אנו מודים לחברי המעבדה וואן ומעבדת Nagarajan לדיונים אינפורמטיביים. N.Nagarajan נתמך על ידי מימון מ * כוכב. Y.Wan נתמך על ידי מימון מ- A * סטאר וחברה במדע- Branco Weiss Fellowship.

<ol>
	<li>Wan, Y., Kertesz, M., Spitale, R. C., Segal, E., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+the+transcriptome+through+RNA+structure.">Understanding the transcriptome through RNA structure.</a> Nat.Rev.Genet. 12 (9), 641-655 (2011).</li><li>Kertesz, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+measurement+of+RNA+secondary+structure+in+yeast.">Genome-wide measurement of RNA secondary structure in yeast.</a> Nature. 467 (7311), 103-107 (2010).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+Measurement+of+RNA+Folding+Energies.">Genome-wide Measurement of RNA Folding Energies.</a> Mol.Cell. 48 (2), 169-181 (2012).</li><li>Wan, Y., Qu, K., Ouyang, Z., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+RNA+structure+using+nuclease+digestion+and+high-throughput+sequencing.">Genome-wide mapping of RNA structure using nuclease digestion and high-throughput sequencing.</a> Nat.Protoc. 8 (5), 849-869 (2013).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+and+variation+of+RNA+secondary+structure+across+the+human+transcriptome.">Landscape and variation of RNA secondary structure across the human transcriptome.</a> Nature. 505 (7485), 706-709 (2014).</li><li>Spitale, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+imprints+in+vivo+decode+RNA+regulatory+mechanisms.">Structural imprints in vivo decode RNA regulatory mechanisms.</a> Nature. 519 (7544), 486-490 (2015).</li><li>Ding, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+genome-wide+profiling+of+RNA+secondary+structure+reveals+novel+regulatory+features.">In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features.</a> Nature. 505 (7485), 696-700 (2014).</li><li>Rouskin, S., Zubradt, M., Washietl, S., Kellis, M., Weissman, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+probing+of+RNA+structure+reveals+active+unfolding+of+mRNA+structures+in+vivo.">Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo.</a> Nature. 505 (7485), 701-705 (2014).</li><li>Kudla, G., Granneman, S., Hahn, D., Beggs, J. D., Tollervey, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-linking,+ligation,+and+sequencing+of+hybrids+reveals+RNA-RNA+interactions+in+yeast.">Cross-linking, ligation, and sequencing of hybrids reveals RNA-RNA interactions in yeast.</a> Proc.Natl.Acad.Sci.U.S.A. 108 (24), 10010-10015 (2011).</li><li>Sugimoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=hiCLIP+reveals+the+in+vivo+atlas+of+mRNA+secondary+structures+recognized+by+Staufen+1.">hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1.</a> Nature. 519 (7544), 491-494 (2015).</li><li>Engreitz, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-RNA+interactions+enable+specific+targeting+of+noncoding+RNAs+to+nascent+Pre-mRNAs+and+chromatin+sites.">RNA-RNA interactions enable specific targeting of noncoding RNAs to nascent Pre-mRNAs and chromatin sites.</a> Cell. 159 (1), 188-199 (2014).</li><li>Ramani, V., Qiu, R., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+determination+of+RNA+structure+by+proximity+ligation.">High-throughput determination of RNA structure by proximity ligation.</a> Nat.Biotechnol. , (2015).</li><li>Lu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+Duplex+Map+in+Living+Cells+Reveals+Higher-Order+Transcriptome+Structure.">RNA Duplex Map in Living Cells Reveals Higher-Order Transcriptome Structure.</a> Cell. 165 (5), 1267-1279 (2016).</li><li>Sharma, E., Sterne-Weiler, T., O'Hanlon, D., Blencowe, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+Mapping+of+Human+RNA-RNA+Interactions.">Global Mapping of Human RNA-RNA Interactions.</a> Mol.Cell. 62 (4), 618-626 (2016).</li><li>Aw, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Mapping+of+Eukaryotic+RNA+Interactomes+Reveals+Principles+of+Higher-Order+Organization+and+Regulation.">In Vivo Mapping of Eukaryotic RNA Interactomes Reveals Principles of Higher-Order Organization and Regulation.</a> Mol.Cell. 62 (4), 603-617 (2016).</li></ol>

למחברים אין אינטרסים פיננסיים מתחרים.

כאן, אנו מתארים בפירוט את זרימת עבודה ניסיונית וחישובית עבור SPLASH, שיטה המאפשרת לנו לזהות אינטראקציות RNA חכם חכמים בצורה גנום רחב. אנו ניצלו בהצלחה SPLASH בתרבית חיידקים, שמרים ותרבויות האדם צופים כי האסטרטגיה יכולה להיות מיושמת באופן נרחב על אורגניזמים שונים תחת מדינות ...

ללמוד כיצד מקרומולקולות לקפל וליצור אינטראקציה זה עם זה הוא המפתח להבנת רגולציה גנטית בתא. בעוד שמאמצים רבים התמקדו בעשור האחרון בהבנת האופן שבו דנ&quot;א וחלבונים תורמים לרגולציה גנטית, ידוע פחות פחות על תקנה פוסט-תעתיקית של ביטוי גנים. RNA נושאת מידע הן ברצף הליניארי שלה והן במבנה המשני שלה ושלישוני 1 . היכולת שלה בסיס זוג עם עצמו ועם אחרים חשוב לתפקידה in vivo . ההתקדמות האחרונה בתפוקה גבוהה RNA מבנה משני בדיקה חיישן סיפק תובנות ערך למיקומים של אזורים בודדים כפול בודד transcriptome 2 , 3 , 4 , 5 , 6 , 7 , 8 , Howeמידע על השותפים לאינטראקציה של זוגות עדיין חסר במידה רבה. כדי לקבוע איזה רצף RNA הוא אינטראקציה עם אזור RNA אחר transcriptome, אנחנו צריכים מידע גלובלי זוג חכם. מיפוי זוגי אינטראקציות RNA חכם באופן גלובלי, ללא דעות מוקדמות באופן מסורתי היה אתגר גדול. בעוד גישות קודמות, כגון CLASH 9 , hiCLIP 10 ו RAP 11 , משמשות לזיהוי אינטראקציות רנ&quot;א בקנה מידה גדול, טכניקות אלה בדרך כלל מפתבות צימוד בסיס RNA עבור קבוצת משנה של RNAs או אינטראקציה עם חלבון מסוים או מינים RNA. ההתפתחויות האחרונות בחקר אינטראקציות RNA העולמי כוללים את השיטה RPL 12 , אשר אינו מייצב אינטראקציות RNA in vivo ולכן יכול רק ללכוד תת קבוצה של אינטראקציות vivo . כדי להתגבר על האתגרים הללו, אנו ואחרים פיתחנו אסטרטגיות גנומיות רחבות ובלתי מוטותP רנ&quot;א אינטראקציה ב vivo , באמצעות גרסאות שונה של crosslinker psoralen 13 , 14 , 15 . בפרוטוקול זה, אנו מתארים את הפרטים עבור ביצוע S S השוואות של Sorsen crosslinked, L igated, ו S נבחר H ybrids (SPLASH), אשר מנצל psoralen biotinylated כדי crosslink בסיס זיווג RNAs ב vivo , ואחריו קשירת הקרבה ותפוקה גבוהה התפוקה כדי לזהות RNA בסיס זיווג שותפים גנום רחב ( איור 1 ) 15 . בכתב יד זה, אנו מתארים את השלבים לביצוע SPLASH באמצעות תאים חסיד תרבותי, במקרה זה תאים הלה. פרוטוקול זהה ניתן להתאים בקלות תאים יונקים ההשעיה כדי שמרים תאים חיידקים. בקצרה, תאים Hella מטופלים עם psoralen biotinylated ו מוקרן ב 365 ננומטר כדי crosslink אינטראקציות RNA זוגות זוג in vivo. RNAs מחולצים מכן מן התאים, מקוטע מועשר על אזורים crosslinking באמצעות חרוזים streptavidin. אינטראקציה שברי RNA אז ligated יחד באמצעות קשירת הקרבה והפך לספריית cDNA עבור רצף עמוק. על רצף, RNAs chimeric ממופים על transcriptome / הגנום כדי לזהות את אזורי RNA אינטראקציה מותאמים זה לזה. יש לנו בהצלחה לנצל SPLASH לזהות אלפי אינטראקציות רנ&quot;א in vivo בשמרים ותאים אנושיים שונים, כולל intramolecular ו intermolecular RNA בסיס צימוד בשיעורים שונים של RNAs, כגון snoRNAs, lncRNAs ו mRNAs, להציץ לתוך הארגון המבני דפוסי אינטראקציה של RNAs בתא.

<table><tbody><tr><td>1 kb Plus DNA Ladder</td><td>Life Technologies Holdings Pte Ltd</td><td>10787026</td><td>DNA ladder</td></tr><tr><td>10 bp DNA ladder</td><td>Life Technologies Holdings Pte Ltd</td><td>10821-015</td><td>DNA ladder</td></tr><tr><td>20% SDS solution</td><td>First BASE</td><td>BUF-2052-1L&amp;nbsp;&amp;nbsp;</td><td></td></tr><tr><td>20x SSC</td><td>First BASE</td><td>BUF-3050-20X1L</td><td></td></tr><tr><td>3.0 M Sodium Acetate Solution</td><td>First BASE</td><td>BUF-1151-1L-pH5.2&amp;nbsp;&amp;nbsp;</td><td>Required for nucleic acid precipitation</td></tr><tr><td>40% Acrylamide/Bis Solution, 19:1</td><td>Bio-Rad</td><td>1610145</td><td>TBE Urea gel component</td></tr><tr><td>Ambion Buffer Kit</td><td>Life Technologies Holdings Pte Ltd</td><td>AM9010</td><td></td></tr><tr><td>Ammonium Persulfate, Molecular Grade&amp;nbsp;&amp;nbsp;</td><td>Promega</td><td>V3131&amp;nbsp;</td><td>TBE Urea gel component</td></tr><tr><td>Bromophenol Blue</td><td>Sigma-Aldrich</td><td>B0126-25G</td><td></td></tr><tr><td>Chloroform</td><td>Merck</td><td>1.02445.1000</td><td>RNA extraction</td></tr><tr><td>Single strand DNA ligase</td><td>Epicentre</td><td>CL9025K</td><td>CircLigase II ssDNA Ligase</td></tr><tr><td>Centrifuge tube filters</td><td>Sigma-Aldrich</td><td>CLS8160-96EA</td><td>Costar Spin-X centrifuge tube filters</td></tr><tr><td>D5628-1G DIGITONIN CRYSTALLINE</td><td>Sigma-Aldrich</td><td>D5628-1G</td><td>For cell treatment</td></tr><tr><td>Dark Reader Transilluminator&amp;nbsp;</td><td>Clare Chemical Research</td><td>Dark Reader DR89X Transilluminator</td><td>Blue light transilluminator</td></tr><tr><td>DNA Gel Loading Dye (6x)</td><td>Life Technologies Holdings Pte Ltd</td><td>R0611</td><td>Required for agarose gel electroporation</td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium</td><td>Pan BioTech</td><td>P04-03500</td><td>For Hela cell culture</td></tr><tr><td>Streptavidin magnetic beads</td><td>Life Technologies Holdings Pte Ltd</td><td>65002</td><td>Dynabeads MyOne Streptavidin C1&amp;nbsp;</td></tr><tr><td>Magnetic stand for 15&amp;nbsp;mL tubes</td><td>Life Technologies Holdings Pte Ltd</td><td>12301D</td><td>DynaMag-15</td></tr><tr><td>Magnetic stand for 15&amp;nbsp;mL tubes</td><td>Life Technologies Holdings Pte Ltd</td><td>12321D</td><td>DynaMag-2</td></tr><tr><td>ThermoMixer</td><td>Eppendorf</td><td>5382 000.015</td><td>Eppendorf ThermoMixer&amp;nbsp;C</td></tr><tr><td>Biotinylated psoralen</td><td>Life Technologies Holdings Pte Ltd</td><td>29986</td><td>EZ-Link Psoralen-PEG3-Biotin</td></tr><tr><td>F8T5/BL&amp;nbsp;</td><td>Hitachi</td><td>F8T5/BL&amp;nbsp;</td><td>365 nm UV bulb</td></tr><tr><td>Fetal Bovine Serum</td><td>Life Technologies Holdings Pte Ltd</td><td>10270106&amp;nbsp;&amp;nbsp;</td><td>Components of Hela medium</td></tr><tr><td>Formamide</td><td>Promega</td><td>H5052&amp;nbsp;&amp;nbsp;</td><td>Component in hybridization buffer</td></tr><tr><td>G8T5</td><td>Sankyo-Denki</td><td>G8T5</td><td>254 nm UV bulb</td></tr><tr><td>Glycogen</td><td>Life Technologies Holdings Pte Ltd</td><td>10814010</td><td>Required for nucleic acid precipitation</td></tr><tr><td>Nanodrop</td><td>Life Technologies Holdings Pte Ltd</td><td>Nanodrop 2000</td><td>Spectrophotometer for nucleic acidquantification</td></tr><tr><td>Nuclease free water&amp;nbsp;</td><td>First BASE</td><td>BUF-1180-500ml&amp;nbsp;&amp;nbsp;</td><td></td></tr><tr><td>Penicillin Streptomycin&amp;nbsp;&amp;nbsp;</td><td>Life Technologies Holdings Pte Ltd</td><td>15140122&amp;nbsp;&amp;nbsp;</td><td>Components of Hela medium</td></tr><tr><td>High-Fidelity DNA polymerase (2x)</td><td>Life Technologies Holdings Pte Ltd</td><td>F531L&amp;nbsp;</td><td>Phusion High-Fidelity PCR Master Mix with HF Buffer (2x)</td></tr><tr><td>Primers Set 1</td><td>New England Biolabs</td><td>E7335L&amp;nbsp;</td><td>PCR primers</td></tr><tr><td>DNA Gel Extraction Kit</td><td>QIAgen</td><td>28106</td><td>QIAquick Gel Extraction Kit</td></tr><tr><td>Fluorometric Quantification kit</td><td>Life Technologies Holdings Pte Ltd</td><td>Q32854</td><td>Qubit dsDNA HS Assay Kit</td></tr><tr><td>RNA clean up kit</td><td>Qiagen</td><td>74106</td><td>RNeasy Mini Kit Silica-membrane column</td></tr><tr><td>Rnase Inhibitor</td><td>Life Technologies Holdings Pte Ltd</td><td>AM2696</td><td>SUPERase In</td></tr><tr><td>Reverse transcriptase</td><td>Life Technologies Holdings Pte Ltd</td><td>18080400</td><td>SuperScript III First-Strand Synthesis SuperMix</td></tr><tr><td>Nucleic Acid Gel Stain</td><td>Life Technologies Holdings Pte Ltd</td><td>S11494</td><td>SYBR GOLD NUCLEIC ACID 500 UL</td></tr><tr><td>T4 Polynucleotide Kinase</td><td>New England Biolabs</td><td>M0201L</td><td>End repair enzyme</td></tr><tr><td>T4 RNA Ligase 1</td><td>New England Biolabs</td><td>M0204L</td><td>Enzyme for proximity ligation</td></tr><tr><td>T4 RNA Ligase 2, truncated KQ</td><td>New England Biolabs</td><td>M0373L</td><td>Enzyme for adaptor ligation</td></tr><tr><td>Temed</td><td>Bio-Rad</td><td>1610801</td><td>TBE Urea gel component</td></tr><tr><td>Guanidinium thiocyanate-phenol-chloroform</td><td>Life Technologies Holdings Pte Ltd</td><td>15596018</td><td>TRIzol&amp;reg; Reagent for RNA extraction</td></tr><tr><td>Urea</td><td>First BASE</td><td>BIO-2070-5kg&amp;nbsp;&amp;nbsp;</td><td></td></tr><tr><td>UV crosslinker</td><td>Stratagene</td><td>400072</td><td>UV Stratalinker 1800</td></tr><tr><td>UV Transilluminator</td><td>UVP</td><td>95-0417-01</td><td>For visualizing of bands</td></tr><tr><td>Xylene Cyanol FF</td><td>Sigma-Aldrich</td><td>X4126-10G</td><td></td></tr><tr><td>DNA cleanup it</td><td>Zymo Research&amp;nbsp;</td><td>D4004</td><td>Zymo DNA concentrator-5&amp;nbsp;</td></tr><tr><td>&lt;strong&gt;List of software required&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>FastQC software</td><td>0.11.4</td><td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td><td></td></tr><tr><td>SeqPrep software</td><td>1.0.7</td><td>https://github.com/jstjohn/SeqPrep</td><td></td></tr><tr><td>BWA software</td><td>0.7.12</td><td>http://bio-bwa.sourceforge.net/</td><td></td></tr><tr><td>SAMTOOLS software</td><td>1.2.1</td><td>http://www.htslib.org/</td><td></td></tr><tr><td>PULLSEQ software</td><td>1.0.2</td><td>https://github.com/bcthomas/pullseq</td><td></td></tr><tr><td>STAR software</td><td>2.5.0c</td><td>https://github.com/alexdobin/STAR</td><td></td></tr><tr><td>rem_dups.py PYTHON script</td><td>PYTHON 2.7.11</td><td>https://github.com/CSB5/splash/tree/master/src</td><td></td></tr><tr><td>find_chimeras.py PYTHON script</td><td>PYTHON 2.7.11</td><td>https://github.com/CSB5/splash/tree/master/src</td><td></td></tr><tr><td>pickJunctionReads.awk AWK script</td><td>AWK GNU 4.1.2</td><td>https://github.com/CSB5/splash/tree/master/src</td><td></td></tr><tr><td>&lt;strong&gt;Buffer composition&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Elution buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>0.3 M sodium acetate</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Lysis Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>50 mM Tris-Cl pH 7.0</td><td></td><td></td><td></td></tr><tr><td>10 mM EDTA</td><td></td><td></td><td></td></tr><tr><td>1% SDS</td><td></td><td></td><td></td></tr><tr><td>Always add Superase-in fresh before use except when washing beads</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Proteinase K Buffer&amp;nbsp;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>100 mM NaCl</td><td></td><td></td><td></td></tr><tr><td>10 mM Tris-Cl pH 7.0</td><td></td><td></td><td></td></tr><tr><td>1 mM EDTA</td><td></td><td></td><td></td></tr><tr><td>0.5% SDS</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Hybridization Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>750 mM NaCl</td><td></td><td></td><td></td></tr><tr><td>1% SDS</td><td></td><td></td><td></td></tr><tr><td>50 mM Tris-Cl pH 7.0</td><td></td><td></td><td></td></tr><tr><td>1 mM EDTA</td><td></td><td></td><td></td></tr><tr><td>15% formamide (store in the dark at 4 &amp;deg;C)</td><td></td><td></td><td></td></tr><tr><td>Always add Superase-in fresh before use</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;2x SSC Wash Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>2x NaCl and Sodium citrate (SSC) (diluted from 20x SSC Invitrogen stock)</td><td></td><td></td><td></td></tr><tr><td>0.5% SDS</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;2x RNA fragmentation buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>18 mM MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td></td><td></td><td></td></tr><tr><td>450 mM KCl</td><td></td><td></td><td></td></tr><tr><td>300 mM Tris-Cl pH 8.3</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;2x RNA loading Dye&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>95% Formamide</td><td></td><td></td><td></td></tr><tr><td>0.02% SDS</td><td></td><td></td><td></td></tr><tr><td>0.02% bromophenol blue</td><td></td><td></td><td></td></tr><tr><td>0.01% Xylene Cyanol</td><td></td><td></td><td></td></tr><tr><td>1 mM EDTA</td><td></td><td></td><td></td></tr><tr><td colspan="4">3&#039; RNA adapter sequence:&lt;br /&gt;
5rAppCTGTAGGCACCATCAAT/3ddC</td></tr><tr><td colspan="4">RT primer sequence:&lt;br /&gt;
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG</td></tr></tbody></table>

mapping rna-rna interactions globally using biotinylated psoralen

לדעת איך RNAs אינטראקציה עם עצמם ועם אחרים היא המפתח להבנת RNA הרגולציה הגן בתא. בעוד דוגמאות של אינטראקציות RNA-RNA כגון אינטראקציות microRNA-mRNA הוכחו כדי להסדיר ביטוי גנים, את מלוא היקף שבו אינטראקציות RNA להתרחש בתא עדיין לא ידוע. שיטות קודמות כדי לחקור אינטראקציות RNA התמקדו בעיקר על תת קבוצות של RNAs כי הם אינטראקציה עם חלבון מסוים או מינים RNA. כאן, אנו מפרטים שיטה בשם S equencing של P סורלן crosslinked, L igated, ו S נבחר H ybrids (SPLASH) המאפשר לכידת גנום רחב של אינטראקציות רנ&quot;א in vivo בצורה משוחדת. SPLASH מנצל ב crosslinking vivo , קשירת הקרבה, רצף התפוקה גבוהה לזהות intramolecular ו intermolecular RNA בסיס זוגות שותפים ברחבי העולם. SPLASH ניתן ליישם אורגניזמים שונים, כולל חיידקים, שמרים ותאי אדם, כמו גםS תנאים מגוונים הסלולר כדי להקל על ההבנה של הדינמיקה של ארגון רנ&quot;א תחת הקשרים הסלולר מגוונים. כל פרוטוקול SPLASH ניסיוני לוקח בערך 5 ימים כדי להשלים את העבודה חישובית לוקח בערך 7 ימים כדי להשלים.

איור 1 מתאר את הסכימה של זרימת העבודה SPLASH. על תוספת של psoralen biotinylated בנוכחות 0.01% digitonin, ו crosslinking UV, RNA סך מופק מהתאים ואת כתם נקודה מבוצעת על מנת להבטיח crosslinking של biotinylated כדי RNA קרה ביעילות ( איור 2 ). אנו משתמשים biiginylated בסיס או...

Watch this Scientific Journal Video about Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen at JoVE.com

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

כאן, אנו מפרטים את השיטה של S equen של P סורלן crosslinked, L igated, ו S נבחר H ybrids (SPLASH), אשר מאפשר מיפוי גנום רחב של interramolecular ו intermolecular RNA-RNA אינטראקציות in vivo . SPLASH ניתן ליישם את המחקר RNA אינטראקציות של אורגניזמים כולל שמרים, חיידקים ובני אדם.

מיפוי RNA-RNA אינטראקציות גלובלי באמצעות Psoralen Biotinylated

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

mapping-rna-rna-interactions-globally-using-biotinylated-psoralen

Research

JoVE Journal

Genetics

11.9K Views.  A*STAR.  כאן, אנו מפרטים את השיטה של S equen של P סורלן crosslinked, L igated, ו S נבחר H ybrids (SPLASH), אשר מאפשר מיפוי גנום רחב של interramolecular ו intermolecular RNA-RNA אינטראקציות in vivo . SPLASH ניתן ליישם את המחקר RNA אינטראקציות של אורגניזמים כולל שמרים, חיידקים ו...

Video: Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

RNA מחייב רומן בידוד חלבונים לפי שיטת RAPID

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

Sample Preparation for Mass Spectrometry-based Identification of RNA-binding Regions

Noncoding RNAs play important roles in several nuclear processes, including regulating gene expression, chromatin structure, and DNA repair. In most cases, the action of noncoding RNAs is mediated by proteins whose functions are in turn regulated by these interactions with noncoding RNAs. Consistent with this, a growing number of proteins involved in nuclear functions have been reported to bind RNA and in a few cases the RNA-binding regions of these proteins have been mapped, often through laborious, candidate-based methods.
Here, we report a detailed protocol to perform a high-throughput, proteome-wide unbiased identification of RNA-binding proteins and their RNA-binding regions. The methodology relies on the incorporation of a photoreactive uridine analog in the cellular RNA, followed by UV-mediated protein-RNA crosslinking, and mass spectrometry analyses to reveal RNA-crosslinked peptides within the proteome. Although we describe the procedure for mouse embryonic stem cells, the protocol should be easily adapted to a variety of cultured cells.

We describe a protocol to identify RNA-binding proteins and map their RNA-binding regions in live cells using UV-mediated photocrosslinking and mass spectrometry.

הכנת הדוגמא לזיהוי מבוססי ספקטרומטר מסה של RNA-איגוד אזורים

Noncoding RNAs play important roles in several nuclear processes, including regulating gene expression, chromatin structure, and DNA repair. In most ...

Biochemistry

mRNA Interactome Capture from Plant Protoplasts

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional gene regulation (PTGR) of messenger RNAs (mRNAs). In the past few years, a number of mRNA-bound proteomes from yeast and mammalian cell lines have been successfully isolated through the use of a novel method called &#34;mRNA interactome capture,&#34; which allows for the identification of mRNA-binding proteins (mRBPs) directly from a physiological environment. The method is composed of in vivo ultraviolet (UV) crosslinking, pull-down and purification of messenger ribonucleoprotein complexes (mRNPs) by oligo(dT) beads, and the subsequent identification of the crosslinked proteins by mass spectrometry (MS). Very recently, by applying the same method, several plant mRNA-bound proteomes have been reported simultaneously from different Arabidopsis tissue sources: etiolated seedlings, leaf tissue, leaf mesophyll protoplasts, and cultured root cells. Here, we present the optimized mRNA interactome capture method for Arabidopsis thaliana leaf mesophyll protoplasts, a cell type that serves as a versatile tool for experiments that include various cellular assays. The conditions for optimal protein yield include the amount of starting tissue and the duration of UV irradiation. In the mRNA-bound proteome obtained from a medium-scale experiment (107 cells), RBPs noted to have RNA-binding capacity were found to be overrepresented, and many novel RBPs were identified. The experiment can be scaled up (109 cells), and the optimized method can be applied to other plant cell types and species to broadly isolate, catalog, and compare mRNA-bound proteomes in plants.

Here, we present an interactome capture protocol applied to Arabidopsis thaliana leaf mesophyll protoplasts. This method critically relies on in vivo UV crosslinking and allows for the isolation and identification of plant mRNA-binding proteins from a physiological environment.

MRNA Interactome ללכוד מן Protoplasts הצמח

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture (CARIC) Strategy

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used strategy for RBP capture exploits the polyadenylation [poly(A)] of target RNAs, which mostly occurs on eukaryotic mature mRNAs, leaving most binding proteins of non-poly(A) RNAs unidentified. Here we describe the detailed procedures of a recently reported method termed click chemistry-assisted RNA-interactome capture (CARIC), which enables the transcriptome-wide capture of both poly(A) and non-poly(A) RBPs by combining the metabolic labeling of RNAs, in vivo UV cross-linking, and bioorthogonal tagging.

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture CARIC Strategy

A detailed protocol for applying the click chemistry-assisted RNA-interactome capture (CARIC) strategy to identify proteins binding to both coding and noncoding RNAs is presented.

לכידת וזיהוי של RNA-מחייב חלבונים באמצעות לחץ בסיוע כימיה RNA-interactome ללכוד אסטרטגיה (CARIC)

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used ...

In Vitro Biochemical Assays using Biotin Labels to Study Protein-Nucleic Acid Interactions

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental methods to study protein-nucleic acid interactions require the use of fluorescent tags, radioactive isotopes, or other labels to detect and analyze specific target molecules. Biotin, a non-radioactive nucleic acid label, is commonly used in electrophoretic mobility shift assays (EMSA) but has not been regularly employed to monitor protein activity during nucleic acid processes. This protocol illustrates the utility of biotin labeling during in vitro enzymatic reactions, demonstrating that this label works well with a range of different biochemical assays. Specifically, in alignment with previous findings using radioisotope 32P-labeled substrates, it is confirmed via biotin-labeled EMSA that MEIOB (a protein specifically involved in the meiotic recombination) is a DNA-binding protein, that MOV10 (an RNA helicase) resolves biotin-labeled RNA duplex structures, and that MEIOB cleaves biotin-labeled single-stranded DNA. This study demonstrates that biotin is capable of substituting 32P in various nucleic acid-related biochemical assays in vitro.&#160;

Presented here are protocols for in vitro biochemical assays using biotin labels that may be widely&#160;applicable for studying protein-nucleic acid interactions.

בתוך מבחנה ביוכימית באמצעות תוויות Biotin ללמוד חלבון-גרעין חומצה אינטראקציות

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental ...

Single-step Purification of Macromolecular Complexes Using RNA Attached to Biotin and a Photo-cleavable Linker

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial purification of biologically important RNA/protein complexes. However, this strategy suffers from one major disadvantage that limits its broader utilization: the biotin/streptavidin interaction can be broken only under denaturing conditions that also disrupt the integrity of the eluted complexes, hence precluding their subsequent functional analysis and/or further purification by other methods. In addition, the eluted samples are frequently contaminated with the background proteins that nonspecifically associate with streptavidin beads, complicating the analysis of the purified complexes by silver staining and mass spectrometry. To overcome these limitations, we developed a variant of the biotin/streptavidin strategy in which biotin is attached to an RNA substrate via a photo-cleavable linker and the complexes immobilized on streptavidin beads are selectively eluted to solution in a native form by long wave UV, leaving the background proteins on the beads. Shorter RNA binding substrates can be synthesized chemically with biotin and the photo-cleavable linker covalently attached to the 5&#39; end of the RNA, whereas longer RNA substrates can be provided with the two groups by a complementary oligonucleotide. These two variants of the UV-elution method were tested for purification of the U7 snRNP-dependent processing complexes that cleave histone pre-mRNAs at the 3&#39; end and they both proved to compare favorably to other previously developed purification methods. The UV-eluted samples contained readily detectable amounts of the U7 snRNP that was free of major protein contaminants and suitable for direct analysis by mass spectrometry and functional assays. The described method can be readily adapted for purification of other RNA binding complexes and used in conjunction with single- and double-stranded DNA binding sites to purify DNA-specific proteins and macromolecular complexes.

RNA/protein complexes purified using botin-streptavidin strategy are eluted to solution under denaturing conditions in a form unsuitable for further purification and functional analysis. Here, we describe a modification of this strategy that utilizes a photo-cleavable linker in RNA and a gentle UV-elution step, yielding native and fully functional RNA/protein complexes.

צעד אחר צעד טיהור של מתחמי Macromolecular בעזרת RNA המצורפת ביוטין, מקשר צילום-cleavable

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial ...

Mapping R-Loops and RNA:DNA Hybrids with S9.6-Based Immunoprecipitation Methods

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological ...

Identification of RNAs Engaged in Direct RNA-RNA Interaction with a Long Non-Coding RNA

The growing role attributed nowadays to long non-coding RNAs (lncRNA) in physiology and pathophysiology makes it crucial to characterize their interactome by identifying their molecular partners, DNA, proteins and/or RNAs. The latter can interact with lncRNA through networks involving proteins, but they can also be engaged in direct RNA/RNA interactions. We, therefore, developed an easy-to-use RNA pull-down procedure that allowed identification of RNAs engaged in direct RNA/RNA interaction with a lncRNA using psoralen, a molecule that cross-links only RNA/RNA interactions. Bioinformatics modeling of the lncRNA secondary structure allowed the selection of several specific antisense DNA oligonucleotide probes with a strong affinity for regions displaying a low probability of internal base pairing. Since the specific probes that were designed targeted accessible regions throughout the length of the lncRNA, the RNA-interaction zones could be delineated in the sequence of the lncRNA. When coupled with a high throughput RNA sequencing, this protocol can be used for the whole direct RNA interactome studies of a lncRNA of interest.

An easy-to-use RNA pull-down protocol is designed for the identification of RNAs engaged in direct RNA/RNA interaction with a long non-coding RNA. The protocol uses psoralen as a fixative to cross-link only RNA/RNA interactions and provides the whole direct RNA interactome of a long non-coding RNA when coupled with RNA sequencing.

The growing role attributed nowadays to long non-coding RNAs (lncRNA) in physiology and pathophysiology makes it crucial to characterize their interactome ...

A Rapid High-throughput Method for Mapping Ribonucleoproteins (RNPs) on Human pre-mRNA

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding location often influences function of a splicing factor.  However, as with any sampling strategy the chance of identifying an RNA bound to a splicing factor is proportional to its cellular abundance.  We have developed a novel in vitro approach for surveying binding specificity on otherwise transient pre-mRNA. This approach utilizes a specifically designed oligonucleotide pool that tiles across introns, exons, splice junctions, or other pre-mRNA.  The pool is subjected to some kind of molecular selection. Here, we demonstrate the method by separating the oligonucleotide into a bound and unbound fraction and utilize a two color array strategy to record the enrichment of each oligonucleotide in the bound fraction. The array data generates high-resolution maps with the ability to identify sequence-specific and structural determinates of ribonucleoprotein (RNP) binding on pre-mRNA.  A unique advantage to this method is its ability to avoid the sampling bias towards mRNA associated with current IP and SELEX techniques, as the pool is specifically designed and synthesized from pre-mRNA sequence. The flexibility of the oligonucleotide pool is another advantage since the experimenter chooses which regions to study and tile across, tailoring the pool to their individual needs.  Using this technique, one can assay the effects of polymorphisms or mutations on binding on a large scale or clone the library into a functional splicing reporter and identify oligonucleotides that are enriched in the included fraction.  This novel in vitro high-resolution mapping scheme provides a unique way to study RNP interactions with transient pre-mRNA species, whose low abundance makes them difficult to study with current in vivo techniques.  



A Rapid High-throughput Method for Mapping Ribonucleoproteins RNPs on Human pre-mRNA

Due to the transient nature of pre-mRNA, it can be difficult to isolate and study in vivo. Here, we present a novel in vitro approach to investigate RNA-protein interactions using a synthetic oligo pool that tiles across selected regions of pre-mRNA.

שיטה מהירה תפוקה גבוהה עבור Ribonucleoproteins מיפוי (RNPs) על mRNA מראש אדם

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding ...

Biology

PAR-CliP - A Method to Identify Transcriptome-wide the Binding Sites of RNA Binding Proteins

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) that are often expressed in a cell-type dependently. To understand how the interplay of these RNA-binding factors affects the regulation of individual transcripts, high resolution maps of in vivo protein-RNA interactions are necessary1.
A combination of genetic, biochemical and computational approaches are typically applied to identify RNA-RBP or RNA-RNP interactions. Microarray profiling of RNAs associated with immunopurified RBPs (RIP-Chip)2 defines targets at a transcriptome level, but its application is limited to the characterization of kinetically stable interactions and only in rare cases3,4 allows to identify the RBP recognition element (RRE) within the long target RNA. More direct RBP target site information is obtained by combining in vivo UV crosslinking5,6 with immunoprecipitation7-9 followed by the isolation of crosslinked RNA segments and cDNA sequencing (CLIP)10. CLIP was used to identify targets of a number of RBPs11-17. However, CLIP is limited by the low efficiency of UV 254 nm RNA-protein crosslinking, and the location of the crosslink is not readily identifiable within the sequenced crosslinked fragments, making it difficult to separate UV-crosslinked target RNA segments from background non-crosslinked RNA fragments also present in the sample.
We developed a powerful cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs that we term PAR-CliP (Photoactivatable-Ribonucleoside-Enhanced Crosslinking and Immunoprecipitation) (see Fig. 1A for an outline of the method). The method relies on the incorporation of photoreactive ribonucleoside analogs, such as 4-thiouridine (4-SU) and 6-thioguanosine (6-SG) into nascent RNA transcripts by living cells. Irradiation of the cells by UV light of 365 nm induces efficient crosslinking of photoreactive nucleoside-labeled cellular RNAs to interacting RBPs. Immunoprecipitation of the RBP of interest is followed by isolation of the crosslinked and coimmunoprecipitated RNA. The isolated RNA is converted into a cDNA library and deep sequenced using Solexa technology. One characteristic feature of cDNA libraries prepared by PAR-CliP is that the precise position of crosslinking can be identified by mutations residing in the sequenced cDNA. When using 4-SU, crosslinked sequences thymidine to cytidine transition, whereas using 6-SG results in guanosine to adenosine mutations. The presence of the mutations in crosslinked sequences makes it possible to separate them from the background of sequences derived from abundant cellular RNAs.
Application of the method to a number of diverse RNA binding proteins was reported in Hafner et al.18

RNA transcripts are subject to extensive posttranscriptional regulation that is mediated by a multitude of trans-acting RNA-binding proteins (RBPs). Here we present a generalizable method to identify precisely and on a transcriptome-wide scale the RNA binding sites of RBPs.

PAR-Clip - שיטה לזהות Transcriptome רחב אתרי קישור של חלבונים RNA הכבילה

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ...