Detection of Respiratory Pathogens in Animal Specimens by Nanoscale PCR

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of combining reactions together. We designed and evaluated a panel based on this principle to rapidly identify the presence of common disease agents in dogs and horses with acute respiratory illness. This manuscript describes a nanoscale diagnostic PCR workflow for sample preparation, amplification, and analysis of target pathogen sequences, focusing on procedures that are different from microliter scale reactions. In the respiratory panel presented, 18 assays were each set up in triplicate, accommodating up to 48 samples per plate. A universal extraction and pre-amplification workflow was optimized for high-throughput sample preparation to accommodate multiple matrices and DNA and RNA based pathogens. Representative data are presented for one RNA target (influenza A matrix) and one DNA target (equine herpesvirus 1). The ability to quickly and accurately test for a comprehensive, syndrome-based group of pathogens is a valuable tool for improving efficiency and ergonomics of diagnostic testing and for acute respiratory disease diagnosis and management.

High-throughput testing of DNA and RNA based pathogens by nanoscale PCR is described using a syndromic canine and equine respiratory PCR panel.

איתור תפוקה גבוהה של פתוגנים הנשימה בדגימות בעלי חיים על ידי ננו PCR

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of ...

Combining Analysis of DNA in a Crude Virion Extraction with the Analysis of RNA from Infected Leaves to Discover New Virus Genomes

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low titers in their host or cannot be mechanically inoculated to another host are difficult to propagate to achieve a greater titer of infectious material. Infected leaves are ground in a mild buffer with optimal pH and ionic composition recommended for purifying most bacilliform Para retroviruses. Urea is used to break up inclusion bodies that trap virions and to dissolve cellular components. Differential centrifugation provides further separation of virions from plant contaminants. Then proteinase K treatment removes the capsids. Then the viral DNA is concentrated and used for next-generation sequencing (NGS). The NGS data are used to assemble contigs which are submitted to NCBI-BLASTn to identify a subset of virus sequences in the generated dataset. In a parallel pipeline, RNA is isolated from infected leaves using a standard column-based RNA extraction method. Then ribosome depletion is carried out to enrich for a subset of mRNA and virus transcripts. Assembled sequences derived from RNA sequencing (RNA-seq) were submitted to NCBI-BLASTn to identify a subset of virus sequences in this dataset. In our study, we identified two related full-length badnavirus genomes in the two datasets. This method is preferred to another common approach which extracts the aggregate population of small RNA sequences to reconstitute plant virus genomic sequences. This latter metagenomic pipeline recovers virus related sequences that are retro-transcribing elements inserted into the plant genome. This is coupled to biochemical or molecular assays to further discern the actively infectious agents. The approach documented in this study, recovers sequences representative of replicating viruses that likely indicate active virus infection.

Here we present a new approach to identify plant viruses with double-strand DNA genomes. We use standard methods to extract DNA and RNA from infected leaves and carry out next-generation sequencing. Bioinformatic tools assemble sequences into contigs, identify contigs representing virus genomes and assign genomes to taxonomic groups.

שילוב ניתוח של דנ א ב מיצוי Virion גולמי עם הניתוח של RNA של עלים נגועים לגלות הגנום וירוס חדש

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low ...

Swabbing the Urban Environment - A Pipeline for Sampling and Detection of SARS-CoV-2 From Environmental Reservoirs

To control community transmission of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) during the 2020 global pandemic, most countries implemented strategies based on direct human testing, face covering, and surface disinfection. Under the assumption that the main route of transmission includes aerosols and respiratory droplets, efforts to detect SARS-CoV-2 in fomites have focused on locations suspected of high prevalence (e.g., hospital wards, cruise ships, and mass transportation systems). To investigate the presence of SARS-CoV-2 on surfaces in the urban environment that are rarely cleaned and&#160;seldomly disinfected, 350 citizens were enlisted from the greater San Diego County. In total, these citizen scientists collected 4,080 samples. An online platform was developed to monitor sampling kit delivery and pickup, as well as to collect sample data. The sampling kits were mostly built from supplies available in pandemic-stressed stores. Samples were processed using reagents that were easy to access despite the recurrent supply shortage. The methods used were highly sensitive and resistant to inhibitors that are commonly present in environmental samples. The proposed experimental design and processing methods were successful at engaging numerous citizen scientists who effectively gathered samples from diverse surface areas. The workflow and methods described here are relevant to survey the urban environment for other viruses, which are of public health concern and pose a threat for&#160;future pandemics.

A citizen science project was designed to recruit San Diego residents to collect environmental samples for SARS-CoV-2. A multilingual web-based platform was created for data submission using a user-friendly mobile device interface. A laboratory information management system facilitated the collection of thousands of geographically diverse samples with real-time outcome tracking.

סניקה של הסביבה העירונית - צינור לדגימה וזיהוי של SARS-CoV-2 ממאגרים סביבתיים

To control community transmission of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) during the 2020 global pandemic, most countries ...

Biology

גישה גנומית מבוססת ננופור להדברת כלבת במדינות בעלות הכנסה נמוכה

Whole Genome Sequencing for Rapid Characterization of Rabies Virus Using Nanopore Technology

Genomic data can be used to track the transmission and geographic spread of infectious diseases. However, the sequencing capacity required for genomic surveillance remains limited in many low- and middle-income countries (LMICs), where dog-mediated rabies and/or rabies transmitted by wildlife such as vampire bats pose major public health and economic concerns. We present here a rapid and affordable sample-to-sequence-to-interpretation workflow using nanopore technology. Protocols for sample collection and the diagnosis of rabies are briefly described, followed by details of the optimized whole genome sequencing workflow, including primer design and optimization for multiplex polymerase chain reaction (PCR), a modified, low-cost sequencing library preparation, sequencing with live and offline base calling, genetic lineage designation, and phylogenetic analysis. Implementation of the workflow is demonstrated, and critical steps are highlighted for local deployment, such as pipeline validation, primer optimization, inclusion of negative controls, and the use of publicly available data and genomic tools (GLUE, MADDOG) for classification and placement within regional and global phylogenies. The turnaround time for the workflow is 2-3 days, and the cost ranges from $25 per sample for a 96 sample run to $80 per sample for a 12 sample run. We conclude that setting up rabies virus genomic surveillance in LMICs is feasible and can support progress toward the global goal of zero dog-mediated human rabies deaths by 2030, as well as enhanced monitoring of wildlife rabies spread. Moreover, the platform can be adapted for other pathogens, helping to build a versatile genomic capacity that contributes to epidemic and pandemic preparedness.

Author Spotlight: זרימת עבודה גנומית חסכונית לקידום הדברת כלבת בסביבות מוגבלות במשאבים 

Here, we present a rapid and cost-effective workflow for characterizing rabies virus (RABV) genomes using nanopore technology. The workflow is intended to support genomics-informed surveillance at a local level, providing information on circulating RABV lineages and their placement within regional phylogenies to guide rabies control measures.

ריצוף גנום שלם לאפיון מהיר של נגיף הכלבת בטכנולוגיית ננופור

Genomic data can be used to track the transmission and geographic spread of infectious diseases. However, the sequencing capacity required for genomic ...