This work has been funded in part with Federal funds from the National Institutes of Health, Office of Director, Innovator (No.: DP2OD06514) (PCS) and from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health and Human Services, under Contracts (No:HHSN272200900018C, HHSN272200900049C and U19AI110818).

Ethik-Anweisung: Lassa-Fieber-Patienten wurden für diese Studie rekrutiert unter Verwendung von Protokollen von menschlichen Probanden Ausschüsse an der Tulane Universität genehmigt, Harvard University, Broad Institute, Irrua Fach Teaching Hospital (ISTH), Kenema Regierungskrankenhaus (KGH), Oyo Staatsministerium für Gesundheit, Ibadan , Nigeria und Sierra Leone Ministerium für Gesundheit. Alle Patienten wurden mit einem ähnlichen Standard der Behandlung behandelt und das Medikament Ribavirin angeboten, auch nicht entschieden, sie in der Studie teilzunehmen. Für Lassa-Fieber (LF) der Patienten, die Behandlung mit Ribavirin folgte den derzeit empfohlenen Richtlinien und wurde in der Regel so schnell wie LF angeboten wurde stark vermutet. Aufgrund der schweren Ausbruch für Ebola-Virus-Krankheit (EVD), Patienten, die nicht durch unsere Standardprotokolle zugestimmt werden konnte. Verwendung von klinischen überschüssigen Proben von EVD Patienten Stattdessen wurde von Institutional Review Boards in Sierra Leone und an der Harvard University bewertet und genehmigt. Die Office des Sierra Leone Ethik und Scientific Review Committee, die Sierra Leone Ministerium für Gesundheit und Hygiene, und der Harvard Ausschuss für die Verwendung von menschlichen Probanden haben einen Verzicht auf Zustimmung erteilt zu sequenzieren und öffentlich verfügbaren viralen Sequenzen von Patienten und Kontaktproben erhalten machen während des Ebola-Ausbruch in Sierra Leone gesammelt. Diese Stellen auch die Verwendung von klinischen und epidemiologischen Daten für de-identifizierte Proben aus allen Verdacht EVD Patienten während des Ausbruchs Antwort zu erhalten Pflege gesammelt gewährt. Die Sierra Leone Ministerium für Gesundheit und Hygiene auch die Verbringung von nicht-infektiösen, nicht-biologische Proben von Sierra Leone auf dem Broad Institute und der Harvard University für genomischen Untersuchungen bei Ausbruch Proben genehmigt. 1. DNase-Behandlung der Proben-RNA (bis zu 55 &amp; mgr; l Extrahierte Gesamt-RNA, ~ 4 h) <ol><li> Stellen Sie die DNase - Reaktion in einer 96-Well PCR - Platte auf Eis in einem Bio - Sicherheitsschrank nach oben , wie in Tabelle 1 beschrieben , </strong&gt;, Schritt 1.1 (Gesamtvolumen 70 ul / Vertiefung). Hinweis: Ein Master-Mix hergestellt werden können. </li><li> Vortex sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. </li><li> für 30 min bei 37 ° C inkubieren. </li><li> Cleanup unter Verwendung von RNA Solid Phase Reversible Immobilisation (SPRI) Perlen. <ol><li> Warm RNA Perlen für 30 min auf RT. </li><li> Sanft RNA Perlen Flasche schütteln alle magnetischen Partikel zu suspendieren, die bereits gelöst haben. In 1.8x Volumen (126 ul) von RNA-Perlen zu DNase behandelten RNA (70 &amp; mgr; l), mischen Sie mit einer Pipette 10-mal und Inkubation für 5 min bei RT (Gesamtvolumen in gut 196 ul). </li><li> Setzen Sie Mischung auf dem Magnetstation. Warten, bis die Lösung klar (5 - 10 min). </li><li> Entfernen gelöscht Lösung, während auf der Station mit einer Pipette und entsorgen. Während auf der Station, waschen Perlen durch Pellet mit 70% Ethanol bedeckt und für 1 min inkubiert. Entfernen Ethanol mit Pipette und entsorgen. Wiederholen für insgesamt zwei Waschungen. Hinweis: Die Verwendung genau 70% frisch zubereitet etHANOL ist kritisch, da ein höherer Prozentsatz in ineffizienten Waschen von kleineren Molekülen führen, während &lt;70% Ethanolverlust der Probe 7 führen könnte. </li><li> Halten Sie Platte auf der Station und offen lassen, an der Luft trocknen. Hinweis: Stellen Sie sicher, dass die Kügelchen vollständig trocknen lassen, bis Perlen zu knacken beginnen. </li><li> In 55 ul Nuklease-freies Wasser auf die Platte RNA zu eluieren. Entfernen Platte von der Station die Perlen zu mischen und Wasser durch sorgfältiges Pipettieren. Hinweis: Alternativ können Sie auch weniger Wasser (≤ 10 &amp; mgr; l), um die Gesamt-RNA zu konzentrieren. </li><li> Legen Sie die Platte wieder auf die Station. Warten Sie, bis die Lösung mit einer Pipette auf neue Schraubverschluss Rohr für die Langzeitlagerung (-80 ° C) zu übertragen löscht. Platz 5 ul RNA in neue 96-Well-PCR-Platte zur Abreicherung (Schritt. 2.4). </li><li> Optional:. Speichern und verdünnen 1 ul in 19 &amp; mgr; l Wasser (1:20) für qRT-PCR von rRNA (zB 18S, 28S rRNA) (Tabelle 2) und Virusmarker 5 &lt;/ Li&gt; </ol></li></ol> 2. Selektive Depletion von ribosomalen und Carrier-RNA aus Viral RNA-Probe (ca. 4 h) <ol><li> Machen Sie 5x Hybridisierung und 10x RNase H Reaktionspuffer und nukleasefreiem Wasser mit linearen Acrylamid Träger , wie in Tabelle 1 beschrieben. </li><li> Set up Hybridisierungsreaktion von RNA mit rRNA Verarmungs Oligos (Tabelle 3) und Oligo (dT) auf Eis in einem 96-Well - PCR - Platte kombiniert , wie in Tabelle 1 beschrieben. Hinweis: Ein Master-Mix hergestellt werden können. 50 Femtogramm (fg) einer einzigartigen synthetischen RNA (ERCCs 8) für die Verfolgung sowohl der viralen Sequenzierung und potenziellen Index gelesen Kreuzkontamination hinzugefügt werden. <ol><li> Vortex sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. bei 95 ° C inkubieren für 2 min, langsam erhöhende bis 45 ° C bei -0,1 ° C pro sec. Halten Sie den Thermocycler bei 45 ° C. </li></ol></li><li> Richten Sie RNase H-Reaktionsmischung auf Eis, wie beschreibenVorwärmen d in Tabelle 1, dann bei 45 ° C für 2 min. Hinweis: Ein Master-Mix hergestellt werden können. <ol><li> Fügen Sie die vorgewärmte RNase H-Mix in die Hybridisierungsreaktion in der Platte, während die Platte bei 45 ° C in den Thermocycler zu halten. </li><li> Gut mischen durch vorsichtiges Pipettieren 6 - 8 mal. für weitere 30 min bei 45 ° C inkubieren. Legen Sie auf dem Eis. </li></ol></li><li> Stellen Sie die DNase - Reaktionsmischung auf Eis, wie in Tabelle 1 beschrieben . Hinweis: Ein Master - Mix hergestellt werden können. <ol><li> In der RNase H-Reaktion in der Platte, Wirbel sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. für 30 min bei 37 ° C inkubieren. </li><li> Stopp DNase Reaktion durch Zugabe von 5 ul 0,5 M EDTA. Vortex sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. </li></ol></li><li> Cleanup unter Verwendung von RNA-Kügelchen (siehe Schritt 1.3) mit einem 1,8x Volumen (144 ul) Perlen. Eluieren in 11 ul Nuklease-freies Wasser. Hinweis: Für einen sicheren Kaltlagerung, Lager abgereichertem RNA-Proben bei -80 ° C O / N. </li></ol> 3. cDNA Synthesis (~ 6 h) <ol><li> Mix rRNA / Träger-verarmten RNA mit zufälligen Primern auf Eis in einer 96-Well PCR - Platte , wie in Tabelle 1 beschrieben, Wirbel sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. <ol><li> Das Gemisch wird auf 70 ° C für 10 min in einem Thermocycler. Unmittelbar nach Hitzedenaturierung, legen Sie die RNA auf Eis für 1 - 5 min. Nicht in die RNA (auch auf Eis) stehen für länger als 5 Minuten vor dem ersten Strang Reaktion. </li></ol></li><li> Erstes Strangsynthese - Reaktionsmischung auf Eis, wie in Tabelle 1 beschrieben. Hinweis: Ein Master-Mix hergestellt werden können. <ol><li> In den RNA / Random-Primer-Mix in der Platte, Wirbel sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. Inkubieren bei 22 - 25 ° C für 10 min. </li><li> bei 55 ° C inkubieren für 60 min in einem Luft Inkubator. Legen Sie die Platte auf Eis, um die Reaktion zu beenden. Nichte: Die Verwendung eines Luft-Inkubator wird empfohlen die Glühung Primern während dessen allmähliche Erwärmung der Erststrang-Reaktion zu erzeugen, und der erste Strang zu dehnen beginnt. </li></ol></li><li> Set Zweitstrangsynthese - Reaktionsmischung auf Eis, wie in Tabelle 1 beschrieben. Hinweis: Ein Master-Mix hergestellt werden können. <ol><li> In den ersten Strangsynthesereaktion in der Platte, Wirbel sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. Inkubieren für 2 Stunden bei 16 ° C (halten Deckel bei 25 ° C). Lassen Sie nicht die Temperatur über 16 ° C steigen. </li><li> Legen Sie die Platte auf Eis, dann inaktivieren Reaktion durch Zugabe von 5 ul 0,5 M EDTA, vorsichtig mischen und gründlich, dann Zentrifuge bei 280 × g bei RT für 1 min. </li></ol></li><li> Cleanup mit DNA-Kügelchen (Schritt 1.3 für Protokoll sehen) unter Verwendung von 1,8x Volumen (153 ul) von Perlen. Eluieren in 9 &amp; mgr; l Elutionspuffer (EB). Speichern 1 ul für die Quantifizierung. Verwenden Sie 1 ng cDNA für subsequent Schritte. Wenn cDNA-Konzentration zu niedrig ist, zu erfassen, verwenden 4 ul cDNA für tagmentation (siehe Schritt 4.1). </li><li> Für einen sicheren Kaltlagerung, zu speichern doppelsträngige cDNA bei 4 ° CO / N oder -20 ° C zur Langzeitlagerung. </li></ol> 4. Bibliothek Vorbereitung - DNA Library Construction (~ 4 h) <ol><li> Transfer 4 ul cDNA in eine 96-Well-Platte und die verbleibende cDNA für einen zweiten Versuch zu speichern, wenn nötig. </li><li> Stellen Sie die tagmentation Reaktion auf Eis, wie in Tabelle 1 beschrieben. Hinweis: Ein Master-Mix hergestellt werden können. Um Hintergrund und die Gesamtkosten, das Gesamtvolumen der tagmentation Reaktion reduzieren wird von 20 auf 10 &amp; mgr; l reduziert. Wie cDNA der begrenzende Faktor ist, wird die Menge von ATM verwendet (dh transposome) in der Reaktion ebenfalls verringert die Zahl der Integrationsstellen zu verringern. <ol><li> Hinzufügen tagmentation Mischung cDNA in der Platte, vortex sanft und gründlich und Zentrifuge bei 280 xg (bei RT) für 1 min.Inkubieren bei 55 ° C für 5 min Halten bei 10 ° C. </li><li> Nachdem bei 10 ° C, fügen Sie sofort 2,5 ul Neutralize Tagment Buffer (NT), um die Reaktion zu beenden. Mischen durch Pipettieren von oben und unten, dann Zentrifuge bei 280 xg (bei RT) für 1 min. </li><li> 5 min bei RT inkubiert. </li></ol></li><li> Set up PCR Amplifikationsreaktion auf Eis , wie in Tabelle 1 beschrieben. <ol><li> Vortex sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. </li><li> Führen PCR auf Thermocycler unter Verwendung der Bedingungen , die in Tabelle 1. Hinweis: 12 PCR-Zyklen werden für 1 ng cDNA tagmented vorgeschlagen; jedoch virale klinischen Proben haben oft nicht nachweisbar Mengen an cDNA. Für geringe Mengen an cDNA (&lt;1 ng), verwenden Sie bis 18 PCR-Zyklen bis genug Bibliothek für die Sequenzierung erstellen. </li></ol></li><li> Bibliothek Vorbereitung - Bereinigung und Bündelung für die Sequenzierung <ol><li> Bringen Probe bis zu 50 &amp; mgr; l mit EB. </li><li> Cleanup mitDNA-Kügelchen (Schritt 1.3 für Protokoll sehen) unter Verwendung von 0,6x Volumen (30 ul) Perlen. Eluieren in 15 ul EB. </li><li> Die Konzentration der Bibliothek (Abbildung 3) durch die Durchführung Bereichsanalyse (150 bis 1.000 bp) mit Bioanalyzer Software 9, ohne Primer - Dimere (~ 120 bp) aus der Region Analyse. Hinweis: Alternativ können qPCR verwendet werden , um Bibliotheken zu quantifizieren 10. </li><li> Pool-Bibliotheken auf der niedrigsten molaren Konzentration von 1 nM oder mehr beträgt. Wenn Bibliothek unter 1 nM ist, fügen Sie ein kleines Volumen von Bibliothek Pool (~ 1x Volumen von anderen Bibliotheken) Sequenzinformationen aus diesen Bibliotheken zu erfassen. </li><li> Cleanup-Pool mit 0,7x DNA Perlen wie oben beschrieben (siehe Schritt 2). Eluieren in 15 ul EB. Hinweis: Volumen der Perlen auf dem endgültigen Volumen des Beckens ab. </li><li> Analysieren Pool 9. Bestimmen Sie molare Konzentration nach Regionen Analyse der Durchführung (150 bis 1.000 bp) 9. Hinweis: Alternativ können qPCR verwendet werden Bibliothek Pool zu quantifizieren 10 &lt;/ Sup&gt;. </li><li> Last - Sequenzer auf 10.00 Uhr Bibliothek Konzentration 101 bp zu erzeugen, gepaart-End liest mit Dual - Barcode 11 liest. </li></ol></li></ol><img alt="Figur 3" src="/files/ftp_upload/54117/54117fig3.jpg" /> Abbildung 3. Bibliotheken Hergestellt aus Ebola Virus klinischen Proben. Gel - Bild von 4 repräsentativen Ebola - Virus (EBOV) Bibliotheken. Regionen der Bibliothek und der Primer - Dimere werden angezeigt. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig3large.jpg" target="_blank">Bitte hier klicken</a> , um <a href="https://www.jove.com/files/ftp_upload/54117/54117fig3large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a>

<ol>
	<li>Stremlau, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+novel+rhabdoviruses+in+the+blood+of+healthy+individuals+from+West+Africa.">Discovery of novel rhabdoviruses in the blood of healthy individuals from West Africa.</a> PLoS Negl Trop Dis. 9, e0003631 (2015).</li><li>Gire, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+surveillance+elucidates+Ebola+virus+origin+and+transmission+during+the+2014+outbreak.">Genomic surveillance elucidates Ebola virus origin and transmission during the 2014 outbreak.</a> Science. 345, 1369-1372 (2014).</li><li>Morlan, J. D., Qu, K., Sinicropi, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+depletion+of+rRNA+enables+whole+transcriptome+profiling+of+archival+fixed+tissue.">Selective depletion of rRNA enables whole transcriptome profiling of archival fixed tissue.</a> PLoS One. 7, e42882 (2012).</li><li>Park, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ebola+Virus+Epidemiology,+Transmission,+and+Evolution+during+Seven+Months+in+Sierra+Leone.">Ebola Virus Epidemiology, Transmission, and Evolution during Seven Months in Sierra Leone.</a> Cell. 161, 1516-1526 (2015).</li><li>Andersen, K. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+Sequencing+Uncovers+Origins+and+Evolution+of+Lassa+Virus.">Clinical Sequencing Uncovers Origins and Evolution of Lassa Virus.</a> Cell. 162, 738-750 (2015).</li><li>Matranga, C. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+methods+for+unbiased+deep+sequencing+of+Lassa+and+Ebola+RNA+viruses+from+clinical+and+biological+samples.">Enhanced methods for unbiased deep sequencing of Lassa and Ebola RNA viruses from clinical and biological samples.</a> Genome Biol. 15, 519 (2014).</li><li>Tang, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Seq+analysis+to+capture+the+transcriptome+landscape+of+a+single+cell.">RNA-Seq analysis to capture the transcriptome landscape of a single cell.</a> Nat Protoc. 5, 516-535 (2010).</li><li>Jiang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+spike-in+standards+for+RNA-seq+experiments.">Synthetic spike-in standards for RNA-seq experiments.</a> Genome Res. 21, 1543-1551 (2011).</li><li>. Kapa Biosystems Available from: <a target="_blank" href="https://www.kapabiosystems.com/product-applications/products/next-generation-sequencing-2/library-quantification/">https://www.kapabiosystems.com/product-applications/products/next-generation-sequencing-2/library-quantification/</a> (2015)</li><li>. Illumina Technologies Available from: <a target="_blank" href="https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/preparing-libraries-for-sequencing-on-miseq-15039740-d.pdf">https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/preparing-libraries-for-sequencing-on-miseq-15039740-d.pdf</a> (2015)</li><li>Kircher, M., Sawyer, S., Meyer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double+indexing+overcomes+inaccuracies+in+multiplex+sequencing+on+the+Illumina+platform.">Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform.</a> Nucleic Acids Res. 40, 3 (2012).</li><li>Trombley, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+panel+of+real-time+TaqMan+polymerase+chain+reaction+assays+for+detection+and+absolute+quantification+of+filoviruses,+arenaviruses,+and+New+World+hantaviruses.">Comprehensive panel of real-time TaqMan polymerase chain reaction assays for detection and absolute quantification of filoviruses, arenaviruses, and New World hantaviruses.</a> Am J Trop Med Hyg. 82, 954-960 (2010).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serial+high-resolution+analysis+of+blood+virome+and+host+cytokines+expression+profile+of+a+patient+with+fatal+H7N9+infection+by+massively+parallel+RNA+sequencing.">Serial high-resolution analysis of blood virome and host cytokines expression profile of a patient with fatal H7N9 infection by massively parallel RNA sequencing.</a> Clin Microbiol Infect. 21, 713 (2015).</li><li>Simon-Loriere, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lineages+of+Ebola+virus+in+Guinea+during+the+2014+West+African+epidemic.">Distinct lineages of Ebola virus in Guinea during the 2014 West African epidemic.</a> Nature. 524, 102-104 (2015).</li><li>Folarin, O. A., Happi, A. N., Happi, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empowering+African+genomics+for+infectious+disease+control.">Empowering African genomics for infectious disease control.</a> Genome Biol. 15, 515 (2014).</li><li>Blainey, P. C., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+MDA+for+enumeration+of+total+nucleic+acid+contamination.">Digital MDA for enumeration of total nucleic acid contamination.</a> Nucleic Acids Res. 39, 19 (2011).</li><li>Malboeuf, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+viral+RNA+genome+sequencing+of+ultra-low+copy+samples+by+sequence-independent+amplification.">Complete viral RNA genome sequencing of ultra-low copy samples by sequence-independent amplification.</a> Nucleic Acids Res. 41, 13 (2013).</li><li>Gonzalez, I. L., Sylvester, J. E., Smith, T. F., Stambolian, D., Schmickel, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosomal+RNA+gene+sequences+and+hominoid+phylogeny.">Ribosomal RNA gene sequences and hominoid phylogeny.</a> Mol Biol Evol. 7, 203-219 (1990).</li><li>Adiconis, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+RNA+sequencing+methods+for+degraded+or+low-input+samples.">Comparative analysis of RNA sequencing methods for degraded or low-input samples.</a> Nat Methods. 10, 623-629 (2013).</li></ol>

The authors have no competing financial interests.

Das skizzierte Ansatz ermöglicht robuste, universelle, schnelle Sequenzierung und wurde zur Sequenzierung von Ebola - Virus während der 2014 Ausbruch 2,4 verwendet. Durch die Kopplung selektive Depletion und cDNA-Synthese mit tagmentation Bibliothekskonstruktion wurde die Gesamtprozesszeit um ~ 2 Tage reduziert von früheren Methoden Adaptorligation. In jüngerer Zeit wurde dieses Protokoll , das von internationalen Mitarbeiter und andere mit großem Erfolg 15,16 und wird eingesetzt , um Labors in Westafrika zu unterstützen lokale Genomik-basierte Studien und Diagnostik 17 eingesetzt. Das hier beschriebene Protokoll verwendet Zufallsprimer cDNA-RNA-seq-Bibliotheken für die virale vorzubereiten. Im Gegensatz zu früheren viralen RNA-seq Ansätze, es erfordert keine a priori Kenntnis von Sequenzdaten oder aufwendige und zeitraubende Primerdesign für einen bestimmten Virus oder Klade. Das Verfahren kann auf jede viral RNA Probe angewendet werden. Beispielsweise wurde es verwendet, viralen Gehalt von sowohl Ebola zu erzeugenund Lassa Proben 6. Das Protokoll kann auch Projekte für Host transkriptomischen, Metagenom und Erreger Entdeckung Sequenzierung 1 verwendet werden. Ein kritischer Schritt des Protokolls wird RNase H Verdau gezielte, ein Hochdurchsatz, kostengünstiges Verfahren zum Entfernen von unerwünschten Träger- und Host-RNA aus viralen Proben. Die selektive Depletion Schritt des Protokolls verwendet viele Komponenten und erfordert Geschicklichkeit und Genauigkeit. Extra-Zeit und Sorgfalt sollte bei der Ersteinrichtung genommen werden. Da die meisten klinischen Serum- und Plasmaproben oft sehr wenig Nukleinsäurematerial aufweisen, sind Verunreinigungen und Probenverlust gemeinsam. Um diese Probleme zu vermeiden, sollten Sie besonders vorsichtig sein, wenn dieses Protokoll verwenden. Zunächst wird RNA sehr anfällig für Degradation; Daher sollten alle Bereiche sauber und frei von Nukleasen sein. Zweitens, um Proben zu identifizieren geeignet für den Einsatz in diesem Protokoll qRT-PCR - Assays für sowohl Wirts - RNA und Virus sollte zur Quantifizierung 5,6 verwendet werden </sup&gt;. Wenn der Eingang Vergleich beträgt mit Sequenzierung ergibt sich aus dem Protokoll, Sequenzierung Erfolg (dh die Erzeugung von genügend Daten für die vollständige virale Montage) korreliert mit Proben , die mindestens 100 pg Gesamt - RNA und 1.000 Kopien des Virus enthalten. Drittens Einwirkung von Umweltquellen von Nukleinsäuren sollten vermieden werden. Das Protokoll hier skizzierte in einem Biosicherheitsschrank für Sicherheitsvorkehrungen durchgeführt und zur Begrenzung der Umweltschadstoffe. Darüber hinaus haben unsere Gruppe und anderen bemerkt , dass kommerzielle Enzyme bakterielle Nukleinsäuren in niedrigen Eingangsproben von verunreinigenden 6,18 eine andere Quelle sein kann. Die Verwendung eines sauberen Arbeitsplatz (zB PCR - Haube, biologische Sicherheit Kabinett) und Negativkontrollen (zB Wasser oder Puffer) wird dazu beitragen , lindern und Verschmutzung zu verfolgen sind. Bei Proben mit &lt;100 pg Gesamt-RNA, nur Poly (rA) Carrier-RNA, nicht rRNA, sollte eine hohe Qualität Sequenzierergebnisse erschöpft sein, um sicherzustellen, während Materialverlust zu begrenzen. Für sehrniedrige Eingangsproben cDNA-Amplifikationsverfahren können 19 besser geeignet sein, obwohl Poly (rA) Träger sollte vor der cDNA - Synthese entfernt werden. Die Abreicherung von Wirts rRNA reichert für virale Gehalt in Sequenzierungsbibliotheken und ist anwendbar auf verschiedene Probensammlungen einschließlich Serum oder Plasma, und mehrere Arten von Gewebe von Nagern und nicht-menschlichen Primaten 5,6. In nicht-menschlichen Organismen, liest Ausrichten zu 28S rRNA nach Erschöpfung blieb, was darauf hindeutet 28S rRNA ist weniger konserviert zwischen Menschen und anderen Spezies 6,20. Bei Verwendung dieser Methode mit nicht-humanen Isolate, kann es notwendig sein , mit DNA - Oligos zu ergänzen , die komplementär zu den divergierenden rRNA - Sequenzen der spezifischen Wirts 3,21. Da das Protokoll unvoreingenommen ist, liest virale nur einen kleinen Bruchteil der gesamten Bibliothek Inhalt darstellen. Obwohl rRNA ist die häufigste Art des Wirts RNA und nur ein kleiner Prozentsatz der rRNA liest (0; 1%) werden nach der selektiven Erschöpfung, alle anderen Wirts - RNA (zB mRNA) bleiben nach Erschöpfung und Konto kann für viele Sequenzierung liest aus der Probe gefunden. Daher &quot;Überabtasten&quot; (dh oversequencing) wird einzelne Bibliotheken benötigt , um für Anrufe virale Montage und Variante genügend Deckung zu haben. Für unsere Studien versuchen wir zu Folge ~ 20 Millionen liest pro Probe 2,5 ausreichende Tiefe für die Analyse von viralen genomischen und die damit verbundenen Varianten sowie metagenomic Inhalt zu haben. Für metagenomic und Studien Entdeckung pathogen ist es wichtig, dass kontaminierende Wirts-DNA zu beachten, durch DNase-Verdau entfernt. Daher Viren und andere Pathogene, die DNA-Genome enthalten kann während des Prozesses jedoch RNA Zwischenprodukte können noch sequenzierenden verloren.

Next Generation Sequenzierung von Viren aus klinischen Quellen kann die Übertragung und die Epidemiologie von Infektionen informieren, sowie dazu beitragen, Unterstützung neuer diagnostischer, Impfstoff und therapeutische Entwicklung. cDNA - Synthese unter Verwendung von Zufallsprimer hat den Nachweis und die Montage von Genomen von divergent, Coinfizierung oder auch neuartige Viren 1,2 erlaubt. Wie bei anderen unvoreingenommene Methoden, besetzen unerwünschte Verunreinigungen viele Sequenzierung liest und negativ Sequenzierungsergebnisse auswirken. Host-und Poly (rA) Carrier-RNA sind Verunreinigungen, die in vielen bestehenden viralen Musterkollektionen. Das Protokoll beschreibt eine effiziente und kostengünstige Möglichkeit der tiefen Sequenzierung Genomen RNA Virus basiert auf unvoreingenommene total RNA-seq. Das Verfahren nutzt eine RNase H selektive Depletion Schritt 3 unerwünschte Wirt ribosomalen und Carrier - RNA zu entfernen. Selektive Depletion reichert für virale Gehalt (Abbildung 1) und verbessert die Gesamtqualität der Sequenzierungsdaten(Abbildung 2) aus klinischen Proben. Außerdem wird tagmentation dem Protokoll angewendet, wie es deutlich Bibliothek Bauzeit reduziert. Diese Methoden wurden verwendet , um schnell große Datenmengen von Ebola und Lassa - Virus - Genome 2,4,5 erzeugen und kann verwendet werden , um ein breites Spektrum von RNA - Viren zu untersuchen. Schließlich wird der Ansatz nicht auf menschlichen Proben beschränkt; Die Nützlichkeit der selektive Depletion wurde auf Gewebeproben von Lassa-infizierte Nager und nicht-menschlichen Primaten - Krankheitsmodellen 5,6 gesammelt gezeigt. <img alt="Abbildung 1" src="/files/ftp_upload/54117/54117fig1.jpg" /> Abbildung 1. Die Gesamt - RNA Inhalt Reflektiert Anreicherung von Lassa - Virus von Inhalt mit Selective Depletion. Beginnend Gesamtinhalt (RNA - Eingang) und Anreicherung von einzigartigen Lassa - Virus (LASV) liest (Library Inhalt) auf rRNA Depletion von neun verschiedenen klinischen Isolaten. Diese Zahl wurde von 6 geändert <em&gt;. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig1large.jpg" target="_blank">Bitte hier klicken</a> , um <a href="https://www.jove.com/files/ftp_upload/54117/54117fig1large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 2" src="/files/ftp_upload/54117/54117fig2.jpg" /> Abbildung 2. Höhere Qualität Sequenzierung Nach Carrier - RNA Depletion. Median Basisqualitäten pro Sequenzierzyklus von Poly (rA) -contaminated Bibliotheken Lassa - Virus (rot) und Kontrolle (kein Träger in der Bibliothek beobachtet, schwarz) von QC - Bericht 13. Beide lesen 1 und 2 gelesen gepaarter Ende liest in der Bibliothek BAM-Datei zusammengefügt und die Qualitätswerte werden an jeder Basis gezeigt. Diese Zahl hat sich von 6 geändert. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig2large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www.jove.com/files/ftp_upload/54117/54117fig2large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> Die virale RNA-seq Protokoll Details Bau von Bibliotheken direkt aus extrahiertenRNA gesammelt aus klinischen und biologischen Proben. Um sicherzustellen, dass die persönliche Sicherheit, alle viralen Serum, Plasma und Gewebeproben sollten in geeigneten Puffern vor der RNA-Extraktion inaktiviert werden. In einigen Inaktivierung und Extraktion-Kits, Träger Poly (rA) RNA ist im Preis inbegriffen; Dies wird während der anfänglichen RNase H selektive Depletion Schritt entfernt werden. Basierend auf vollständige Genesung, ist die erwartete Konzentration von Carrier-RNA 100 ng / ul. In dem Protokoll, 110 ng / &amp; mgr; l Oligo-dT-RNA (1.1x Ladungsträgerkonzentration), zur Abreicherung eingesetzt. Wenn Poly (rA) Träger nicht in der Probe vorhanden ist, dann Oligo (dT) nicht hinzugefügt, um Erschöpfung vor werden. Das folgende Protokoll wird für 24 Reaktionen in PCR-Plattenformat ausgelegt (bis zu 250 &amp; mgr; l Volumen). Eine frühere Version dieses Protokolls wurde in Matranga, et al. 6.

<table border="0" cellpadding="0" cellspacing="0" width="965">
	<tbody>
		<tr height="30">
			<td height="30" style="height:31px;width:376px;">96-Well PCR Plates</td>
			<td style="width:183px;">VWR</td>
			<td style="width:119px;">47743-953</td>
			<td style="width:289px;"></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Strips of Eight Caps</td>
			<td>VWR</td>
			<td>47745-512</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Nuclease-free water</td>
			<td>Ambion</td>
			<td>AM9937</td>
			<td>50 ml bottle</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">TURBO DNase&#160;</td>
			<td>Ambion</td>
			<td>AM2238</td>
			<td>post RNA extraction step, 2 U/&#181;L, buffer included</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">PCR cycler</td>
			<td></td>
			<td></td>
			<td>any PCR cyclers&#160;</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Agencourt RNAClean XP SPRI beads&#160;</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63987</td>
			<td>beads for RNA cleanup</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Real Time qPCR system</td>
			<td></td>
			<td></td>
			<td>any system</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">DynaMag-96 Side Skirted Magnet</td>
			<td>Invitrogen</td>
			<td>12027</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">70% Ethanol</td>
			<td></td>
			<td></td>
			<td>prepare fresh</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">qRT-PCR primers</td>
			<td>IDT DNA</td>
			<td></td>
			<td>see Table 2</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">5M NaCl&#160;</td>
			<td>Ambion</td>
			<td>AM9760G</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">1M Tris-HCl pH 7.4&#160;</td>
			<td>Sigma</td>
			<td>T2663-1L</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">1M Tris-HCl pH 7.5&#160;</td>
			<td>Invitrogen</td>
			<td>15567-027</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">1M MgCl2&#160;</td>
			<td>Ambion</td>
			<td>AM9530G</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Linear acrylamide&#160;</td>
			<td>Ambion&#160;</td>
			<td>AM9520</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">DNA oligos covering entire rRNA region</td>
			<td>IDT DNA</td>
			<td></td>
			<td>see Table 3, order lab-ready at 100 &#181;M</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Oligo (dT)</td>
			<td>IDT DNA</td>
			<td></td>
			<td>40 nt long, desalted</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Hybridase Thermostable RNase H&#160;</td>
			<td>Epicentre</td>
			<td>H39100</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">RNase-free DNase Kit&#160;</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td>post selective depletion step</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">SUPERase-In RNase Inhibitor</td>
			<td>Ambion</td>
			<td>AM2694</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Random Primers&#160;</td>
			<td>Invitrogen</td>
			<td>48190-011</td>
			<td>mostly hexamers</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">10 mM dNTP mix</td>
			<td>New England Biolabs</td>
			<td>N0447L</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">SuperScript III Reverse Transcriptase&#160;</td>
			<td>Invitrogen</td>
			<td>18080-093</td>
			<td>with first-strand buffer, DTT</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Air Incubator</td>
			<td></td>
			<td></td>
			<td>any air incubator cyclers&#160;</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">NEBNext Second Strand Synthesis (dNTP-free) Reaction Buffer</td>
			<td>New England Biolabs</td>
			<td>B6117S</td>
			<td>10x</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">E. coli DNA Ligase&#160;</td>
			<td>New England Biolabs</td>
			<td>M0205L</td>
			<td>10 U/&#956;l</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">E. coli DNA Polymerase I&#160;</td>
			<td>New England Biolabs</td>
			<td>M0209L</td>
			<td>10 U/&#956;l</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">E. coli RNase H&#160;</td>
			<td>New England Biolabs</td>
			<td>M0297L</td>
			<td>2 U/&#956;l</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">0.5M EDTA</td>
			<td>Ambion</td>
			<td>AM9261</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Agencourt AMPure XP SPRI beads</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63881</td>
			<td>beads for DNA cleanup</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Elution Buffer&#160;</td>
			<td>Qiagen</td>
			<td></td>
			<td>10 mM Tris HCl, pH 8.5</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Quant-iT dsDNA HS Assay Kit&#160;</td>
			<td>Invitrogen</td>
			<td>Q32854</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Qubit fluorometer&#160;</td>
			<td>Invitrogen</td>
			<td>Q32857</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Nextera XT DNA Sample Prep Kit&#160;</td>
			<td>Illumina</td>
			<td>FC-131-1096</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Nextera XT DNA Index Kit&#160;</td>
			<td>Illumina</td>
			<td>FC-131-1001</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Tapestation 2200</td>
			<td>Agilent</td>
			<td>G2965AA</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">High Sensitivity D1000 reagents</td>
			<td>Agilent</td>
			<td>5067-5585</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">High Sensitivity D1000 ScreenTape</td>
			<td>Agilent</td>
			<td>5067-5584</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">BioAnalyzer 2100&#160;</td>
			<td>Agilent</td>
			<td>G2939AA</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">High Sensitivity DNA reagents</td>
			<td>Agilent</td>
			<td>5067-4626</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Library Quantification Complete kit (Universal)</td>
			<td>Kapa Biosystems</td>
			<td>KK4824</td>
			<td>alternative to tapestation, bioanalyzer for library quantification</td>
		</tr>
	</tbody>
</table>

unbiased deep sequencing of rna viruses from clinical samples

Hier beschreiben wir eine Next-Generation - RNA - Sequenzierung Protokoll , das de novo Assemblierung und intra-Host - Variante Anrufe von viralen Genomen von klinischen und biologischen Quellen gesammelt werden können. Die Methode ist unvoreingenommen und universell; es verwendet zufällige Primer für die cDNA-Synthese und erfordert keine vorherige Kenntnis der viralen Sequenz Gehalt. Vor dem Aufbau der Bibliothek, selektive RNase H-basierte Verdauung wird verwendet, um unerwünschte RNA zu führen - einschließlich Poly (rA) Träger und ribosomale RNA - von der viralen RNA-Probe. Selective Depletion verbessert sowohl die Datenqualität und die Anzahl der eindeutigen liest in der viralen RNA-Sequenzierung Bibliotheken. Darüber hinaus ist ein Transposase-basierten &#39;tagmentation&#39; Schritt wird in dem Protokoll verwendet wird, wie es allgemeine Bibliothek Bauzeit reduziert. Das Protokoll hat eine rasante tiefe Sequenzierung von mehr als 600 Lassa und Ebola-Virusproben-Sammlungen einschließlich aktiviert sowohl von Blut und Gewebe isoliert-und ist im Großen und Ganzen auf andere mikrobielle Genomstudien.

Das beschriebene Protokoll ermöglicht die Erzeugung von qualitativ hochwertigen Sequenzierung liest aus Low-Input-Virus-RNA-Proben, während für einzigartige virale Inhalte zu bereichern. Wie in Abbildung 1 gezeigt, angereichert das Protokoll einzigartige Inhalte Lassa - Virus mindestens fünffach in allen Proben ( im Vergleich zu nicht-verarmte Kontrollen) mit mindestens einer Million Kopien von 18S rRNA (~ 100 pg Gesamt - RNA). Ebenso Sequenzierungs Erfolg auch mit der Menge des Virus in einer gegebenen Probe korreliert. Verwendung qRT-PCR als Surrogat für die Virusmenge, die Proben enthielten ~ 1.000 oder mehr viralen Genomkopien meist vollständige Baugruppen erstellt (Daten nicht gezeigt). Darüber hinaus Abreicherung von Poly (rA) Träger reduziert Homopolymer - Sequenzen A und T in Bibliotheken, in sauberer Vorbereitungen resultierende und eine bessere Qualität Sequenzierung sichergestellt liest (Abbildung 2). Endgültige Bibliotheken von extensiven viralen klinischen Proben haben oft ein breites Fragment Länge von 150 bis 1000 bp(Abbildung 3). Nach der Sequenzierung Probe misidentification und Übersprechens zwischen Bibliotheken innerhalb eines Pools 12, nur Index liest mit einer Basisqualitätsfaktor von 25 (q25) und sicherzustellen , Null - Fehlpaarungen gehalten werden während des Demultiplexprozess zu reduzieren. Virale Genome werden mit einer Bioinformatik Pipeline spezifisch für divergent Viren 2,4-6 montiert. Diese Werkzeuge sind in https://github.com/broadinstitute/viral-ngs oder durch kommerzielle Cloud - Plattformen 4. <table border="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Schritt 1.1: DNase Reaktion </td><td></td></tr><tr><td> Reagens </td><td> Volumen pro Reaktion (ul) </td></tr><tr><td> 10x DNase Puffer </td><td> 7 </td></tr><tr><td> Nuklease-freies Wasser </td><td> 6 </td></tr><tr><td> Heraus viralen RNA </td><td> 55 </td></tr><tr><td> DNase (2 U / &amp; #181; l) </td><td> 2 </td></tr><tr><td> Volle Lautstärke </td><td> 70 </td></tr><tr><td> Schritt 2.1: 5x Hybridisierungspuffer </td><td></td></tr><tr><td> Reagens </td><td> Volume 1 ml (ul) </td></tr><tr><td> 5 M NaCl </td><td> 200 </td></tr><tr><td> 1 M Tris-HCl (pH 7,4) </td><td> 500 </td></tr><tr><td> Nuklease-freies Wasser </td><td> 300 </td></tr><tr><td> Volle Lautstärke </td><td> 1000 </td></tr><tr><td> Schritt 2.1: 10x RNase H - Reaktionspuffer </td><td></td></tr><tr><td> Reagens </td><td> Volume 1 ml (ul) </td></tr><tr><td> 5 M NaCl </td><td> 200 </td></tr><tr><td> 1 M Tris-HCl (pH 7,5) </td><td> 500 </td></tr><tr><td> 1 M MgCl 2 </td><td> 200 </td></tr><tr><td> Nuklease-freies Wasser </td><td> 500 </td></tr><tr><td> Volle Lautstärke </td><td> 1000 </td></tr><tr><td> Schritt 2.1: Wasser wi-ten linearen Acrylamid </td><td></td></tr><tr><td> Reagens </td><td> Volume 1 ml Puffer (ul) </td></tr><tr><td> Nuklease-freies Wasser </td><td> 992 </td></tr><tr><td> Lineares Acrylamid (5 mg / ml) </td><td> 8 </td></tr><tr><td> Volle Lautstärke </td><td> 1000 </td></tr><tr><td colspan="2"> Schritt 2.2: Hybridisierungsreaktion für die selektive Depletion </td></tr><tr><td> Reagens </td><td> Volumen pro Reaktion (ul) </td></tr><tr><td> 5x Hybridisierungspuffer </td><td> 2 </td></tr><tr><td> rRNA-Depletion oligo-Mix (100 uM) </td><td> 1,22 </td></tr><tr><td> Oligo (d) T (550 ng / ul) </td><td> 1 </td></tr><tr><td> DNase-behandelte Gesamt-RNA </td><td> bis zu 5 </td></tr><tr><td> Spike-in-RNA (Dies ist optional) </td><td> 0,5 </td></tr><tr><td> Wasser (mit linearen acrylamid) </td><td> bringen bis zu 10 Gesamt </td></tr><tr><td> insgesamt Volumich </td><td> 10 </td></tr><tr><td colspan="2"> Schritt 2.3: RNase H - Reaktion für die selektive Depletion </td></tr><tr><td> Reagens </td><td> Volumen pro Reaktion (ul) </td></tr><tr><td> 10x RNase H Reaction Buffer </td><td> 2 </td></tr><tr><td> Wasser (mit linearen acrylamid) </td><td> 5 </td></tr><tr><td> Thermostabile RNase H (5 U / ul) </td><td> 3 </td></tr><tr><td> Volle Lautstärke </td><td> 10 </td></tr><tr><td colspan="2"> Schritt 2.4: DNase Reaktion Post selektive Depletion </td></tr><tr><td> Reagens </td><td> Volumen pro Reaktion (ul) </td></tr><tr><td> 10x DNase Buffer </td><td> 7.5 </td></tr><tr><td> Wasser (mit linearen acrylamid) </td><td> 44.5 </td></tr><tr><td> RNase-Inhibitor (20 U / ul) </td><td> 1 </td></tr><tr><td> RNase-freie DNase I (2,72 U / ul) </td><td> 2 </td></tr&gt; <tr><td> Das Gesamtvolumen (mit RNase H-Reaktion) </td><td> 75 </td></tr><tr><td colspan="2"> Schritt 3.1: cDNA - Synthese, Random - Primer - Hybridisierung </td></tr><tr><td> Reagens </td><td> Volumen pro Reaktion (ul) </td></tr><tr><td> rRNA / Träger-verarmten RNA </td><td> 10 </td></tr><tr><td> 3 ug Zufallsprimer </td><td> 1 </td></tr><tr><td> Volle Lautstärke </td><td> 11 </td></tr><tr><td> Schritt 3.2: Der erste Strang der cDNA - Synthesereaktion </td><td></td></tr><tr><td> Reagens </td><td> Volumen (ul) </td></tr><tr><td> 5x First Strand Reaction Buffer </td><td> 4 </td></tr><tr><td> 0,1 M DTT </td><td> 2 </td></tr><tr><td> 10 mM dNTP mix </td><td> 1 </td></tr><tr><td> RNase-Inhibitor (20 U / ul) </td><td> 1 </td></tr><tr><td> Reverse-Transkriptase (hinzufügen letzte) </td><td> 1 </td></tr><tr><td> Das Gesamtvolumen (mit RNA oben) &lt;/ Td&gt; <td> 20 </td></tr><tr><td colspan="2"> Schritt 3.3: Zweiter Strang cDNA - Synthesereaktion </td></tr><tr><td> Reagens </td><td> Volumen (ul) </td></tr><tr><td> RNase-freies Wasser </td><td> 43 </td></tr><tr><td> 10x Second-Strand Reaction Buffer </td><td> 8 </td></tr><tr><td> 10 mM dNTP mix </td><td> 3 </td></tr><tr><td> E. coli DNA - Ligase (10 U / ul) </td><td> 1 </td></tr><tr><td> E. coli DNA Polymerase I (10 U / ul) </td><td> 4 </td></tr><tr><td> E. coli RNase H (2 U / ul) </td><td> 1 </td></tr><tr><td> Das Gesamtvolumen (mit 1. Strang - Reaktion) </td><td> 80 </td></tr><tr><td> Schritt 4.2: Tagmentation Reaktion </td><td></td></tr><tr><td> Reagens </td><td> Volumen (ul) </td></tr><tr><td> Amplicon Tagment Mix (ATM) </td><td> 1 </td></tr><tr><td> Tagment DNA-Puffer (TD) </td&gt; <td> 5 </td></tr><tr><td> Das Gesamtvolumen (mit cDNA) </td><td> 10 </td></tr><tr><td> Schritt 4.3: Bibliothek PCR - Reaktion </td><td></td></tr><tr><td> Reagens </td><td> Volumen (ul) </td></tr><tr><td> PCR Master Mix (NPM) </td><td> 7.5 </td></tr><tr><td> Index 1 Primer (i7) </td><td> 2.5 </td></tr><tr><td> Index 2 Primer (i5) </td><td> 2.5 </td></tr><tr><td> Das Gesamtvolumen (mit tagmented cDNA) </td><td> 25 </td></tr><tr><td> Schritt 4.3.2: Bibliothek PCR - Bedingungen </td><td></td></tr><tr><td> 72 ° C, 3 min </td><td></td></tr><tr><td> 95 ° C, 30 sec </td><td></td></tr><tr><td colspan="2"> bis zu 18 Zyklen-10 sec bei 95 ° C, 30 sec bei 55 ° C, 30 sec bei 72 ° C </td></tr><tr><td> 72 ° C, 5 min </td><td></td></tr><tr><td> 10 ° C, für immer </td><td></td></tr></tbody></table>Tabelle 1:. Reaction Set-up und Puffer Schritt- für -Schritt - Tabellen mit Inhalten aller Puffer und Reaktionsmischungen. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Oligo - Name </td><td> Sequenz (5 &#39;bis 3&#39;) </td></tr><tr><td> Ebola KGH FW </td><td> GTCGTTCCAACAATCGAGCG </td></tr><tr><td> Ebola KGH RV </td><td> CGTCCCGTAGCTTTRGCCAT </td></tr><tr><td> Ebola kulesh FW </td><td> TCTGACATGGATTACCACAAGATC </td></tr><tr><td> Ebola kulesh RV </td><td> GGATGACTCTTTGCCGAACAATC </td></tr><tr><td> Lassa SL FW </td><td> GTA AGC CCA GCD GYA AAB CC </td></tr><tr><td> Lassa SL RV </td><td> AAG CCA CAG AAA RCT GGS AGC A </td></tr><tr><td> 18S rRNA FW </td><td> TCCTTTAACGAGGATCCATTGG </td></tr><tr><td> 18S rRNA RV </td><td> CGAGCTTTTTAACTGCAGCAACT </td></tr></tbody></tLage&gt; Tabelle 2: qRT-PCR - Primer - Sequenzen Primer für die Messung Host (18S rRNA) und virale (Ebola und Lassa) Inhalt.. &quot;KGH&quot; ist Kenema Regierungskrankenhaus in Sierra Leone, wo die Ebola - Primer 2 getestet wurden. &#39;Kulesh&#39; ist der Ermittler, der Primer 14 gesetzt entworfen. Tabelle 3: ribosomale RNA (rRNA) Depletion Oligos 195 50 Nukleotide lange Sequenzen , die komplementär zu menschlicher rRNA für die selektive Depletion Schritt 6.. <a href="https://www.jove.com/files/ftp_upload/54117/Table_3.xlsx" target="_blank">Bitte hier klicken</a> , um <a href="https://www.jove.com/files/ftp_upload/54117/Table_3.xlsx" target="_blank">diese Datei herunterzuladen.</a>

Watch this Scientific Journal Video about Unbiased Deep Sequencing of RNA Viruses from Clinical Samples at JoVE.com

Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

Unvoreingenommene Tiefe Sequenzierung von RNA-Viren aus klinischen Proben

Here we outline a next-generation RNA sequencing protocol that enables de novo assemblies and intra-host variant calls of viral genomes collected from ...

unbiased-deep-sequencing-of-rna-viruses-from-clinical-samples

Research

JoVE Journal

Medicine

16.8K Aufrufe.  Broad Institute of MIT and Harvard. This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

Serie: Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

Isolation and Functional Characterization of Human Ventricular Cardiomyocytes from Fresh Surgical Samples

Cardiomyocytes from diseased hearts are subjected to complex remodeling processes involving changes in cell structure, excitation contraction coupling and membrane ion currents. Those changes are likely&#160;to be responsible for the increased arrhythmogenic risk and the contractile alterations leading to systolic and diastolic dysfunction in cardiac patients. However, most information on the alterations of myocyte function in cardiac diseases has come from animal models.
Here we describe and validate a protocol to isolate viable myocytes from small surgical samples of ventricular myocardium from patients undergoing cardiac surgery operations. The protocol is described in detail. Electrophysiological and intracellular calcium measurements are reported to demonstrate the feasibility of a number of single cell measurements in human ventricular cardiomyocytes obtained with this method.
The protocol reported here can be useful for future investigations of the cellular and molecular basis of functional alterations of the human heart in the presence of different cardiac diseases. Further, this method can be used to identify novel therapeutic targets at cellular level and to test the effectiveness of new compounds on human cardiomyocytes, with direct translational value.

Current knowledge on the cellular basis of cardiac diseases mostly relies on studies on animal models. Here we describe and validate a novel method to obtain single viable cardiomyocytes from small surgical samples of human ventricular myocardium. Human ventricular myocytes can be used for electrophysiological studies and drug testing.

Isolierung und funktionelle Charakterisierung der Menschen ventrikuläre Kardiomyozyten von Fresh Chirurgische Proben

Cardiomyocytes from diseased hearts are subjected to complex remodeling processes involving changes in cell structure, excitation contraction coupling and ...

Forschung

Medizin

Isolation of Cancer Stem Cells From Human Prostate Cancer Samples

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly isolated from human tissues and serially propagated in immunodeficient mice, typically through antibody labeling of subpopulations of cells and fractionation by flow cytometry. However, the unique clinical features of prostate cancer have considerably limited the study of prostate CSCs from fresh human tumor samples. We recently reported the isolation of prostate CSCs directly from human tissues by virtue of their HLA class I (HLAI)-negative phenotype. Prostate cancer cells are harvested from surgical specimens and mechanically dissociated. A cell suspension is generated and labeled with fluorescently conjugated HLAI and stromal antibodies. Subpopulations of HLAI-negative cells are finally isolated using a flow cytometer. The principal limitation of this protocol is the frequently microscopic and multifocal nature of primary cancer in prostatectomy specimens. Nonetheless, isolated live prostate CSCs are suitable for molecular characterization and functional validation by transplantation in immunodeficient mice.

The isolation of cancer stem cells (CSCs) directly from human tissues is requisite for their biological characterization. This manuscript describes a methodology for the isolation of prostate CSCs from human tissues, while also providing tips on troubleshooting difficult steps.

Isolierung von Krebs Stammzellen aus menschlichen Prostatakrebs-Proben

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly ...

Controlling Parkinson's Disease With Adaptive Deep Brain Stimulation

Adaptive deep brain stimulation (aDBS) has the potential to improve the treatment of Parkinson&#39;s disease by optimizing stimulation in real time according to fluctuating disease and medication state. In the present realization of adaptive DBS we record and stimulate from the DBS electrodes implanted in the subthalamic nucleus of patients with Parkinson&#39;s disease in the early post-operative period. Local field potentials are analogue filtered between 3 and 47 Hz before being passed to a data acquisition unit where they are digitally filtered again around the patient specific beta peak, rectified and smoothed to give an online reading of the beta amplitude. A threshold for beta amplitude is set heuristically, which, if crossed, passes a trigger signal to the stimulator. The stimulator then ramps up stimulation to a pre-determined clinically effective voltage over 250 msec and continues to stimulate until the beta amplitude again falls down below threshold. Stimulation continues in this manner with brief episodes of ramped DBS during periods of heightened beta power.
Clinical efficacy is assessed after a minimum period of stabilization (5 min) through the unblinded and blinded video assessment of motor function using a selection of scores from the Unified Parkinson&#39;s Rating Scale (UPDRS). Recent work has demonstrated a reduction in power consumption with aDBS as well as an improvement in clinical scores compared to conventional DBS. Chronic aDBS could now be trialed in Parkinsonism.

Adaptive deep brain stimulation (aDBS) is effective for Parkinson&#8217;s disease, improving symptoms and reducing power consumption compared to conventional deep brain stimulation (cDBS). In aDBS we track a local field potential biomarker (beta oscillatory amplitude) in real time and use this to control the timing of stimulation.

Controlling Parkinson-Krankheit mit Adaptive Tiefe Hirnstimulation

Adaptive deep brain stimulation (aDBS) has the potential to improve the treatment of Parkinson&#39;s disease by optimizing stimulation in real time ...

Handling of the Cotton Rat in Studies for the Pre-clinical Evaluation of Oncolytic Viruses

Oncolytic viruses are a novel anticancer therapy with the ability to target tumor cells, while leaving healthy cells intact. For this strategy to be successful, recent studies have shown that involvement of the host immune system is essential. Therefore, oncolytic virotherapy should be evaluated within the context of an immunocompetent model. Furthermore, the study of antitumor therapies in tolerized animal models may better recapitulate results seen in clinical trials. Cotton rats, commonly used to study respiratory viruses, are an attractive model to study oncolytic virotherapy as syngeneic models of mammary carcinoma and osteosarcoma are well established. However, there is a lack of published information on the proper handling procedure for these highly excitable rodents. The handling and capture approach outlined minimizes animal stress to facilitate experimentation. This technique hinges upon the ability of the researcher to keep calm during handling and perform procedures in a timely fashion. Finally, we describe how to prepare cotton rat mammary tumor cells for consistent subcutaneous tumor formation, and how to perform intratumoral and intraperitoneal injections. These methods can be applied to a wide range of studies furthering the development of the cotton rat as a relevant pre-clinical model to study antitumor therapy.

Cotton rats are extremely excitable and have a strong flight-or-fight response. A handling method optimized to reduce the stress of the animals is described which will make cotton rats more accessible as a preclinical model.

Die Handhabung der Baumwolle Ratte in Studien für die präklinische Bewertung onkolytischer Viren

Oncolytic viruses are a novel anticancer therapy with the ability to target tumor cells, while leaving healthy cells intact.  For this strategy to be ...

VDJ-Seq: Deep Sequencing Analysis of Rearranged Immunoglobulin Heavy Chain Gene to Reveal Clonal Evolution Patterns of B Cell Lymphoma

Understanding tumor clonality is critical to understanding the mechanisms involved in tumorigenesis and disease progression. In addition, understanding the clonal composition changes that occur within a tumor in response to certain micro-environment or treatments may lead to the design of more sophisticated and effective approaches to eradicate tumor cells. However, tracking tumor clonal sub-populations has been challenging due to the lack of distinguishable markers. To address this problem, a VDJ-seq protocol was created to trace the clonal evolution patterns of diffuse large B cell lymphoma (DLBCL) relapse by exploiting VDJ recombination and somatic hypermutation (SHM), two unique features of B cell lymphomas.
In this protocol, Next-Generation sequencing (NGS) libraries with indexing potential were constructed from amplified rearranged immunoglobulin heavy chain (IgH) VDJ region from pairs of primary diagnosis and relapse DLBCL samples. On average more than half million VDJ sequences per sample were obtained after sequencing, which contain both VDJ rearrangement and SHM information. In addition, customized bioinformatics pipelines were developed to fully utilize sequence information for the characterization of IgH-VDJ repertoire within these samples. Furthermore, the pipeline allows the reconstruction and comparison of the clonal architecture of individual tumors, which enables the examination of the clonal heterogeneity within the diagnosis tumors and deduction of clonal evolution patterns between diagnosis and relapse tumor pairs. When applying this analysis to several diagnosis-relapse pairs, we uncovered key evidence that multiple distinctive tumor evolutionary patterns could lead to DLBCL relapse. Additionally, this approach can be expanded into other clinical aspects, such as identification of minimal residual disease, monitoring relapse progress and treatment response, and investigation of immune repertoires in non-lymphoma contexts.

This protocol describes an approach to interrogate the recombined immunoglobulin heavy chain VDJ regions of lymphomas by deep-sequencing and retrieve VDJ rearrangement and somatic hypermutation status to delineate clonal architecture of individual tumor. Comparing clonal architecture between paired diagnosis and relapse samples reveals lymphoma relapse clonal evolution modes.

VDJ-Seq: Tiefe Sequenzierung Analyse Rearranged Immunglobulin-Schwerketten-Gen zu Klonale Entwicklung Muster der B Zell-Lymphom Reveal

Understanding tumor clonality is critical to understanding the mechanisms involved in tumorigenesis and disease progression. In addition, understanding ...

Using Saccadometry with Deep Brain Stimulation to Study Normal and Pathological Brain Function

The oculomotor system involves a large number of brain areas including parts of the basal ganglia, and various neurodegenerative diseases including Parkinson's and Huntington's can disrupt it. People with Parkinson's disease, for example, tend to have increased saccadic latencies. Consequently, the quantitative measurement of saccadic eye movements has received considerable attention as a potential biomarker for neurodegenerative conditions. A lot more can be learned about the brain in both health and disease by observing what happens to eye movements when the function of specific brain areas is perturbed. Deep brain stimulation is a surgical intervention used for the management of a range of neurological conditions including Parkinson's disease, in which stimulating electrodes are placed in specific brain areas including several sites in the basal ganglia. Eye movement measurements can then be made with the stimulator systems both off and on and the results compared. With suitable experimental design, this approach can be used to study the pathophysiology of the disease being treated, the mechanism by which DBS exerts it beneficial effects, and even aspects of normal neurophysiology.

This paper describes the use of quantitative measurement of eye movements in conjunction with stimulation of focal areas of the deep brain in order to study physiology, pathophysiology, and the mechanisms of deep brain stimulation.

Mit Saccadometry mit Deep Brain Stimulation Normale und Pathologische Funktion des Gehirns zu studieren

The oculomotor system involves a large number of brain areas including parts of the basal ganglia, and various neurodegenerative diseases including ...

Transarterial Administration of Oncolytic Viruses for Locoregional Therapy of Orthotopic HCC in Rats

Hepatocellular carcinoma (HCC) is a disease with limited treatment options and poor prognosis. In recent years, oncolytic virotherapies have proven themselves to be potentially powerful tools to fight malignancy. Due to the unique dual blood supply in the liver, it is possible to apply therapies locally to orthotopic liver tumors, which are predominantly fed by arterial blood flow. We have previously demonstrated that hepatic arterial delivery of oncolytic viruses results in safe and efficient transduction efficiency of multifocal HCC lesions, resulting in significant prolongation of survival in immune competent rats. This procedure closely mimics the application of transarterial embolization in patients, which is the standard palliative care provided to many HCC patients. The ability to administer tumor therapies through the hepatic artery in rats allows for a highly sophisticated preclinical model for evaluating novel viral vectors under development. Here we describe the detailed protocol for microdissection of the hepatic artery for infusion of oncolytic virus vectors to treat orthotopic HCC.

Oncolytic virotherapies are under development as novel therapeutics for the treatment of hepatocellular carcinoma (HCC). Here we describe a method for locoregional therapy of HCC via hepatic arterial administration of oncolytic virus.

Transarterial Verwaltung von onkolytischen Viren für lokoregionale von Orthotopische HCC bei Ratten

Hepatocellular carcinoma (HCC) is a disease with limited treatment options and poor prognosis.  In recent years, oncolytic virotherapies have proven ...

Sampling Strategies and Processing of Biobank Tissue Samples from Porcine Biomedical Models

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of genetically modified pig models, and the often-limited number of available animals of these models, establishment of (biobank) collections of adequately processed tissue samples suited for a broad spectrum of subsequent analyses methods, including analyses not specified at the time point of sampling, represent meaningful approaches to take full advantage of the translational value of the model. With respect to the peculiarities of porcine anatomy, comprehensive guidelines have recently been established for standardized generation of representative, high-quality samples from different porcine organs and tissues. These guidelines are essential prerequisites for the reproducibility of results and their comparability between different studies and investigators. The recording of basic data, such as organ weights and volumes, the determination of the sampling locations and of the numbers of tissue samples to be generated, as well as their orientation, size, processing and trimming directions, are relevant factors determining the generalizability and usability of the specimen for molecular, qualitative, and quantitative morphological analyses. Here, an illustrative, practical, step-by-step demonstration of the most important techniques for generation of representative, multi-purpose biobank specimen from porcine tissues is presented. The methods described here include determination of organ/tissue volumes and densities, the application of a volume-weighted systematic random sampling procedure for parenchymal organs by point-counting, determination of the extent of tissue shrinkage related to histological embedding of samples, and generation of randomly oriented samples for quantitative stereological analyses, such as isotropic uniform random (IUR) sections generated by the &#34;Orientator&#34; and &#34;Isector&#34; methods, and vertical uniform random (VUR) sections.

The practical application and performance of methods for generation of representative tissue samples of porcine animal models for a broad spectrum of downstream analyses in biobank projects are demonstrated, including volumetry, systematic random sampling, and differential processing of tissue samples for qualitative and quantitative morphologic and molecular analyses types.

Probenahmestrategien und Verarbeitung der Biobank Gewebeproben von porcinen biomedizinische Modelle

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations often cause a distorted reading frame and premature stop codons, resulting in an almost total lack of dystrophin protein. The reading frame can be corrected using antisense oligonucleotides (AONs) that induce exon skipping. The morpholino AON viltolarsen (code name: NS-065/NCNP-01) has been shown to induce exon 53 skipping, restoring the reading frame for patients with exon 52 deletions. We recently administered NS-065/NCNP-01 intravenously to DMD patients in an exploratory investigator-initiated, first-in-human trial of NS-065/NCNP-01. In this methods article, we present the molecular characterization of dystrophin expression using Sanger sequencing, RT-PCR, and western blotting in the clinical trial. The characterization of dystrophin expression was fundamental in the study for showing the efficacy since no functional outcome tests were performed.

Here, we present the molecular characterization of dystrophin 38 expression using Sanger sequencing, RT-PCR, and western blotting in the clinical trial.

Charakterisierung der Exon-Skipping-Effizienz in DMD-Patientenproben in klinischen Studien mit Antisense-Oligonukleotiden

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...

Isolation of Viable Adipocytes and Stromal Vascular Fraction from Human Visceral Adipose Tissue Suitable for RNA Analysis and Macrophage Phenotyping

Visceral adipose tissue (VAT) is an active metabolic organ composed mainly of mature adipocytes and stromal vascular fraction (SVF) cells, which release different bioactive molecules that control metabolic, hormonal, and immune processes; currently, it is unclear how these processes are regulated within the adipose tissue. Therefore, the development of methods evaluating the contribution of each cell population to the pathophysiology of adipose tissue is crucial. This protocol describes the isolation steps and provides the necessary troubleshooting guidelines for efficient isolation of viable mature adipocytes and SVF from human VAT biopsies in a single process, using a collagenase enzymatic digestion technique. Moreover, the protocol is also optimized to identify macrophage subsets and perform mature adipocyte RNA isolation for gene expression studies, which allows performing studies dissecting the interaction between these cell populations. Briefly, VAT biopsies are washed, minced mechanically, and digested to generate a single-cell suspension. After centrifugation, mature adipocytes are isolated by flotation from the SVF pellet. The RNA extraction protocol ensures a high yield of total RNA (including miRNAs) from adipocytes for downstream expression assays. Simultaneously, SVF cells are used to characterize macrophage subsets (pro- and anti-inflammatory phenotype) through flow cytometry analysis.

This protocol provides an efficient collagenase digestion method for isolation of viable adipocytes and stromal vascular fraction-SVF cells from human visceral fat in a single process, including methodology to obtain high-quality RNA from adipocytes and phenotypification of SVF-macrophages through staining of multiple membrane-bound markers for analysis by flow cytometry.

Isolierung lebensfähiger Adipozyten und stromaler vaskulärer Fraktion aus menschlichem viszeralem Fettgewebe, geeignet für RNA-Analyse und Makrophagen-Phänotypisierung

Visceral adipose tissue (VAT) is an active metabolic organ composed mainly of mature adipocytes and stromal vascular fraction (SVF) cells, which release ...