Name: mapping rna-rna interactions globally using biotinylated psoralen
Uploaded: 2017-05-24T13:00:00
Description: Watch this Scientific Journal Video about Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen at JoVE.com

We thank members of the Wan lab and the Nagarajan lab for informative discussions. N.Nagarajan is supported by funding from A*STAR. Y.Wan is supported by funding from A*STAR and Society in Science-Branco Weiss Fellowship.

1. Treatment of HeLa Cells with Biotinylated Psoralen and RNA Extraction
<ol>
	<li>Culture HeLa cells in Dulbecco&#39;s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin streptomycin (PS) in a 10 cm plate.</li>
	<li>Wash the HeLa cells twice with 5 mL of 1x PBS. Drain excess PBS completely from the dish by placing the dish vertically for 1 min.</li>
	<li>Add 1 mL of PBS containing 200 &#181;M of biotinylated psoralen and 0.01% w/v digitonin, to the cells uniformly and incubat...

<ol>
	<li>Wan, Y., Kertesz, M., Spitale, R. C., Segal, E., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+the+transcriptome+through+RNA+structure.">Understanding the transcriptome through RNA structure.</a> Nat.Rev.Genet. 12 (9), 641-655 (2011).</li><li>Kertesz, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+measurement+of+RNA+secondary+structure+in+yeast.">Genome-wide measurement of RNA secondary structure in yeast.</a> Nature. 467 (7311), 103-107 (2010).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+Measurement+of+RNA+Folding+Energies.">Genome-wide Measurement of RNA Folding Energies.</a> Mol.Cell. 48 (2), 169-181 (2012).</li><li>Wan, Y., Qu, K., Ouyang, Z., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+RNA+structure+using+nuclease+digestion+and+high-throughput+sequencing.">Genome-wide mapping of RNA structure using nuclease digestion and high-throughput sequencing.</a> Nat.Protoc. 8 (5), 849-869 (2013).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+and+variation+of+RNA+secondary+structure+across+the+human+transcriptome.">Landscape and variation of RNA secondary structure across the human transcriptome.</a> Nature. 505 (7485), 706-709 (2014).</li><li>Spitale, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+imprints+in+vivo+decode+RNA+regulatory+mechanisms.">Structural imprints in vivo decode RNA regulatory mechanisms.</a> Nature. 519 (7544), 486-490 (2015).</li><li>Ding, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+genome-wide+profiling+of+RNA+secondary+structure+reveals+novel+regulatory+features.">In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features.</a> Nature. 505 (7485), 696-700 (2014).</li><li>Rouskin, S., Zubradt, M., Washietl, S., Kellis, M., Weissman, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+probing+of+RNA+structure+reveals+active+unfolding+of+mRNA+structures+in+vivo.">Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo.</a> Nature. 505 (7485), 701-705 (2014).</li><li>Kudla, G., Granneman, S., Hahn, D., Beggs, J. D., Tollervey, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-linking,+ligation,+and+sequencing+of+hybrids+reveals+RNA-RNA+interactions+in+yeast.">Cross-linking, ligation, and sequencing of hybrids reveals RNA-RNA interactions in yeast.</a> Proc.Natl.Acad.Sci.U.S.A. 108 (24), 10010-10015 (2011).</li><li>Sugimoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=hiCLIP+reveals+the+in+vivo+atlas+of+mRNA+secondary+structures+recognized+by+Staufen+1.">hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1.</a> Nature. 519 (7544), 491-494 (2015).</li><li>Engreitz, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-RNA+interactions+enable+specific+targeting+of+noncoding+RNAs+to+nascent+Pre-mRNAs+and+chromatin+sites.">RNA-RNA interactions enable specific targeting of noncoding RNAs to nascent Pre-mRNAs and chromatin sites.</a> Cell. 159 (1), 188-199 (2014).</li><li>Ramani, V., Qiu, R., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+determination+of+RNA+structure+by+proximity+ligation.">High-throughput determination of RNA structure by proximity ligation.</a> Nat.Biotechnol. , (2015).</li><li>Lu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+Duplex+Map+in+Living+Cells+Reveals+Higher-Order+Transcriptome+Structure.">RNA Duplex Map in Living Cells Reveals Higher-Order Transcriptome Structure.</a> Cell. 165 (5), 1267-1279 (2016).</li><li>Sharma, E., Sterne-Weiler, T., O'Hanlon, D., Blencowe, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+Mapping+of+Human+RNA-RNA+Interactions.">Global Mapping of Human RNA-RNA Interactions.</a> Mol.Cell. 62 (4), 618-626 (2016).</li><li>Aw, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Mapping+of+Eukaryotic+RNA+Interactomes+Reveals+Principles+of+Higher-Order+Organization+and+Regulation.">In Vivo Mapping of Eukaryotic RNA Interactomes Reveals Principles of Higher-Order Organization and Regulation.</a> Mol.Cell. 62 (4), 603-617 (2016).</li></ol>

Here, we describe in detail the experimental and computational workflow for SPLASH, a method that allows us to identify pair-wise RNA interactions in a genome-wide manner. We have successfully utilized SPLASH in bacterial, yeast and human cultures and anticipate that the strategy can be widely applied to diverse organisms under different cellular states. One of the critical steps in the protocol is to start with at least 20 &#181;g of crosslinked RNA to have adequate material for downstream processes. The RNA is then fra...

Studying how macromolecules fold and interact with each other is the key to understanding gene regulation in the cell. While much effort has been focused in the past decade on understanding how DNA and proteins contribute to gene regulation, relatively less is known about post-transcriptional regulation of gene expression. RNA carries information in both its linear sequence and in its secondary and tertiary structure1. Its ability to base pair with itself and with others is important for its function in vivo. Recent advances in high throughput RNA secondary structure probing has provided valuable insights into the locations of double and single stranded regions in the transcriptome2,3,4,5,6,7,8, however information on the pairing interaction partners is still largely missing. To determine which RNA sequence is interacting with another RNA region in the transcriptome, we need global pair-wise information.
Mapping pair-wise RNA interactions in a global, unbiased manner has traditionally been a major challenge. While previous approaches, such as CLASH9, hiCLIP10 and RAP11, are used to identify RNA interactions in a large scale manner, these techniques typically map RNA base pairing for a subset of RNAs that either interact with a particular protein or RNA species. Recent developments in studying global RNA interactions include the method RPL12, which does not stabilize RNA interactions in vivo and hence may only capture a subset of in vivo interactions. To overcome these challenges, we and others developed genome-wide, unbiased strategies to map RNA interactomes in vivo, using modified versions of the crosslinker psoralen13,14,15. In this protocol, we describe the details for performing Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH), which utilizes biotinylated psoralen to crosslink base pairing RNAs in vivo, followed by proximity ligation and high throughput sequencing to identify RNA base-pairing partners genome-wide (Figure 1)15.
In this manuscript, we describe the steps to perform SPLASH using cultured adherent cells, in this case HeLa cells. The same protocol can be easily adapted to suspension mammalian cells and to yeast and bacteria cells. Briefly, HeLa cells are treated with biotinylated psoralen and irradiated at 365 nm to crosslink interacting RNA base pairs in vivo. The RNAs are then extracted from the cells, fragmented and enriched for crosslinking regions using streptavidin beads. Interacting RNA fragments are then ligated together using proximity ligation and made into a cDNA library for deep sequencing. Upon sequencing, the chimeric RNAs are mapped onto the transcriptome/genome to identify the RNA interacting regions that are paired to each other. We have successfully utilized SPLASH to identify thousands of RNA interactions in vivo in yeast and different human cells, including intramolecular and intermolecular RNA base pairing in diverse classes of RNAs, such as snoRNAs, lncRNAs and mRNAs, to glimpse into the structural organization and interaction patterns of RNAs in the cell.

<table border="0" cellpadding="0" cellspacing="0" width="1136">
	<colgroup>
		<col />
		<col span="3" />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:284px;">1 Kb Plus DNA Ladder</td>
			<td style="width:284px;">Life Technologies Holdings Pte Ltd</td>
			<td style="width:284px;">10787026</td>
			<td style="width:284px;">DNA ladder</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 bp DNA ladder</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10821-015</td>
			<td>DNA ladder</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20 % SDS solution</td>
			<td>First BASE</td>
			<td>BUF-2052-1L&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20x SSC</td>
			<td>First BASE</td>
			<td>BUF-3050-20X1L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">3.0 M Sodium Acetate Solution</td>
			<td>First BASE</td>
			<td>BUF-1151-1L-pH5.2&#160;&#160;</td>
			<td>Required for nucleic acid precipitation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40% Acrylamide/Bis Solution, 19:1</td>
			<td>Bio-Rad</td>
			<td>1610145</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ambion Buffer Kit</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>AM9010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ammonium Persulfate, Molecular Grade&#160;&#160;</td>
			<td>Promega</td>
			<td>V3131&#160;</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bromophenol Blue</td>
			<td>Sigma-Aldrich</td>
			<td>B0126-25G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chloroform</td>
			<td>Merck</td>
			<td>1.02445.1000</td>
			<td>RNA extraction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Single strand DNA ligase</td>
			<td>Epicentre</td>
			<td>CL9025K</td>
			<td>CircLigase II ssDNA Ligase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge tube filters</td>
			<td>Sigma-Aldrich</td>
			<td>CLS8160-96EA</td>
			<td>Costar Spin-X centrifuge tube filters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D5628-1G DIGITONIN CRYSTALLINE</td>
			<td>Sigma-Aldrich</td>
			<td>D5628-1G</td>
			<td>For cell treatment</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dark Reader Transilluminator&#160;</td>
			<td>Clare Chemical Research</td>
			<td>Dark Reader DR89X Transilluminator</td>
			<td>Blue light transilluminator</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Gel Loading Dye (6X)</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>R0611</td>
			<td>Required for agarose gel electroporation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dulbecco&#39;s Modified Eagle Medium</td>
			<td>Pan BioTech</td>
			<td>P04-03500</td>
			<td>For Hela cell culture</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin magnetic beads</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>65002</td>
			<td>Dynabeads MyOne Streptavidin C1&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Magnetic stand for 15ml tubes</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>12301D</td>
			<td>DynaMag-15</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Magnetic stand for 15ml tubes</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>&#160;12321D</td>
			<td>DynaMag-2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ThermoMixer</td>
			<td>Eppendorf</td>
			<td>5382 000.015</td>
			<td>Eppendorf ThermoMixer&#160;C</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotinylated psoralen</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>29986</td>
			<td>EZ-Link Psoralen-PEG3-Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">F8T5/BL&#160;</td>
			<td>Hitachi</td>
			<td>F8T5/BL&#160;</td>
			<td>365 nm UV bulb</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fetal Bovine Serum</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10270106&#160;&#160;</td>
			<td>Components of Hela medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Formamide</td>
			<td>Promega</td>
			<td>H5052&#160;&#160;</td>
			<td>Component in hybridization buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">G8T5</td>
			<td>Sankyo-Denki</td>
			<td>G8T5</td>
			<td>254 nm UV bulb</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glycogen&#160;</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10814010</td>
			<td>Required for nucleic acid precipitation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>Nanodrop 2000</td>
			<td>Spectrophotometer for nucleic acidquantification</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nuclease free water&#160;</td>
			<td>First BASE</td>
			<td>BUF-1180-500ml&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Penicillin Streptomycin&#160;&#160;</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>15140122&#160;&#160;</td>
			<td>Components of Hela medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">High-Fidelity DNA polymerase (2x)</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>F531L&#160;</td>
			<td>Phusion High-Fidelity PCR Master Mix with HF Buffer (2x)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers Set 1</td>
			<td>New England Biolabs</td>
			<td>E7335L&#160;</td>
			<td>PCR primers</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Gel Extraction Kit</td>
			<td>QIAgen</td>
			<td>28106</td>
			<td>QIAquick Gel Extraction Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fluorometric Quantification kit</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>Q32854</td>
			<td>Qubit dsDNA HS Assay Kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA clean up kit</td>
			<td>Qiagen</td>
			<td>74106</td>
			<td>RNeasy Mini Kit Silica-membrane column</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Rnase Inhibitor</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>AM2696</td>
			<td>SUPERase In</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Reverse transcriptase</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>18080400</td>
			<td>SuperScript III First-Strand Synthesis SuperMix</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nucleic Acid Gel Stain</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>S11494</td>
			<td>SYBR GOLD NUCLEIC ACID 500 UL</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 Polynucleotide Kinase</td>
			<td>New England Biolabs</td>
			<td>M0201L</td>
			<td>End repair enzyme</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 RNA Ligase 1</td>
			<td>New England Biolabs</td>
			<td>M0204L</td>
			<td>Enzyme for proximity ligation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 RNA Ligase 2, truncated KQ</td>
			<td>New England Biolabs</td>
			<td>M0373L</td>
			<td>Enzyme for adaptor ligation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Temed</td>
			<td>Bio-Rad</td>
			<td>1610801</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Guanidinium thiocyanate-phenol-chloroform</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>15596018</td>
			<td>TRIzol&#174; Reagent for RNA extraction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Urea</td>
			<td>First BASE</td>
			<td>BIO-2070-5kg&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UV crosslinker</td>
			<td>Stratagene</td>
			<td>400072</td>
			<td>UV Stratalinker 1800</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UV Transilluminator</td>
			<td>UVP</td>
			<td>95-0417-01</td>
			<td>For visualizing of bands</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Xylene Cyanol FF</td>
			<td>Sigma-Aldrich</td>
			<td>X4126-10G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA cleanup it</td>
			<td>Zymo Research&#160;</td>
			<td>D4004</td>
			<td>Zymo DNA concentrator-5&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">List of software required</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastQC software</td>
			<td>0.11.4</td>
			<td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SeqPrep software</td>
			<td>1.0.7</td>
			<td>https://github.com/jstjohn/SeqPrep</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BWA software</td>
			<td>0.7.12</td>
			<td>http://bio-bwa.sourceforge.net/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SAMTOOLS software</td>
			<td>1.2.1</td>
			<td>http://www.htslib.org/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PULLSEQ software</td>
			<td>1.0.2</td>
			<td>https://github.com/bcthomas/pullseq</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">STAR software</td>
			<td>2.5.0c</td>
			<td>https://github.com/alexdobin/STAR</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">rem_dups.py PYTHON script</td>
			<td>PYTHON 2.7.11</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">find_chimeras.py PYTHON script</td>
			<td>PYTHON 2.7.11</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pickJunctionReads.awk AWK script</td>
			<td>AWK GNU 4.1.2</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Buffer composition</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Elution buffer:&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.3 M sodium acetate</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lysis Buffer:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50 mM Tris-Cl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Always add Superase-in fresh before use except when washing beads</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K Buffer&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM NaCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 mM TrisCl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hybridization Buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">750 mM NaCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50 mM Tris-Cl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% formamide (store in the dark at 4 &#176;C)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Always add Superase-in fresh before use</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2x SSC Wash Buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2x NaCl and Sodium citrate (SSC) (diluted from 20x SSC Invitrogen stock)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2X RNA fragmentation buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">18mM MgCl2</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">450mM KCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">300mM Tris-CL pH 8.3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2x RNA loading Dye:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">95% Formamide</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.02% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.02% bromophenol blue</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.01% Xylene Cyanol</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1mM EDTA&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3&#39; RNA adapter sequence</td>
			<td>5rAppCTGTAGGCACCATCAAT/3ddC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RT primer sequence</td>
			<td>AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

mapping rna-rna interactions globally using biotinylated psoralen

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA interactions such as microRNA-mRNA interactions have been shown to regulate gene expression, the full extent to which RNA interactions occur in the cell is still unknown. Previous methods to study RNA interactions have primarily focused on subsets of RNAs that are interacting with a particular protein or RNA species. Here, we detail a method named Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH) that allows genome-wide capture of RNA interactions in vivo in an unbiased manner. SPLASH utilizes in vivo crosslinking, proximity ligation, and high throughput sequencing to identify intramolecular and intermolecular RNA base-pairing partners globally. SPLASH can be applied to different organisms including bacteria, yeast and human cells, as well as diverse cellular conditions to facilitate the understanding of the dynamics of RNA organization under diverse cellular contexts. The entire experimental SPLASH protocol takes about 5 days to complete and the computational workflow takes about 7 days to complete.

Figure 1 depicts the schematic of the SPLASH workflow. Upon the addition of biotinylated psoralen in the presence of 0.01% digitonin, and UV crosslinking, total RNA is extracted from the cells and a dot blot is performed to ensure that crosslinking of biotinylated to the RNA has happened efficiently (Figure 2). We use biotinylated 20 base oligos as positive controls to titrate the amount of biotinylated psoralen to be added to th...

Watch this Scientific Journal Video about Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen at JoVE.com

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Here, we detail the method of Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH), which enables genome-wide mapping of intramolecular and intermolecular RNA-RNA interactions in vivo. SPLASH can be applied to study RNA interactomes of organisms including yeast, bacteria and humans.

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

The overall goal of this video is to describe the method for sequencing of psoralen crosslinked ligated and selected hybrids or SPLASH in which pair-wise in vivo RNA-RNA interactions are mapped in a genome-wide manner. This technique is a simple, high throughput method for mapping the RNA interaction in vivo. This method can help answer key questions in the RNA genomics field such as how do different regions along a single strand of RNA or between different strands of RNAs interact with each other.Though this method can provide insights into yeast and human cells, it can also be applied to studies in other modern organisms including bacteria and membrane in cells. We first had the idea for this method when we wanted to come up with a way to map interaction molecular. Note that the following procedure contains several stopping points.At these times, the experiment can be paused briefly or indefinitely. Details can be found in the accompanying text. Begin this procedure by washing HeLa cells twice with five milliliters of PBS.Place the dish vertically for one minute to completely drain any excess PBS. Next, add one milliliter of PBS containing 200 micromolar biotinylated psoralen and 0.01%digitonin which increases cell permeability. Take care to add the solution evenly over the surface of the cells.Incubate at 37 degrees Celsius for five minutes. Following the incubation, remove the lid of the dish and place it on ice inside a UV Crosslinker three centimeters from the UV bulb. Irradiate with 365 nanometer UV for 20 minutes.After 20 minutes, remove the dish from the Crosslinker and then isolate fragment and precipitate the RNA from HeLa cells according to the instructions in the accompanying document. Load denatured ladder and RNA samples onto a 8.6 centimeter square 6%TBE-urea gel. Size fractionate by electrophoresis at 180 volts for 40 minutes.Stain the gel in 10 milliliters of TBE buffer containing a 1:10, 000 dilution of nucleic acid gel stain for five minutes in the dark. While the gel is staining, use a 24 gauge needle to puncture a clean 0.6 milliliter microfuge tube at the bottom. Place it in a two milliliter microfuge tube.Using a transilluminator, visualize the bands on the post-stained gel and cut a gel slice corresponding to 90 to 110 nucleotides. Transfer the gel slice into the punctured 0.6 milliliter microfuge tube in the two milliliter microfuge tube. Size selection allows us to set the minimal length for the chimeric fragments and to distinguish between ligated products and non-ligated products later on.Centrifuge the gel slices at 12, 000 times g at room temperature for two minutes to shred the gel slice and collect it in the two milliliter microfuge tube. After the spin, discard the empty 0.6 milliliter microfuge tube. To the shredded gel slice, add 700 microliters of elution buffer.Incubate at four degrees Celsius overnight with constant rotation to allow diffusion of the samples into the buffer. Transfer the gel slices and the elution buffer to a centrifuge tube filter and centrifuge at 20, 000 times g for 20 minutes. After the spin, the gel slices will be trapped at the top compartment of the filter which may be discarded.Precipitate and quantify the RNA as described in the accompanying document. Flash freeze and store the RNA at minus 80 degrees Celsius in liquid nitrogen until it is used. To enrich RNA crosslinking regions, begin by adding 100 microliters of lysis buffer containing RNase inhibitor to wash streptavidin-coated magnetic beads in a microfuge tube.To a 15 milliliter conical centrifuge tube, add two milliliters of freshly-prepared hybridization buffer, one milliliter of supplemented lysis buffer, 1.5 micrograms of size fractionated RNA, and 100 microliters of resuspended beads. Vortex the tube gently. Incubate at 37 degrees Celsius for 30 minutes with end-to-end rotation.Following the incubation, wash the beads five times with pre-warmed wash buffer. At the end of the fifth wash, place the microfuge tube containing the beads on the magnet stand for one minute and then remove the wash buffer. Add one milliliter of cold T4 polynucleotide kinase buffer to the washed beads.Incubate the beads for five minutes at four degrees Celsius with end-to-end rotation. Place the microfuge tube containing the beads on the magnetic strip. After one minute, gently remove the buffer.Repeat this step for a total of two washes and remove the buffer after the last wash. Next, follow the instructions in the accompanying document to convert the five prime and three prime ends to be ligation compatible and perform the proximity ligation. After a wash, add 100 microliters of RNA PK buffer to the beads and resuspend them by pipetting up and down.Heat the samples at 95 degrees Celsius for 10 minutes on a heat block. Next, chill the sample on ice for one minute. Add 500 microliters of guanidinium thiocyanate-phenol-chloroform to the sample.Mix by vortexing vigorously for 10 seconds. Incubate the mixture at room temperature for 10 minutes. Following the incubation, use a kit to precipitate, clean up, and recover the RNA, ensure that even small RNAs are retained.Elute the RNA in 100 microliters of nuclease-free water. Transfer 100 microliters of the eluted samples into a well of a 24-well plate on nice. Keeping the sample on ice, UV irradiate it at 254 nanometers for five minutes.Transfer the reverse crosslinked sample to a clean microfuge tube. Add 10 microliters of sodium acetate, one microliter of glycogen, and 300 microliters of 100%ethanol. Precipitate the RNA at minus 20 degrees Celsius for at least one hour.To recover the RNA, centrifuge the precipitated RNA at 20, 000 times g for 30 minutes at four degrees Celsius. After the spin, remove the supernatant and add one milliliter of 70%cold ethanol to wash the RNA pellet. Centrifuge the washed pellet at 20, 000 times g for 15 minutes at four degrees Celsius.Remove the wash buffer and add 4.25 microliters of nuclease-free water to resuspend the RNA. Transfer the RNA to a 0.2 milliliter PCR tube. Finally, reverse transcribe, circularize, and amplify the cDNA according to the instructions in the accompanying document.This schematic depicts the SPLASH workflow. Upon the addition of biotinylated psoralen in the presence of 0.01%digitonin and UV crosslinking, total RNA is extracted from the cells and a dot blot is performed to ensure that crosslinking was efficient. Biotinylated 20 base oligos are then used as positive controls to titrate the amount of biotinylated psoralen to be added to the cells such that approximately one in every 150 bases are crosslinked.Small-scale PCR amplification is then performed using increasing numbers of PCR cycles to determine the minium number of cycles required for deep sequencing. In an efficient library preparation process, a cDNA sequencing library can be amplified from a 1.5 microgram of size selected RNA input in less than 15 cycles of PCR amplification. The library is then sequenced using two 150 base pair reads on a high throughout sequencing machine.The sequencing reads are then processed according to the computational pipeline. The end result is a list of filtered chimeric interactions that includes both intramolecular and intermolecular RNA-RNA interactions in the transcriptome. While attempting this procedure, it is important to remember to check for biotinylated psoralen incorporation when using SPLASH on new organisms.After its development, this technique paved the way for researchers in the field of RNA biology to explore RNA interactions in diverse organisms. After watching this video, you should have a good understanding of how to make a sequencing library that captures pair-wise RNA interactions globally in the cell.

Research

JoVE Journal

Genetics

Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia ...

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Single Molecule Analysis of Laser Localized Psoralen Adducts

The DNA Damage Response (DDR) has been extensively characterized in studies of double strand breaks (DSBs) induced by laser micro beam irradiation in live ...

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

Genome-wide mapping of protein-DNA interactions is critical for understanding gene regulation, chromatin remodeling, and other chromatin-resident ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions ...

Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

Transcription Start Site Mapping Using Super-low Input Carrier-CAGE

Cap analysis of gene expression (CAGE) is a method used for single-nucleotide resolution detection of RNA polymerase II transcription start sites (TSSs). ...

In Vitro Biochemical Assays using Biotin Labels to Study Protein-Nucleic Acid Interactions

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental ...