Name: mrna interactome capture from plant protoplasts
Uploaded: 2017-07-28T13:00:00.000+00:00
Duration: 12 min 29 s
Description: Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

אנו מכירים במעבדה של פרופ &#39;יוריס וינדריקס, שסיפק את המנגנון crosslinking UV מצויד מנורת UV קונבנציונאלי. KG נתמך על ידי קרן מחקר KU Leuven ומכיר תמיכה של FWO להעניק G065713N.

למחברים אין מה לחשוף.

אנו בהצלחה להחיל mRNA אינטראקציה ללכוד, שפותח עבור שמרים ותאי אדם, לשתול protoplasts mesophyll עלה. תאים עלה mesophyll הם הסוג העיקרי של רקמת הקרקע עלים צמח. היתרון העיקרי של שיטה זו היא כי היא משתמשת vivo crosslinking לגלות את החלבונים מסביבה פיזיולוגית. <p class="jove_content" style=";text-align:right;directi...

Eukaryotes להשתמש RNA מספר ביוגנזה מסלולים רגולטוריים כדי לשמור על תהליכים ביולוגיים תאיים. בין סוגים ידועים של רנ&quot;א, mRNA הוא מגוון מאוד ונושא קיבולת קידוד של חלבונים ואת האיזופורמים שלהם 1. מסלול PTGR מכוון את גורלם של pre-mRNAs 2 , 3 . RBPs ממשפחות גנים שונים לשלוט על הרגולציה של RNA, ב PTGR, mRNAs ספציפיים mRNAs מדריך דרך אינטראקציות פיזיות ישירות, יצירת mRNPs תפקודית. לכן, זיהוי ואפיון mRBPs ו mRNPs שלהם הוא קריטי להבנת הרגולציה של חילוף החומרים mRNA נייד 2. מעל שלושת העשורים האחרונים, שונים בשיטות חוץ גופית - כולל מבחני ניידות RNASA ניידות (REMSA) מבחנים, אבולוציה שיטתית של ligands ידי מבחני העשרה מעריכי (SELEX) מבוסס על ספריות הנגזרות בונה, RNA Bind-N-Seq (RBNS), radiolabeled או כמותיפלואורסצנטי RNA מחייב מבחני, קריסטלוגרפיה רנטגן, ו ספקטרוסקופיה תמ&quot;ג 4 , 5 , 6 , 7 , 8 , 9 - יושמו באופן נרחב על מחקרים של RBPs, בעיקר תאים יונקים. התוצאות של מחקרים אלה של RBPs יונקים ניתן לחפש באמצעות RNA מחייב DataBase חלבון (RBPDB), אשר אוספת את התצפיות שפורסמו 10 . למרות אלה בגישות חוץ גופית הם כלים רבי עוצמה, הם קובעים את מוטיבים RNA קשורות מתוך מאגר RNA נתון רצפים ולכן מוגבלים ביכולתם לגלות RNAs היעד החדש. הדבר נכון גם לגבי אסטרטגיות חישוביות לחזות RBPs גנום רחב, אשר מבוססים על שימור רצף מבנה חלבון 15 . כדי להתגבר על זה, שיטה ניסיונית חדשה חהS שהוקם המאפשר זיהוי של מוטיבים RNA כי RBP של עניין אינטראקציה עם, כמו גם על קביעת המיקום המדויק של מחייב. שיטה זו, המכונה &quot;crosslinking ו immunoprecipitation&quot; (CLIP), מורכב ב crosslinking UV vivo ואחריו immunoprecipitation 11 . מחקרים מוקדמים הראו כי photactivation של DNA ו RNA נוקליאוטידים יכול להתרחש אורכי גל UV גדול מ 245 ננומטר. התגובה באמצעות thymidine נראה מועדף (דרגה של photoreactivity ירד: dT ≥ dC&gt; rU&gt; rC, dA, dG) 12 . באמצעות אור UV עם אורך גל של 254 ננומטר (UV-C), נצפתה כי קשרים קוולנטיים בין נוקליאוטידים RNA ו שאריות חלבון נוצרות כאשר בטווח של רק כמה אנגסטרומים (Å). התופעה נקראת אפוא &quot;crosslinking&quot; באורך אפס של RNA ו- RBP. זה יכול להיות ואחריו פרוטה טיהור מחמירים<html> Dure עם רקע קטן 13 , 14 . אסטרטגיה משלימה CLIP היא לשלב ב vivo UV crosslinking עם זיהוי חלבון כדי לתאר את הנוף של RBPs. מספר פרוטוקולים כאלה של גנום- mRNA, היו מבודדים מתאי שמרים, תאי גזע עובריים (ESCs) וקווים של תאים אנושיים ( כלומר, HEK293 ו- HeLa) תוך שימוש בגישה הניסויית החדשה, הנקראת &quot;mRNA אינטראקציה ללכוד&quot; 18 , 19 , 20 , 21 . השיטה מורכבת של vivo UV crosslinking ואחריו טיהור mRNP ו- MS מבוסס proteomics. על ידי יישום אסטרטגיה זו, רבים חדשים &quot;moonlighting&quot; RBPs המכילים RBDs שאינם קנוניים התגלו, וזה הפך ברור כי יותר חלבונים יש RNA מחייב קיבולת מאשר בעבר היה אמור להיות&quot;15 , 16 , 17. השימוש בשיטה זו מאפשר ליישומים חדשים וליכולת לענות על שאלות ביולוגיות חדשות בעת חקר RBPs לדוגמה, מחקר שנערך לאחרונה בחן את שימור של פרוטאומה ה- mRNA קשור (הליבה RBP פרוטאומה) בין שמרים לתאים אנושיים 22 . RBPs צמחים כבר נמצא להיות מעורב בצמיחה ופיתוח ( למשל , בתקנה שלאחר תעתיק של זמן הפריחה, השעון היממה, ביטוי גנים במיטוכונדריה ו chloroplasts) 24 , 25 , 26 , 27 , 28 , 29 . יתר על כן, הם חשבו לבצע פונקציות בתהליכים הסלולר להגיב על מדגיש abiotic ( למשל, קר, בצורת, saLines, וחומצה אבסיסית (ABA)) 31 , 32 , 33 , 34 . ישנם יותר מ 200 גנים RBP החזוי בגנום ארבידופסיס thaliana , המבוססת על מוטיב הכרה RNA (RRM) ו K הומולוגיה (KH) מוטיבים רצף מושלם; באורז, כ -250 כבר ציינו 35 , 36 . יש לציין כי רבים חזו כי RBPs נראים ייחודיים לצמחים ( למשל, לא מטאזואנים אורתולוגים לכ 50% של ארבידופסיס RBPs החזוי המכיל תחום RRM) 35 , מה שמרמז כי רבים עשויים לשרת פונקציות חדשות. הפונקציות של רוב RBPs החזוי להישאר uncharacterized 23 . בידוד של proteomes mRNA קשורה מן שתילים ארבידופסיס etiolated, רקמת עלה, תאים שורש תרבותי, ו protoplasts mesophyll עלה באמצעות שימושלכידת mRNA אינטראקציה לאחרונה דווח 38 , 39 . מחקרים אלה מדגימים את הפוטנציאל החזק של קיטלוג שיטתי של RBPs פונקציונליים בצמחים בעתיד הקרוב. כאן, אנו מציגים פרוטוקול לכידת mRNA אינטראקציה מן protoplasts צמח ( כלומר, תאים ללא קירות התא). ארבידופסיס thaliana עלה prooplasts mesophyll הם הסוג העיקרי של תא עלה. Protoplasts מבודד לאפשר גישה אופטימלית של אור UV לתאים. סוג תא זה יכול לשמש מבחני כי transiently להביע חלבונים אפיון פונקציונלי 40 , 41 . יתר על כן, Protoplasting הוחל על סוגים אחרים של תאים צמחיים ומינים 42 , 43 , 44 ( למשל, Petersson et al ., 2009; Bargmann and Birnbaum, 2010, ו- Hong et al , 2012). &lt;P class = &quot;jove_content&quot;&gt; השיטה כוללת סך של 11 צעדים ( איור 1 א ). ארבידופסיס protoplasts mesophyll עלה מבודדים הראשון (שלב 1) והם לאחר מכן UV מוקרן ליצירת mRNPs crosslinked (שלב 2). כאשר protoplasts lysed תחת תנאי denaturing (שלב 3), mRNPs crosslinked משתחררים במאגר תמוגה / מחייב ומשוך למטה על ידי אוליגו d (T) 25 חרוזים (שלב 4). לאחר מספר סיבובים של שוטף מחמירים, mRNPs הם מטוהרים עוד ניתח. פפטידים denatured של mRBPs מתעכלים על ידי K proteinase לפני mRNAs crosslinked הם מטוהרים ואת איכות ה- RNA מאומת על ידי qRT-PCR (שלבים 5 ו -6). לאחר טיפול RNase וריכוז חלבון (שלב 7), איכות החלבון נשלטת על ידי SDS polyacrylamide ג&#39;ל אלקטרופורזה (SDS-PAGE) ואת מכתים כסף (שלב 8). ההבדל בין דפוסי הלהקה חלבון יכול בקלות להיות דמיינו בין מדגם crosslinked (CL) ומדגם לא crosslinked (לא CL;מדגם השליטה השלילי מ protoplasts כי אינו חשוף קרינה UV). זיהוי החלבונים מושגת באמצעות proteomics MS מבוססי. החלבונים מן המדגם CL מופרדים על ידי חד מימדי polyacrylamide ג&#39;ל אלקטרופורזה (1D-PAGE) כדי להסיר זיהום רקע אפשרי, הם &quot;בתוך ג &#39;ל מתעכל&quot; לתוך פפטידים קצרים באמצעות טריפסין, והם מטוהרים (שלב 9). ננו בשלב ההפוך כרומטוגרפיה נוזלית מצמידים ספקטרומטריית מסה (ננו LC-MS) מאפשר קביעת כמות של חלבונים סופי של פרוטאומה כבול mRNA (שלב 10). לבסוף, mRBPs מזוהים מאופיינים וקטלג באמצעות ניתוח ביואינפורמאטי (שלב 11).

<table><tbody><tr><td>&lt;strong&gt;REAGENTS&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>0.8 M Mannitol</td><td>Sigma</td><td>M1902-500G</td><td>Primary isotonic Enzyme solution &amp;amp;&lt;br/&gt; MMg solution</td></tr><tr><td>2 M KCl</td><td>MERCK</td><td>Art. 4935</td><td>Primary isotonic Enzyme solution &amp;amp;&lt;br/&gt; W5 buffer</td></tr><tr><td>0.2 M MES (pH 5.7)&lt;br/&gt; (4-morpholineethanesulfonic acid)</td><td>Sigma-aldrich</td><td>M2933</td><td>Primary isotonic Enzyme solution,&lt;br/&gt; W5 buffer &amp;amp;&lt;br/&gt; MMg solution,&lt;br/&gt; Filtration sterilization</td></tr><tr><td>Cellulase R10</td><td>Yakult Pharmaceutical Industry Co., Ltd.</td><td>CELLULASE&lt;br/&gt; &amp;ldquo;ONOZUKA&amp;rdquo;&lt;br/&gt; R-10, 10 g</td><td>Final isotonic enzyme solution</td></tr><tr><td>Macerozyme R10</td><td>Yakult Pharmaceutical Industry Co., Ltd.</td><td>MACEROZYME R-10, 10g</td><td>Final isotonic enzyme solution</td></tr><tr><td>10% (&lt;em&gt;w/v&lt;/em&gt;) BSA&lt;br/&gt; (Bovine Serum Albumin)</td><td>Sigma-aldrich</td><td>A7906-100G</td><td>Final isotonic enzyme solution &amp;amp;&lt;br/&gt; Filtration sterilization</td></tr><tr><td>1 M CaCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Chem-Lab NV</td><td>CL00.0317.1000</td><td>Final isotonic enzyme solution,&lt;br/&gt; W5 buffer &amp;amp;&lt;br/&gt; Digestion buffer</td></tr><tr><td>1 M NaCl</td><td>Fisher Chemical</td><td>S/3160/60</td><td>W5 buffer</td></tr><tr><td>2 M MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>M8266-100G</td><td>MMg solution</td></tr><tr><td>1 M LiCl&lt;br/&gt; (Lithium Chloride)</td><td>Acros</td><td>199885000</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1,&lt;br/&gt; Wash buffer 2 &amp;amp;&lt;br/&gt; Low salt buffer</td></tr><tr><td>5% (&lt;em&gt;w/v&lt;/em&gt;) LiDS&lt;br/&gt; (Lithium Dodecyl Sulphate)</td><td>Sigma-aldrich</td><td>L4632-25G</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1 &amp;amp;&lt;br/&gt; Filtration sterilization</td></tr><tr><td>1 M DTT&lt;br/&gt; (Dithiothreitol)</td><td>Thermo Fisher Scientific&lt;br/&gt; Wash buffer 1 &amp;amp;&lt;br/&gt; Wash buffer 2</td><td>307866</td><td>Lysis/binding buffer,</td></tr><tr><td>1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl))</td><td>Acros &amp;amp;&lt;br/&gt; Fisher Chemical</td><td>167620010 &amp;amp;&lt;br/&gt; H/1200/PB15</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1,&lt;br/&gt; Wash buffer 2,&lt;br/&gt; Low salt buffer &amp;amp;&lt;br/&gt; Elution buffer</td></tr><tr><td>0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid)</td><td>Sigma-aldrich</td><td>ED-500G</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1,&lt;br/&gt; Wash buffer 2,&lt;br/&gt; Low salt buffer &amp;amp;&lt;br/&gt; Elution buffer</td></tr><tr><td>Tween 20</td><td>MERCK</td><td>8.22184.0500</td><td>Regeneration of oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; beads</td></tr><tr><td>0.1 M NaOH</td><td>VWR PROLABO CHEMICALS</td><td>28244.295</td><td>Regeneration of oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; beads</td></tr><tr><td>1x PBS (pH 7.4)&lt;br/&gt; (Phosphate Buffered Saline)&lt;br/&gt; containing&lt;br/&gt; (NaCl; KCl; Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;; KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Fisher Chemical, MERCK,&lt;br/&gt; Sigma-aldrich &amp;amp; SAFC</td><td>S/3160/60,&lt;br/&gt; Art. 4935,&lt;br/&gt; 71640-250G &amp;amp;&lt;br/&gt; 60230</td><td>Regeneration of oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; beads</td></tr><tr><td>Proteinase K solution (2 &amp;mu;g/&amp;mu;L)</td><td>Thermo Fisher Scientific</td><td>11789020</td><td>Protein digestion</td></tr><tr><td>Loading dye</td><td>Invitrogen</td><td>LC5925</td><td>SDS-PAGE</td></tr><tr><td>qPCR master mix</td><td>Promega</td><td>A6001</td><td>qRT-PCR assay</td></tr><tr><td>RNase Cocktail</td><td>Thermo Fisher Scientific</td><td>AM2286</td><td>RNA digestion</td></tr><tr><td>Methanol</td><td>Sigma-aldrich</td><td>322415</td><td>Gel fixation and gel destaining</td></tr><tr><td>Acetic acid</td><td>Sigma-aldrich</td><td>537020</td><td>Gel fixation and gel destaining</td></tr><tr><td>Coomassie Brilliant Blue R-250</td><td>Thermo Fisher Scientific</td><td>20278</td><td>Gel staining</td></tr><tr><td>1 M NH&lt;sub&gt;4&lt;/sub&gt;HCO&lt;sub&gt;3&lt;/sub&gt;&lt;br/&gt; (Ammonium bicarbonate)&lt;br/&gt; &amp;nbsp;</td><td>Sigma-aldrich</td><td>09830-500G</td><td>Gel hydration &amp;amp;&lt;br/&gt; Digestion buffer</td></tr><tr><td>CH&lt;sub&gt;3&lt;/sub&gt;CN&lt;br/&gt; (Acetonitrile)</td><td>Sigma-aldrich</td><td>34851-100ML</td><td>Gel dehydration &amp;amp;&lt;br/&gt; Peptide dissolving solution</td></tr><tr><td>IAA&lt;br/&gt; (Iodoacetic acid)</td><td>Sigma-aldrich</td><td>I4386-10G</td><td>Alkylating agent</td></tr><tr><td>TFA&lt;br/&gt; (Trifluoroacetic acid)</td><td>Sigma-aldrich</td><td>302031-10X1ML</td><td>Peptide dissolving solution</td></tr><tr><td>FA&lt;br/&gt; (Formic acid)</td><td>Sigma-aldrich</td><td>06554-5G</td><td>Peptide extraction</td></tr><tr><td>Trypsin solution (6 ng/&amp;mu;L)</td><td>Promega</td><td>V5280</td><td>Digestion buffer</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;EQUIPMENT&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Soil</td><td>Peltracom</td><td>LP2D</td><td>Plant growth</td></tr><tr><td>Vermiculite 3</td><td>Sibli AS</td><td>05VERMICULIET</td><td>Plant growth</td></tr><tr><td>Petri dish (150 x 20 mm)</td><td>Sarstedt</td><td>82.1184.500</td><td>Carrier for protoplast suspension</td></tr><tr><td>0.22 &amp;mu;m filter</td><td>Millipore</td><td>SE2M229104</td><td>Homogenization of final isotonic enzyme solution</td></tr><tr><td>Razorblade</td><td>Agar Scientific</td><td>T585</td><td>Rosette leaf strips</td></tr><tr><td>35-75 &amp;mu;m nylon mesh</td><td>SEFAR NITEX</td><td>74010</td><td>Protoplast suspension filtration</td></tr><tr><td>50 mL round bottom tubes</td><td>Sigma-aldrich</td><td>T1918-10EA</td><td>Carrier for protoplast suspension</td></tr><tr><td>Hemocytometer&lt;br/&gt; (B&amp;uuml;rker hemocytometer)</td><td>MARIENFELD</td><td>650030</td><td>Protoplast cell counting</td></tr><tr><td>UV crosslinking apparatus&lt;br/&gt; (HL-2000 HybriLinker)</td><td>UVP, LLC</td><td>UVP95003101</td><td>&lt;em&gt;in vivo&lt;/em&gt; UV crosslinking</td></tr><tr><td>UV lamp&lt;br/&gt; (Sankyo-Denki G8T5)</td><td>SANKYO&lt;br/&gt; DENKI</td><td>SD G8T5</td><td>&lt;em&gt;in vivo&lt;/em&gt; UV crosslinking</td></tr><tr><td>50 mL glass syringe</td><td>FORTUNA Optima</td><td>Z314560</td><td>Homogenization of protoplast lysate</td></tr><tr><td>Narrow needle (0.9 x 25 mm)</td><td>Becton Dickinson microlance 3</td><td>2021-04</td><td>Homogenization of protoplast lysate</td></tr><tr><td>Rotator Model L26</td><td>Labinco BV</td><td>26110912</td><td>Sample incubation by rotating</td></tr><tr><td>Oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; magnetic beads&lt;br/&gt; (5 mg/mL)</td><td>New England BioLabs</td><td>S1419S</td><td>mRNPs and mRNAs binding and pull-down</td></tr><tr><td>Magnetic rack</td><td>Invitrogen</td><td>CS15000</td><td>mRNPs and mRNAs binding and pull-down</td></tr><tr><td>Centrifugal filter units&lt;br/&gt; (Amicon Ultra-4 centrifugal filter units)</td><td>EMD Millipore</td><td>UFC800308</td><td>mRBP concentration</td></tr><tr><td>Pierce Silver Stain Kit</td><td>Thermo Fisher Scientific</td><td>24612</td><td>Silver-staining assay</td></tr><tr><td>RNA purification kit&lt;br/&gt; (InviTrap Spin Plant RNA Mini Kit)</td><td>STRATEC Molecular</td><td>1064100300</td><td>RNA purification</td></tr><tr><td>Spectrophotometer device (NanoDrop 1000 Spectrophotometer)</td><td>Thermo Fisher Scientific</td><td>ND-1000</td><td>RNA quality and quantity</td></tr><tr><td>Real-Time PCR cycler&lt;br/&gt; (StepOne Real-Time PCR cycler)</td><td>Thermo Fisher Scientific</td><td>4376600</td><td>cDNA quantification</td></tr><tr><td>&amp;micro;-C18 columns&lt;br/&gt; (Millipore Zip Tip &amp;micro;-C18 columns)</td><td>Sigma-aldrich</td><td>720046-960EA</td><td>Peptide purification</td></tr><tr><td>Mass spectrometer&lt;br/&gt; (Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)</td><td>Thermo Fisher Scientific</td><td>IQLAAEGAAPFALGMAZR</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument)</td><td>Thermo Fisher Scientific</td><td>ULTIM3000RSLCNANO</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>C18 column&lt;br/&gt; (Easy Spray Pepmap RSLC C18 column)</td><td>Thermo Fisher Scientific</td><td>ES800</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>C18 precolumn&lt;br/&gt; (Acclaim Pepmap 100 C18 precolumn)</td><td>Thermo Fisher Scientific</td><td>160321</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Primers for qRT-PCR assay&lt;/strong&gt;</td><td>&lt;strong&gt;Sequences&lt;/strong&gt;</td><td></td><td></td></tr><tr><td>&lt;em&gt;UBQ10&lt;/em&gt; mRNA&lt;br/&gt; (Li &lt;em&gt;et al.&lt;/em&gt;, 2014)</td><td>Fw: AACTTTGGTGGTTTGTGTTTTGG&lt;br/&gt; Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA</td><td></td><td></td></tr><tr><td>18S rRNA&lt;br/&gt; (Durut &lt;em&gt;et al.&lt;/em&gt;, 2014)</td><td>Fw: CGTAGTTGAACCTTGGGATG&lt;br/&gt; Rv: CACGACCCGGCCAATTA</td><td></td><td></td></tr></tbody></table>

mrna interactome capture from plant protoplasts

RNA מחייב חלבונים (RBPs) לקבוע את גורלם של RNAs. הם משתתפים בכל המסלולים ביוגנזה רנ&quot;א ובמיוחד לתרום שלאחר תקנת גנים תקנה (PTGR) של RNAs השליח (mRNAs). בשנים האחרונות, מספר mRNA-proteomes כבול מן השמרים שורות תאים יונקים היו מבודדים בהצלחה באמצעות שיטה חדשנית בשם &quot;mRNA אינטראקציה ללכוד&quot;, המאפשר זיהוי של mRNA מחייב חלבונים (mRBPs) ישירות מתוך סביבה פיזיולוגית. השיטה מורכבת מ - vivo אולטרה סגול (UV) crosslinking, משוך מטה וטיהור של מסנג &#39;ר ribonucleoprotein קומפלקסים (mRNPs) על ידי חרוזים אוליגו (DT), ואת זיהוי שלאחר מכן של חלבונים crosslinked על ידי ספקטרומטריית מסה (MS). לאחרונה, על ידי יישום שיטה זהה, כמה צמחים mRNA כבול חלבונים דווחו בו זמנית ממקורות רקמה שונים ארבידופסיס : שתילים etiolated, רקמת עלה,עלה prooplasts mesophyll, ותאי שורש תרבותי. כאן, אנו מציגים את אופטימיזציה mRNA אינטראקציה ללכוד שיטת ארבידופסיס thaliana protoplasts mesophyll עלה, סוג התא המשמש כלי רב תכליתי עבור ניסויים הכוללים מבחני הסלולר השונים. התנאים התשואה חלבון אופטימלי כוללים את כמות הרקמות החל ואת משך קרינה UV. ב- mRNA-proteome שהתקבל בניסוי בקנה מידה בינוני (10 7 תאים), RBPs ציינו כי קיבולת ה- RNA מחייב נמצאו לייצג יתר על המידה, ורבים RBPs מזוהים זוהו. הניסוי יכול להיות scaled up (10 9 תאים), ואת השיטה אופטימיזציה ניתן להחיל על סוגי תאים צמחיים אחרים מינים כדי לבודד באופן רחב, קטלוג, ולהשוות proteomes mRNA- קשורה בצמחים.

ראינו הילה אופיינית, המקיפה את גלולה חרוז במדגם CL, לשטוף שלב 4.3 עם חיץ לשטוף 2 ( איור 1 ב ). למרות שזה לא נחקר, התופעה הזאת כנראה ניתן להסביר על ידי הפרעה של מתחמי mRNP crosslinked עם צבירה חרוז במהלך לכידת מגנטי, גרימת צבירה מפוזר יותר להיווצר. זה...

Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

mRNA Interactome Capture from Plant Protoplasts

כאן, אנו מציגים פרוטוקול האינטראקציה ללכוד להחיל על Arabopopsis thaliana עלה mesophyll protoplasts. שיטה זו מסתמכת באופן קריטי על vivo UV crosslinking ומאפשר בידוד וזיהוי של חלבונים mRNA מחייב הצמח מסביבה פיזיולוגית.

MRNA Interactome ללכוד מן Protoplasts הצמח

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

mrna-interactome-capture-from-plant-protoplasts

Research

JoVE Journal

Biochemistry

9.0K Views.  KU Leuven.  כאן, אנו מציגים פרוטוקול האינטראקציה ללכוד להחיל על Arabopopsis thaliana עלה mesophyll protoplasts. שיטה זו מסתמכת באופן קריטי על vivo UV crosslinking ומאפשר בידוד וזיהוי של חלבונים mRNA מחייב הצמח מסביבה פיזיולוגית. 

Video: mRNA Interactome Capture from Plant Protoplasts

A Robotic Platform for High-throughput Protoplast Isolation and Transformation

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal transduction pathways, transcriptional regulatory networks, gene expression, genome-editing, and gene-silencing. Furthermore, significant progress has been made in the regeneration of plants from protoplasts, which has generated even more interest in the use of these systems for plant genomics. In this work, a protocol has been developed for automation of protoplast isolation and transformation from a &#39;Bright Yellow&#39; 2 (BY-2) tobacco suspension culture using a robotic platform. The transformation procedures were validated using an orange fluorescent protein (OFP) reporter gene (pporRFP) under the control of the Cauliflower mosaic virus 35S promoter (35S). OFP expression in protoplasts was confirmed by epifluorescence microscopy. Analyses also included protoplast production efficiency methods using propidium iodide. Finally, low-cost food-grade enzymes were used for the protoplast isolation procedure, circumventing the need for lab-grade enzymes that are cost-prohibitive in high-throughput automated protoplast isolation and analysis. Based on the protocol developed in this work, the complete procedure from protoplast isolation to transformation can be conducted in under 4 hr, without any input from the operator. While the protocol developed in this work was validated with the BY-2 cell culture, the procedures and methods should be translatable to any plant suspension culture/protoplast system, which should enable acceleration of crop genomics research.

A high-throughput, automated, tobacco protoplast production and transformation methodology is described. The robotic system enables massively parallel gene expression and discovery in the model BY-2 system that should be translatable to non-model crops.

פלטפורמה רובוטית עבור תפוקה גבוהה בידוד פרוטופלאסט וההשנאה

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal ...

Genetics

2 in 1: One-step Affinity Purification for the Parallel Analysis of Protein-Protein and Protein-Metabolite Complexes

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of protein-protein interactions (PPI) is no novelty, experimental approaches aiming to characterize endogenous protein-metabolite interactions (PMI) constitute a rather recent development. Herein, we present a protocol that allows simultaneous characterization of the PPI and PMI of a protein of choice, referred to as bait. Our protocol was optimized for Arabidopsis cell cultures and combines affinity purification (AP) with mass spectrometry (MS)-based protein and metabolite detection. In short, transgenic Arabidopsis lines, expressing bait protein fused to an affinity tag, are first lysed to obtain a native cellular extract. Anti-tag antibodies are used to pull down protein and metabolite partners of the bait protein. The affinity-purified complexes are extracted using a one-step methyl tert-butyl ether (MTBE)/methanol/water method. Whilst metabolites separate into either the polar or the hydrophobic phase, proteins can be found in the pellet. Both metabolites and proteins are then analyzed by ultra-performance liquid chromatography-mass spectrometry (UPLC-MS or UPLC-MS/MS). Empty-vector (EV) control lines are used to exclude false positives. The major advantage of our protocol is that it enables identification of protein and metabolite partners of a target protein in parallel in near-physiological conditions (cellular lysate). The presented method is straightforward, fast, and can be easily adapted to biological systems other than plant cell cultures.

Protein-protein and protein-metabolite interactions are crucial for all cellular functions. Herein, we describe a protocol that allows parallel analysis of these interactions with a protein of choice. Our protocol was optimized for plant cell cultures and combines affinity purification with mass spectrometry-based protein and metabolite detection.

2 ב 1: בשלב אחד טיהור זיקה לניתוח מקבילים של חלבון, מתחמי חלבון-מטבוליט

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of ...

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

מיון פלואורסצנטי תא פעיל של Protoplasts הצמח

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Biology

Translating Ribosome Affinity Purification (TRAP) to Investigate Arabidopsis thaliana Root Development at a Cell Type-Specific Scale

In this article, we give hands-on instructions to obtain translatome data from different Arabidopsis thaliana root cell types via the translating ribosome affinity purification (TRAP) method and consecutive optimized low-input library preparation.
As starting material, we employ plant lines that express GFP-tagged ribosomal protein RPL18 in a cell type-specific manner by use of adequate promoters. Prior to immunopurification and RNA extraction, the tissue is snap frozen, which preserves tissue integrity and simultaneously allows execution of time series studies with high temporal resolution. Notably, cell wall structures remain intact, which is a major drawback in alternative procedures such as fluorescence-activated cell sorting-based approaches that rely on tissue protoplasting to isolate distinct cell populations. Additionally, no tissue fixation is necessary as in laser capture microdissection-based techniques, which allows high-quality RNA to be obtained.
However, sampling from subpopulations of cells and only isolating polysome-associated RNA severely limits RNA yields. It is, therefore, necessary to apply sufficiently sensitive library preparation methods for successful data acquisition by RNA-seq.
TRAP offers an ideal tool for plant research as many developmental processes involve cell wall-related and mechanical signaling pathways. The use of promoters to target specific cell populations is bridging the gap between organ and single-cell level that in turn suffer from little resolution or very high costs. Here, we apply TRAP to study cell-cell communication in lateral root formation.

Translating Ribosome Affinity Purification TRAP to Investigate Arabidopsis thaliana Root Development at a Cell Type-Specific Scale

Translating ribosome affinity purification (TRAP) offers the possibility to dissect developmental programs with minimal processing of organs and tissues. The protocol yields high-quality RNA from cells targeted with a green fluorescent protein (GFP)-labeled ribosomal subunit. Downstream analysis tools, such as qRT-PCR or RNA-seq, reveal tissue and cell type-specific expression profiles.

מתרגם הריבוכמה אהדה לטיהור (מלכודת) כדי לחקור את התפתחות השורש של הספר הבסיסי בקנה מידה ספציפי לסוג תא

In this article, we give hands-on instructions to obtain translatome data from different Arabidopsis thaliana root cell types via the translating ribosome ...

Developmental Biology

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation (BiFC) System

We have developed a BiFC technique to test the interaction between two proteins in vivo. This is accomplished by splitting a yellow fluorescent protein (YFP) into two non-overlapping fragments. Each fragment is cloned in-frame to a gene of interest. These constructs can then be co-transformed into Nicotiana benthamiana via Agrobacterium mediated transformation, allowing the transit expression of fusion proteins. The reconstitution of YFP signal only occurs when the inquest proteins interact 1-7. To test and validate the protein-protein interactions, BiFC can be used together with yeast two hybrid (Y2H) assay. This may detect indirect interactions which can be overlooked in the Y2H. Gateway technology is a universal platform that enables researchers to shuttle the gene of interest (GOI) into as many expression and functional analysis systems as possible8,9. Both the orientation and reading frame can be maintained without using restriction enzymes or ligation to make expression-ready clones. As a result, one can eliminate all the re-sequencing steps to ensure consistent results throughout the experiments. We have created a series of Gateway compatible BiFC and Y2H vectors which provide researchers with easy-to-use tools to perform both BiFC and Y2H assays10. Here, we demonstrate the ease of using our BiFC system to test protein-protein interactions in N. benthamiana plants.

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation BiFC System

We have developed a technique to test protein-protein interactions in plant. A yellow fluorescent protein (YFP) is split into two non-overlapping fragments. Each fragment is cloned in-frame to a gene of interest via Gateway system, enabling expression of fusion proteins. Reconstitution of YFP signal only occurs when the inquest proteins interact.

איתור של אינטראקציות חלבון הצמח באמצעות bimolecular תואם Gateway הקרינה השלמה (BiFC) מערכת

We have developed a BiFC technique to test the interaction between two proteins in vivo. This is accomplished by splitting a yellow fluorescent protein ...

TurboID-Based Proximity Labeling for In Planta Identification of Protein-Protein Interaction Networks

Proximity labeling (PL) techniques using engineered ascorbate peroxidase (APEX) or Escherichia coli biotin ligase BirA (known as BioID) have been successfully used for identification of protein-protein interactions (PPIs) in mammalian cells. However, requirements of toxic hydrogen peroxide (H2O2) in APEX-based PL, longer incubation time with biotin (16&#8211;24 h), and higher incubation temperature (37 &#176;C) in BioID-based PL severely limit their applications in plants. The recently described TurboID-based PL addresses many limitations of BioID and APEX. TurboID allows rapid proximity labeling of proteins in just 10&#8201;min under room temperature (RT) conditions. Although the utility of TurboID has been demonstrated in animal models, we recently showed that TurboID-based PL performs better in plants compared to BioID for labeling of proteins that are proximal to a protein of interest. Provided here is a step-by-step protocol for the identification of protein interaction partners using the N-terminal Toll/interleukin-1 receptor (TIR) domain of the nucleotide-binding leucine-rich repeat (NLR) protein family as a model. The method describes vector construction, agroinfiltration of protein expression constructs, biotin treatment, protein extraction and desalting, quantification, and enrichment of the biotinylated proteins by affinity purification. The protocol described here can be easily adapted to study other proteins of interest in Nicotiana and other plant species.

Described here is a proximity labeling method for identification of interaction partners of the TIR domain of the NLR immune receptor in Nicotiana benthamiana leaf tissue. Also provided is a detailed protocol for the identification of interactions between other proteins of interest using this technique in Nicotiana and other plant species.

מבוסס TurboID הסמיכות תיוג עבור בזיהוי Planta של חלבון-חלבון רשתות אינטראקציה

Proximity labeling (PL) techniques using engineered ascorbate peroxidase (APEX) or Escherichia coli biotin ligase BirA (known as BioID) have been ...

Immunology and Infection

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

זיהוי לאחר translational השינויים של קומפלקסי חלבוני צמח

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Protein-protein Interactions Visualized by Bimolecular Fluorescence Complementation in Tobacco Protoplasts and Leaves

Many proteins interact transiently with other proteins or are integrated into multi-protein complexes to perform their biological function. Bimolecular fluorescence complementation (BiFC) is an in vivo method to monitor such interactions in plant cells. In the presented protocol the investigated candidate proteins are fused to complementary halves of fluorescent proteins and the respective constructs are introduced into plant cells via agrobacterium-mediated transformation. Subsequently, the proteins are transiently expressed in tobacco leaves and the restored fluorescent signals can be detected with a confocal laser scanning microscope in the intact cells. This allows not only visualization of the interaction itself, but also the subcellular localization of the protein complexes can be determined. For this purpose, marker genes containing a fluorescent tag can be coexpressed along with the BiFC constructs, thus visualizing cellular structures such as the endoplasmic reticulum, mitochondria, the Golgi apparatus or the plasma membrane. The fluorescent signal can be monitored either directly in epidermal leaf cells or in single protoplasts, which can be easily isolated from the transformed tobacco leaves. BiFC is ideally suited to study protein-protein interactions in their natural surroundings within the living cell. However, it has to be considered that the expression has to be driven by strong promoters and that the interaction partners are modified due to fusion of the relatively large fluorescence tags, which might interfere with the interaction mechanism. Nevertheless, BiFC is an excellent complementary approach to other commonly applied methods investigating protein-protein interactions, such as coimmunoprecipitation, in vitro pull-down assays or yeast-two-hybrid experiments.

Formation of protein complexes in vivo can be visualized by bimolecular fluorescence complementation. Interaction partners are fused to complementary parts of fluorescent tags and transiently expressed in tobacco leaves, resulting in a reconstituted fluorescent signal upon close proximity of the two proteins.

חלבונים אינטראקציות דמיינו ידי bimolecular הקרינה complementation בProtoplasts הטבק ועלים

Many proteins interact transiently with other proteins or are integrated into multi-protein complexes to perform their biological function. Bimolecular ...

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

הכרומטין immunoprecipitation Assay עבור זיהוי של אינטראקציות החלבון-דנ&quot;א ארבידופסיס<em&gt; In vivo</em

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics

Protein-protein interactions are fundamental mechanisms for relaying signal transduction in most cellular processes; therefore, identification of novel protein-protein interaction pairs and monitoring protein interaction dynamics are of particular interest for revealing how plants respond to environmental factors and/or developmental signals. A plethora of approaches have been developed to examine protein-protein interactions, either in vitro or in vivo. Among them, the recently established luciferase complementation imaging (LCI) assay is the simplest and fastest method for demonstrating in vivo protein-protein interactions. In this assay, protein A or protein B is fused with the amino-terminal or carboxyl-terminal half of luciferase, respectively. When protein A interacts with protein B, the two halves of luciferase will be reconstituted to form a functional and active luciferase enzyme. Luciferase activity can be recorded with a luminometer or CCD-camera. Compared with other approaches, the LCI assay shows protein-protein interactions both qualitatively and quantitatively. Agrobacterium infiltration in Nicotiana benthamiana leaves is a widely used system for transient protein expression. With the combination of LCI and transient expression, these approaches show that the physical interaction between COP1 and SPA1 was gradually reduced after jasmonate treatment.

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics

This manuscript describes an easy and rapid experimental procedure for determining protein-protein interactions based on the measurement of luciferase activity.

לוציפראז קומפלמנטציה הדמיה Assay העלים טבק benthamiana עבור Transiently קביעת חלבון אינטראקציה דינמיקה

Protein-protein interactions are fundamental mechanisms for relaying signal transduction in most cellular processes; therefore, identification of novel ...