מחקר זה נתמך על ידי מועצת המחקר השבדי (www.vr.se) מעניקה קשת (2014-6466 וקרן שבדי למחקר אסטרטגי (www.stratresearch.se) כדי ארק (ICA14-0060). האוניברסיטה הטכנולוגית של צ'אלמרס מסופקים תמיכה כספית MKME במהלך עבודה זו. התורמים שחיים היה אין תפקיד תכנון המחקר, איסוף נתונים, ניתוח, ההחלטה לפרסם או אופן ההכנה של כתב היד.

פרוטוקול זה המותווה באיור 1, כולל את ניתוקה של gDNA, מערכת העיכול עם אנזימי הגבלה ביכולת quantitate מספר ribonucleotides, טיפול עם אלקליות כדי hydrolyze הקשרים phosphodiester של ribonucleotides שולבו gDNA, זרחון קצות 5´-אוו, ssDNA מצדו של מתאמי, סינתזת גדיל השני ו- PCR הגברה לפני רצף.
 1. מתאמי, אינדקס תחל <ol><li>תחל אינדקס להשיג ARC49, ARC140 oligonucleotides, ARC76/77, מתאם, ARC78-ARC107 (ראה טבלה 1). 
	הערה: Oligonucleotides צריך להיות HPLC מטוהרים. ARC76/77 מסודרות כמו דופלקס.</li>
	<li>להכין 100 מיקרומטר פתרונות מניות של כל oligonucleotide במאגר טריס-EDTA (TE) (ראה את הטבלה של חומרים) ולאחסן ב-20 מעלות צלזיוס</li>
	<li>להכין 10 מיקרומטר פתרונות של ARC67/77 ו- 2 מיקרומטר פתרונות של תחל ARC49 ואינדקס על ידי דילול במאגר • תנאי (EB; ראה הטבלה של חומרים). חנות ב-20 ° C</li>
</ol> 2. וצמיחה של הקציר של תאים <ol><li>הלה לגדל תאים ב- 70 מ ל Dulbecco &#39; s השתנה נשר בינוני (DMEM) בתוספת 10% סרום שור עוברית בבקבוקון טווה 250 מ ל- 37 מעלות צלזיוס.</li>
	<li>לספור את מספר התאים, לאסוף 5 x 10 תאים 6 בשפופרת 50-mL, צנטריפוגה למשך 5 דקות ב- 200 גרם x, ולמחוק את תגובת שיקוע.</li>
	<li>לרחוץ את התאים עם 20 מ ל 1 x PBS, צנטריפוגה למשך 5 דקות ב- 200 גרם x, ולמחוק את תגובת שיקוע.</li>
	<li>להקפיא את כדורי ב-20 ° C או להמשיך בטהרה דנ א.</li>
</ol> 3. כימות והערכה טיהור DNA <ol><li>לטהר gDNA באמצעות פנול-כלורופורם החילוץ, כפי שמתואר להלן.
	<ol><li>Resuspend התאים במאגר פירוק 2 מ"ל (ראה את הטבלה של חומרים) דגירה למשך 30 דקות ב 42 מעלות צלזיוס על בלוק חימום. 
		התראה: פירוק המאגר מכיל מרכיבים מסוכנים. פתרון מרחביות. הוא מרגיז, Proteinase K sensitizing, מעצבן, רעיל. ללבוש כפפות וביגוד מגן.</li>
		<li>פיצול הדגימה שני צינורות 2 מ"ל ולהוסיף 1 נפח (V) של אלכוהול פנול-כלורופורם-isoamyl (25:24:1). 
		זהירות: אלכוהול פנול-כלורופורם-isoamyl היא רעילה, מוטגן, מאכל ו מסוכנים לסביבות הימית. להשתמש בברדס fume ללבוש כפפות וביגוד מגן, למחוק ב פסולת פנול מיוחד-כלורופורם.</li>
		<li>מיקס על ידי היפוך עבור 30-60 s צנטריפוגה למשך 5 דקות ב- 15,000 x g בטמפרטורת החדר. 
		הערה: האם לא מערבולת DNA כדי למנוע הצגת מעברי סטרנד אקראיים, אשר לעוות את התוצאות.</li>
		<li>להעביר את השלב העליון, מימית צינור 2 מ"ל ולהוסיף 1 V של אלכוהול פנול-כלורופורם-isoamyl (25:24:1).</li>
		<li>מיקס על ידי היפוך צנטריפוגה למשך 5 דקות ב 15,000 g x-4 מעלות צלזיוס</li>
		<li>להעביר את השלב העליון, מימית mL 2 חדש צינור ולהוסיף 20 µL NaCl (5 מ') ו- 1 V של אלכוהול איזופרופיל קר. 
		התראה: אלכוהול איזופרופיל הוא דליק, מעצבן, רעיל. אחסן אותו בארון מאוורר ללבוש כפפות וביגוד מגן, להרחיקו להבות.</li>
		<li>מיקס על ידי היפוך דגירה במשך לפחות שעה ב-20 מעלות צלזיוס</li>
		<li>צנטריפוגה כעשרים דקות בכ-15,000 x g, 4 ° C ותגובת שיקוע להשליך.</li>
		צנטריפוגה כעשרים דקות ב g x 15,000 ב 4 ° C <li>צנפה DNA לשטוף עם 200 µL קר 70% אתנול, ולמחוק תגובת שיקוע. 
		התראה: 70% אתנול הוא דליק, מעצבן. לשמור על הפתרון עובד ב-20 ° C, חנות אחרת ארון מאוורר, ללבוש בגדים מגן, כפפות, ולשמור אותה הרחק להבות.</li>
		<li>יבש בגדר DNA בטמפרטורת החדר במשך 20-25 דק...</li>
		<li>כדורי DNA להמיס 100 טה µL מאגר, בריכה הדגימות צינור אחד.</li>
	</ol></li> <li>Quantitate DNA ריכוז באמצעות תגובה כימית כימות dsDNA על פי יצרן &#39; s מפרטים (ראה את הטבלה של חומרים). 
	הערה: השתמש ריאגנט כימות dsDNA, כי spectrophotometric כימות ה-DNA עשויה להיות מושפעת פנול שיורית.</li>
	<li>מאגר DNA ב-20 ° C או להמשיך בטיפול HincII.</li>
</ol> 4. הידרוליזה אלקליין וטיפול HincII <ol><li>µg 1 תקציר של ה-DNA בתגובה תערובת המכילה 5 µL 10 x מאגר 3.1, µL 1 (10 U) HincII, ו- H נטולת נוקלאז 2 O לאמצעי הסופי של 50 µL- 
	הערה: כדי להשיג תנאים אופטימליים מצדו, סינתזת גדיל השני ו- PCR-הגברה, ייתכן צורך להגדיל את כמות ה-DNA קלט אם הוא צפוי כי ה-DNA מכיל מספר נמוך מאוד של ribonucleotides. באופן דומה, ייתכן צורך להקטין DNA קלט אם מספר ribonucleotides הוא גבוה מאוד.</li>
	<li>תקופת דגירה של 30 דקות ב- 37 מעלות צלזיוס.</li>
	<li>HincII לטהר שטופלו DNA חרוזים פאראמגנטיים. 
	הערה: לשמור את הצינור המכסים פתח ב השלבים הבאים כדי לא להפריע כדורי על-ידי פתיחת הצינורות.
	<ol><li>להוסיף V 1.8 של פאראמגנטיים חרוזים לכל אחד לטעום, לערבב היטב על ידי pipetting, ו דגירה בטמפרטורת החדר במשך 10 דקות</li>
		<li>השתמש מתלה מגנטי כדי הצניפה החרוזים במשך 5 דקות, ואז להסיר ולמחוק את תגובת שיקוע.</li>
		<li>לשטוף את גלולה עם 150 µL של 70% אתנול (טמפרטורת החדר) במשך כ- 30 s ולאחר מכן הסר ו להשליך תגובת שיקוע.</li>
		<li>שטיפת בגדר עם 200 µL של 70% אתנול (טמפרטורת החדר) כ 30 s ואז להסיר ולמחוק את תגובת שיקוע. 
		הערה: ניתן להסיר שאריות אתנול עם פיפטה 10 µL. טיפות יכול להיות טוו למטה בקצרה מראש.</li>
		<li>יבש הדגימות בטמפרטורת החדר במשך כ- 15-20 דקות 
		הערה: הזמן המדויק תלוי בכמויות החרוזים ואת צורת בגדר, לכן כדורי יש לבדוק חזותית.</li>
		<li>להסיר צינורות מהמדף מגנטי, elute צנפה ב 45 µL EB, מיקס על ידי pipetting בזהירות.</li>
		<li>דגירה במשך 5 דקות ואז הצניפה החרוזים על מתלה מגנטי ולהשתמש µL 45 של DNA מטוהרים בשלב 4.4.</li>
	</ol></li> <li>µL 5 להוסיף קו (3 מ') או אשלגן כלורי (3 מ') ל- DNA יצירת הנפח הכולל של 50 µL- 
	התראה: פתרון ז קו 3 הוא מאכל. ללבוש כפפות וביגוד מגן.</li>
	<li>Incubate עבור 2 h ב 55 ° C בהכלאה תנור ואחריו 5 דקות על קרח 
	הערה: מומלץ לבצע את הטיפול KOH תנור במקום בלוק חימום כדי לשמור על חימום אחיד של הצינור וכדי למנוע עיבוי על המכסה.</li>
	<li>לזרז את הדנ א על-ידי הוספת 10 µL סודיום אצטט (3 מ', pH = 5.2) ו- 125 µL קר 100% אתנול. דגירה על קרח במשך 5 דק 
	התראה: 100% אתנול הוא דליק, מעצבן. לאחסן בארון מאוורר, ללבוש כפפות וביגוד מגן ולשמור מן הלהבות.</li>
	<li>גלולה gDNA על ידי צריך שתוציאו ב 21,000 x g, 4 מעלות צלזיוס למשך 5 דקות ולמחוק את תגובת שיקוע.</li>
	<li>DNA שטיפת גלולה עם 250 µL קר 70% צנטריפוגה ב 21,000 x g, 4 מעלות צלזיוס למשך 5 דקות, EtOH, ולמחוק את תגובת שיקוע. 
	הערה: כדי להסיר טיפות, הצינור יכול להיות טוו למטה בקצרה שוב ואת תגובת שיקוע ניתן להסיר עם פיפטה 10 µl.</li>
	<li>תן בגדר יבש צינור פתוח למשך כ- 5-10 דקות עד כל נוזל גלוי התאדו.</li>
	<li>DNA תן התמוססות גלולה ב 20 µL EB במשך 30 דקות בטמפרטורת החדר.</li>
</ol> 5. 5´ סוף זרחון <ol><li>להכין את תערובת התגובה עבור כל דגימה מראש אסיריםisting של 2.5 µL 10 x polynucleotide קינאז התגובה מאגר T4, µL (10 U) 1 3´-פוספטאז-חיסור T4 polynucleotide קינאז, µL 2.5 ATP (10 מ מ)-</li>
	<li>µL 19 העברה של כל ה-DNA לטעום לתוך צינור 200 µL ו denature למשך 3 דקות ב 85 מעלות צלזיוס ב התרמו-הצנטרפוגה.</li>
	<li>הדי מגניב דוגמאות על קרח ולהוסיף 6 µL של התגובה לערבב כל דגימה.</li>
	<li>התגובה Incubate מתערבב ב 37 מעלות צלזיוס במשך 30 דקות ולהפסיק התגובה על ידי המקננת הדגימות ב 65 מעלות צלזיוס במשך 20 דק.</li>
	<li>לטהר דנ א כמו שמתואר 4.3, באמצעות 1.8 V של חרוזים פאראמגנטיים אבל elute ב- 14 µL EB-</li>
</ol> 6. ssDNA מצדו <ol><li>להכין את תערובת התגובה עבור כל דגימה מראש בהיקף של 0.5 µL ATP (2 מ מ), µL 5 10 x T4 RNA ליגאז התגובה מאגר, 5 µL CoCl 3 (NH 3) 6 (10 מ מ), 0.5 µL ARC140 (100 מיקרומטר), ו- 25 µL 50% 8000 פג. לערבב היטב על ידי pipetting. 
	התראה: CoCl 3 (NH 3) 6 הוא מסרטנים, sensitizing ומסוכנים לסביבה הימית. ללבוש כפפות וביגוד מגן.</li>
	<li>µL 13 העברה של DNA מטוהרים צעד 5.5 צינור 200 µL ו denature למשך 3 דקות ב 85 מעלות צלזיוס ב התרמו-הצנטרפוגה.</li>
	<li>מגניב הדנ א על קרח, להוסיף µL 36 של תערובת התגובה אחד לטעום, לערבב על ידי pipetting ואת ספין למטה בקצרה.</li>
	<li>µL להוסיף 1 (10 U) של T4 רנ א ליגאז על כל תגובה, לערבב על ידי pipetting, ספין למטה בקצרה.</li>
	<li>דגירה בדגימות בטמפרטורת החדר ב הלילה האפל.</li>
</ol> 7. השני-strand סינתזה <ol><li>Purify מאתרים DNA כמתואר ב- 4.3, אבל להשתמש 0.8 V של חרוזים פאראמגנטיים, גלולה החרוזים 10 דקות ו elute ב- 20 µL EB- 
	הערה: בשל צמיגות גבוה יותר של המיקס התגובה מצדו, הצעד הראשון pelleting מוארך.</li>
	µL <li>20 העברה של דנ א כדי צינור PCR 200 µL. חזור על השלב טיהור באמצעות 0.8 V של חרוזים פאראמגנטיים בעקבות היצרן &#39; s מפרטים ו elute ב- 14 µL EB-</li>
	<li>להכין את תערובת התגובה עבור כל דגימה מראש בהיקף של 2 µL 10 x T7 DNA פולימראז התגובה מאגר, 2 µL ARC76/77 (2 מיקרומטר), µL 2 dNTPs (2 מ מ), ואת µL 0.8 BSA (1 מ"ג/מ"ל).</li>
	<li>µL 12.8 להעביר מטוהרים דנ א כדי צינור 200 µL, denature למשך 3 דקות ב 85 מעלות צלזיוס ב התרמו-הצנטרפוגה.</li>
	<li>מגניב הדנ א על קרח ולהוסיף 6.8 µL של התגובה מיקס אחד לטעום, לערבב על ידי pipetting, ספין למטה לזמן קצר ולאחר תקופת דגירה של 5 דקות בטמפרטורת החדר.</li>
	<li>להוסיף 0.4 µL (4 U) T7 DNA פולימראז כל תגובה, תקופת דגירה של 5 דקות בטמפרטורת החדר.</li>
	<li>לטהר דנ א כמו שמתואר 4.3, באמצעות 0.8 V של חרוזים פאראמגנטיים ו elute ב- 11 µL EB-</li>
</ol> 8. PCR-הגברה, כימות ספריית <ol><li>להכין תערובת התגובה עבור כל דגימה ב 200 חדש µL צינור המורכב מראש 7.5 µL ARC49 (2 מיקרומטר), µL 7.5 מדד פריימר (2 מיקרומטר, ייחודי עבור כל דגימה) ולאחר 25 µL 2 x התחלה לוהטת מוכן לערבב.</li>
	<li>להוסיף 10 µL של דנ א כדי כל תגובה. להגביר את הספרייה באמצעות התנאים הבאים: denature ב 95 מעלות צלזיוס במשך 45 s, ואחריו 18 מחזורים של 98 ° C 15 s, 65 ° C ל 30 s, 72 ° C ל 30 s, המסתיימים התארכות הסופי ב-72 מעלות לדוגמאות להחזיק 2 דק ב 4 ° ג לאחר הגברה.</li>
	<li>לטהר ספריות כמתואר ב- 4.3, באמצעות 0.8 V פאראמגנטיים חרוזים, ו elute במאגר טה µL 20-</li>
	<li>Quantitate ספריות באמצעות ריאגנט כימות dsDNA, על פי היצרן &#39; s מפרטים (ראה את הטבלה של חומרים).</li>
	<li>לאחסן דגימות ב-20 ° C או להמשיך עם ניתוח הספרייה.</li>
</ol> 9. ספריית ניתוח ו- Pooling <ol><li>לקבוע את האיכות של כל ספריה, להעריך את הגודל הממוצע פרגמנט באמצעות מערכת אלקטרופורזה דיגיטלי. 
	הערה: גודל המקטע הממוצע הוא מוערך על ידי הערכת היכן האזור מתחת העקומה של electropherogram זה חצוי, התעלמות פסגות של סמנים. התוצאות נציג של ספריית מתאימים פרופילים לאחר טיפול קו או אשלגן כלורי מקבלים איור 2 א.</li>
	<li>לחשב את הריכוז (ננומטר) של הספריות כמו: 
	/(p*650) (c/10 3)] * 10 9 איפה c הוא הריכוז של הספרייה ב- ng/µL ו- p מייצג גודל המקטע הממוצע ב- bp, כמו 9.1 מוערך ב-</li>
	<li>בריכה שווה טוחנת כמויות של ספריות עד 24 מוגבר עם צבעי יסוד שונים אינדקס רצף. טה מאגר להוסיף נפח סופי של 25 µL וריכוז של 10 ננומטר. 
	הערה: בהתאם למספר ספריות כדי להיות איחדו, כמות ה-DNA של כל ספריה מותאמת. אם אותרו הדימרים פריימר בשלב 9.1 בתור ברורים לשיא של-130 bp, הנפח הסופי של הבריכה הספרייה יכולים לחרוג 25 µL, כי הצעד טיהור הוא חזר כמתואר ב- 4.3, באמצעות 0.8 V פאראמגנטיים חרוזים, הדנ א הוא eluted ב 25 µL TE buf fer.
	<ol><li>לקבוע ריכוז בריכת ספריה חדשה באמצעות תגובה כימית כימות dsDNA לפי יצרן &#39; s מפרטים לבין הממוצע לשיא הגודל כמתואר לעיל. להמשיך רצף וניתוח נתונים (סעיפים 10 ו-11).</li>
	</ol></li></ol> 10. קביעת רצף <ol><li>לבצע 75-בסיס לזווג-קצה הרצף על ספריות במאגר 12.</li></ol>
 11. ניתוח נתונים <ol><li>חיתוך כל קורא כדי להסיר את המתאם רצפים, סינון עבור איכות ולקרוא אורך. 
	הערה: ניתן לבצע זאת באמצעות cutadapt 1.2.1 20 באמצעות הפקודה ' cutadapt -f fastq - התאמה-קריאה-תווים כלליים - שקט -מ' 15 - q 10, אבנר כהן &#60; קובץ &#62;', איפה אבנר כהן מוחלף הרצף מתאם בפועל, &#60; קובץ &#62; הוא החליף את שם הקובץ fastq.</li>
	<li>להסיר חברים הקריאות שנזרקו בשלב הקודם באמצעות קבצי script מותאמים אישית.</li>
	<li>ליישר 1 חבר של הנותרים זוגות לאינדקס המכיל את רצף כל oligonucleotides בהכנת ספריה (למשל, באמצעות עניבת הפרפר 0.12.8 21 ושורת הפקודה אפשרויות - m1-v2). למחוק את כל זוגות עם יישורים מוצלח.</li>
	<li>ליישר זוגות הנותרים הגנום הפניה האורגניזם באמצעות עניבת הפרפר עם שורת הפקודה אפשרויות - v2 -X הטוב 10000....</li>
	<li>מפה קורא את טווח בין מולקולה מיטוכונדריאלי ההתחלה והסוף על ידי יישור 1 חבר של כל זוגות unaligned (באמצעות עניבת הפרפר עם שורת הפקודה אפשרויות - v2).</li>
	<li>לקבוע הרוזן 5´-מסתיימת כל סוף יחיד ומשויכים במערכים. משמרת את המיקום של אלה עד לבסיס אחד במעלה הנהר עד למיקום שבו היו ribonucleotides הידרוליזה.</li>
	<li>יצא נתונים מהקובץ עניבת הפרפר תבנית לתבנית קובץ bedgraph באמצעות קבצי script מותאמים אישית עבור ויזואליזציה במשותף הגנום דפדפנים. לנרמל את הקריאות על גדיל אחד כדי קריאות לכל מיליון.</li>
	<li>באמצעות את המיקום ואת ספירות מהקובץ bedgraph, להפנות את רצף הגנום של האורגניזם כדי לקבוע את זהותו של incorporated ribonucleotides. 
	הערה: עבור גנום מיטוכונדריאלי האדם קורא מתוך האזורים 16,200-300 ו 5,747-5,847 על גדיל אחד לא להיות כלולים מאז אזורים אלה מכילים הרבה 5´-הפנויות שאינן קשורות ההתאגדות ribonucleotide על ידי ה-DNA פולימראז γ-</li>
	<li>לחלק את סכום קוראת, לא כולל קריאות באתרים HincII 11, עם המספר הממוצע של קורא לכל אתר HincII כדי לקבל את מספר ribonucleotides לכל הפסקה לחוט אחד, (קרי מספר ribonucleotides לכל מולקולה מיטוכונדריאלי).</li>
</ol>

<ol>
	<li>Traut, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+Concentrations+of+Purines+and+Pyrimidines.">Physiological Concentrations of Purines and Pyrimidines.</a> Mol. Cell. Biochem. 140, 1-22 (1994).</li><li>McElhinny, S. A. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abundant+ribonucleotide+incorporation+into+DNA+by+yeast+replicative+polymerases.">Abundant ribonucleotide incorporation into DNA by yeast replicative polymerases.</a> Proc. Natl. Acad. Sci. USA. 107, 4949-4954 (2010).</li><li>Williams, J. S., Lujan, S. A., Kunkel, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Processing+ribonucleotides+incorporated+during+eukaryotic+DNA+replication.">Processing ribonucleotides incorporated during eukaryotic DNA replication.</a> Nat. Rev. Mol. Cell Biol. 17, 350-363 (2016).</li><li>Clausen, A. R., Zhang, S., Burgers, P. M., Lee, M. Y., Kunkel, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribonucleotide+incorporation,+proofreading+and+bypass+by+human+DNA+polymerase+delta.">Ribonucleotide incorporation, proofreading and bypass by human DNA polymerase delta.</a> DNA Repair. 12, 121-127 (2013).</li><li>Potenski, C. J., Klein, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+the+misincorporation+of+ribonucleotides+into+genomic+DNA+can+be+both+harmful+and+helpful+to+cells.">How the misincorporation of ribonucleotides into genomic DNA can be both harmful and helpful to cells.</a> Nucleic Acids Res. 42, 10226 (2014).</li><li>Vengrova, S., Dalgaard, J. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase-sensitive+DNA+modification(s)+initiates+S.+pombe+mating-type+switching.">RNase-sensitive DNA modification(s) initiates S. pombe mating-type switching.</a> Gene. Dev. 18, 794-804 (2004).</li><li>Lujan, S. A., Williams, J. S., Clausen, A. R., Clark, A. B., Kunkel, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribonucleotides+Are+Signals+for+Mismatch+Repair+of+Leading-Strand+Replication+Errors.">Ribonucleotides Are Signals for Mismatch Repair of Leading-Strand Replication Errors.</a> Mol. Cell. 50, 437-443 (2013).</li><li>Ghodgaonkar, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribonucleotides+Misincorporated+into+DNA+Act+as+Strand-Discrimination+Signals+in+Eukaryotic+Mismatch+Repair.">Ribonucleotides Misincorporated into DNA Act as Strand-Discrimination Signals in Eukaryotic Mismatch Repair.</a> Mol. Cell. 50, 323-332 (2013).</li><li>DeRose, E. F., Perera, L., Murray, M. S., Kunkel, T. A., London, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+Structure+of+the+Dickerson+DNA+Dodecamer+Containing+a+Single+Ribonucleotide.">Solution Structure of the Dickerson DNA Dodecamer Containing a Single Ribonucleotide.</a> Biochemistry. 51, 2407-2416 (2012).</li><li>Li, Y. F., Breaker, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+RNA+degradation+by+specific+base+catalysis+of+transesterification+involving+the+2+'-hydroxyl+group.">Kinetics of RNA degradation by specific base catalysis of transesterification involving the 2 '-hydroxyl group.</a> J. Am. Chem. Soc. 121, 5364-5372 (1999).</li><li>McElhinny, S. A. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+instability+due+to+ribonucleotide+incorporation+into+DNA.">Genome instability due to ribonucleotide incorporation into DNA.</a> Nat. Chem. Biol. 6, 774-781 (2010).</li><li>Berglund, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+pools+dictate+the+identity+and+frequency+of+ribonucleotide+incorporation+in+mitochondrial+DNA.">Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA.</a> Plos Genet. 13, (2017).</li><li>Brown, J. A., Suo, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unlocking+the+Sugar+"Steric+Gate"+of+DNA+Polymerases.">Unlocking the Sugar "Steric Gate" of DNA Polymerases.</a> Biochemistry. 50, 1135-1142 (2011).</li><li>Sparks, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+H2-Initiated+Ribonucleotide+Excision+Repair.">RNase H2-Initiated Ribonucleotide Excision Repair.</a> Mol. Cell. 47, 980-986 (2012).</li><li>Miyabe, I., Kunkel, T. A., Carr, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Major+Roles+of+DNA+Polymerases+Epsilon+and+Delta+at+the+Eukaryotic+Replication+Fork+Are+Evolutionarily+Conserved.">The Major Roles of DNA Polymerases Epsilon and Delta at the Eukaryotic Replication Fork Are Evolutionarily Conserved.</a> Plos Genet. 7, (2011).</li><li>Clausen, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+replication+enzymology+in+vivo+by+genome-wide+mapping+of+ribonucleotide+incorporation.">Tracking replication enzymology in vivo by genome-wide mapping of ribonucleotide incorporation.</a> Nat. Struct. Mol. Biol. 22, 185-191 (2015).</li><li>Koh, K. D., Balachander, S., Hesselberth, J. R., Storici, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribose-seq:+global+mapping+of+ribonucleotides+embedded+in+genomic+DNA.">Ribose-seq: global mapping of ribonucleotides embedded in genomic DNA.</a> Nat. Methods. 12, 251 (2015).</li><li>Keszthelyi, A., Daigaku, Y., Ptasinska, K., Miyabe, I., Carr, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+ribonucleotides+in+genomic+DNA+and+exploring+replication+dynamics+by+polymerase+usage+sequencing+(Pu-seq).">Mapping ribonucleotides in genomic DNA and exploring replication dynamics by polymerase usage sequencing (Pu-seq).</a> Nat. Protoc. 10, 1786-1801 (2015).</li><li>Ding, J., Taylor, M. S., Jackson, A. P., Reijns, M. A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+embedded+ribonucleotides+and+other+noncanonical+nucleotides+using+emRiboSeq+and+EndoSeq.">Genome-wide mapping of embedded ribonucleotides and other noncanonical nucleotides using emRiboSeq and EndoSeq.</a> Nat. Protoc. 10, 1433-1444 (2015).</li><li>Martin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutadapt+removes+adapter+sequences+from+high-throughput+sequencing+reads.">Cutadapt removes adapter sequences from high-throughput sequencing reads.</a> EMBnet.journal. 17, 10-12 (2011).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10, (2009).</li></ol>

המחברים מצהירים כי יש להם אינטרסים כלכליים אין מתחרים.

כאן אנו מציגים טכניקה כדי בו-זמנית למפות לכמת ribonucleotides gDNA, ואת mtDNA בפרט, על ידי המבוא פשוטה של ביקוע DNA באתרים ספציפיים רצף הגנום תוספת פרוטוקול ה-היידן-seq הוקמה. בעוד המחקר מתמקד mtDNA אנושי, השיטה היידן-seq פותחה במקור ב שמר האפייה, הממחישות התרגום של השיטה אורגניזמים אחרים,12,16.
עבור תוצאות אמינות המתקבל גישה זו, ראוי לציין כמה צעדים קריטיים: (א) מאז רצף מתאמי מאתרים ומפסיקים את כל הקצוות 5´ זמין, חשוב לעבוד עם ה-DNA מאוד ללא פגע. DNA הנשאים ספריות צריכה להיעשות רצוי מיד לאחר בידוד ה-DNA, או ה-DNA שניתן לאחסן ב-20 ° C. לא מומלץ לאחסן DNA במקרר במשך זמן רב או כדי שוב ושוב הקפאה והפשרה של זה. (ב) כדי ליצור ספריות מתאים בשיטה זו, חשוב לבצע את הטיפול קו ה-dna תנור דגירה, במקום בלוק חימום, שמבטיח חימום הומוגנית של כל דגימה, הידרוליזה כמותית. (ג) יתר על כן, חיוני כדי לקבוע את האיכות של ספריות לפני באגירת ורצף. הדנ א צריך ניתן לכמת, נותחה באמצעות מערכת אלקטרופורזה אוטומטית כדי להבטיח כמות מספקת של ספריית ה-DNA, לאשר בגדלים המתאימים פרגמנט ובדוק הדימרים פריימר.
עבור ניתוח נתונים משמעותיים, חשוב גם לציין כי ערך אינפורמטיבי של שיטה זו הוא תלוי הפקדים המתאימים כדי להעריך ספירות הרקע והנטיות רצף או strand. אנחנו באופן שגרתי להשיג יעילות מיפוי של אשלגן כלורי דוגמאות קרוב 70% כאשר עיכול רק עם רצף ספציפי endonuclease (איור 2B, לוחות שמאלה). בנוסף, חשוב לוודא כי הטיפול endonuclease אינו משפיע הכולל זיהוי של ribonucleotides incorporated על-ידי השוואת HincII ובא לא מטופל דגימות (איור 3B). בניסויים אלה, השתמשנו HincII להציג את האתר הספציפי חתכים, למרות אנזימי הגבלה אחרים באיכות גבוהה יכול לשמש גם.
הפרוטוקול יכול להיות מותאם ללמוד סוגים אחרים של נגעים DNA זה יעובד 5´-פוספט או 5´-הו מסתיים. הדיוק של התוצאות תלוי יחודיות של עיבוד ודורש הפקדים המתאימים (למשל, פראי סוג או לא מטופל) לצורך אימות. יתר על כן, כאשר התאמת שיטה זו יישומים אחרים או לשימוש עם אורגניזמים אחרים, שצריך לשקול כי שיטת ההתקנה הנוכחית שלה דורש כ 1 µg של ה-DNA אשר מעובד בספריה. מאז מספר הקצוות של תלויה מספר ribonucleotides מוטבע, אשר משתנה בהתאם האורגניזם או מוטציה, דגימות כולל מספר נמוך יותר של ribonucleotides ידרוש יותר קלט דנ א כדי להפיק מספר מספיק של מסתיים ב ספריה הבאים בנייה. באופן דומה, אם דגימות די אן איי יש מספר גבוה יותר של ribonucleotides, זה גם ידרוש באמצעות DNA פחות קלט כדי להשיג תנאים אופטימליים מצדו השני סינתזת גדיל, הגברה PCR. ראוי לציין כי בניית ספריה כפי שמתואר פרוטוקול זה נוצר גם נתונים המכסים את הגנום הגרעיני (כפי שהוא מוצג ביישום איור דו-ממדי), רק ניתוח הנתונים היה ממוקד mtDNA. זה ממחיש כי הגנום גדול עם תדרים נמוכים למדי ribonucleotide גם בשבי על ידי שיטה זו.
כאשר בוחנים שיטה זו, מגבלות מסוימות צריכים להילקח בחשבון: אף על פי שיטה זו, תיאורטית, יהיה החלים כמעט כל אורגניזם, גנום התייחסות מתאימה יש צורך היישור של קריאות. יתר על כן, התוצאות המתקבלות מן הפרוטוקול שלנו לייצג את הקריאות בין מספר גדול של תאים. אין אפשרות לזהות דפוסי התאגדות ribonucleotide ספציפיים של קבוצת משנה של תאים על-ידי גישה זו. אם ribonucleotides ממופים ב הגנום גדולות יותר עם מספר נמוך מאוד של ribonucleotides, זה יכול להיות מאתגר להפלות ribonucleotides של ניקס אקראי, הפקדים המתאימים לכן נחוצים.
השיטה נתאר כאן, מרחיב את הטכניקות הזמינות ויוו כגון היידן-Seq16, ריבוז-Seq17, Pu-Seq18או emRiboSeq19. גישות אלה מנצלים הרגישות של ribonucleotides מוטבע אלקליין או טיפול RNase H2, בהתאמה, העסקת הדור הבא רצפי לזהות ribonucleotides הגנום כולו, אשר מאפשר מיפוי שלהם, השוואת יחסי שיתוף. על ידי ביקוע רצף הדנ א במיוחד, כפי שתוארה לעיל, בנוסף הידרוליזה אלקליין ב ribonucleotides מוטבע, הקריאות עבור ribonucleotides יכול להיות מנורמל לאתרים האלה המחשוף, ומאפשר לא רק הזיהוי ומיפוי ribonucleotides, אבל גם שלהם כימות עבור כל מולקולה DNA. היישום של הטכניקה שלנו בהקשר של מחלות הקשורות שכפול ה-DNA, תיקון ה-DNA, ו- TLS יכול לספק הבנה עמוקה יותר של התפקיד של ribonucleotides ב בבסיס המנגנונים המולקולריים ותקינות הגנום באופן כללי.

בתא האיקריוטים, הריכוז של ribonucleotides (rNTPs) הוא גבוה בהרבה מאשר ריכוז deoxyribonucleotides (dNTPs)1. DNA polymerases להפלות ribonucleotides, אבל האפליה אינו מושלם, כתוצאה מכך, ribonucleotides במקום deoxyribonucleotides יכול לשלב הגנום במהלך שכפול ה-DNA. Ribonucleotides עשוי להיות נוקלאוטידים קאנונית הנפוץ ביותר שולבו את הגנום2. רוב ribonucleotides אלה יוסרו במהלך ההבשלה מקטע אוקאזקי RNase H2 ribonucleotide יזם כריתה תיקון (RER) או על ידי טופואיזומראז 1 (נבדקה הפניה3). Ribonucleotides שלא ניתן להסיר להישאר stably ועצוב ה DNA2,4 , עשוי להשפיע על זה בדרכים מזיקות וגם מועיל (נבדקה שנסקרה5). מלבד היכולת לשמש אותות חיובי, לדוגמה ב ההזדווגות סוג מחליף שמר הביקוע 6 , מסמן את הד המתהווה במהלך התאמה לתקן (MMR)7,8, ribonucleotides להשפיע מבנה9 ויציבות ב dna שמסביב עקב קבוצת 2´-הידרוקסיל שלהם ריבוז10, וכתוצאה מכך replicative מתח, הגנום יציבות11. השפע של ribonucleotides ב- DNA גנומי (gDNA) והרלוונטיות שלהם שכפול מנגנוני תיקון, כמו גם ההשלכות על יציבות הגנום, תן סיבה לחקור התרחשות מדויקת והתדירות שלהם באופן הגנום כולו.
RNase H2 פעילות לא נמצא בתוך המיטוכונדריה אנושי, ribonucleotides לכן יוסרו לא יעיל ב- DNA מיטוכונדריאלי (mtDNA). כמה מסלולים מעורבים את האספקה של נוקלאוטידים כדי המיטוכונדריה אנושי, כדי לבדוק הפרעות בבריכה נוקלאוטיד מיטוכונדריאלי לגרום מספר גבוה של ribonucleotides ב mtDNA אנושי, פיתחנו פרוטוקול כדי למפות quantitate אלה ribonucleotides ב mtDNA האנושי מבודד fibroblasts תאים הלה, התא החולה קווים12.
רוב במבחנה גישות (נבדקה שנסקרה13) כדי לקבוע סלקטיביות של ה-DNA polymerases נגד rNTPs מבוססים על ribonucleotide יחיד ההכנסה או פריימר ניסויים סיומת שבו מתחרים rNTPs הינם כלולים התגובה מערבבים, המאפשר זיהוי או כימות יחסי התאגדות ribonucleotide בתבניות הדי קצר. גישות כמותיים על רצפים קצרים עשוי לא לשקף dNTP בריכות rNTP בריכוזים הסלולר, ולכן מספקים תובנה פולימראז סלקטיביות אבל משמעות מוגבלת בנוגע הגנום כולו. הוכח, כי הכמות היחסית של ribonucleotides שולבו במהלך השכפול של תבנית ה-DNA ארוך יותר, כגון פלסמיד, ניתן לאבחן על ג'ל רצף באמצעות radiolabeled dNTPs ו hydrolyzing ה-DNA חצרו אלקליין14. יתר על כן, gDNA נותחה על שהכלים בדרום בעקבות הידרוליזה אלקליין, ומאפשר סטרנד חיטוט וספציפיים קביעת תעריפים מוחלטת של התאגדות ויווribonucleotide15. גישות אלה לאפשר השוואה יחסית של התאגדות תדירות אך לספק שום תובנות המיקום או זהות ribonucleotides incorporated. גישות עדכניות יותר כדי לנתח את התוכן ribonucleotide gDNA ויוו, כמו היידן-Seq16, ריבוז-Seq17, Pu-Seq18או emRiboSeq19, נצל את היתרון של ribonucleotides' מוטבע רגישות אלקליין או טיפול RNase H2, בהתאמה, ולהעסיק את הדור הבא רצפי לזהות ribonucleotides הגנום כולו. שיטות אלה אינם מספקים תובנה תדירות ההתאגדות המוחלט ribonucleotides שזוהו. באמצעות הוספת השלב של פצילות אנזימטי ספציפי רצף פרוטוקול היידן-seq, השיטה שנתאר כאן בנוחות מרחיב את המידע שנצבר בגישה רצף, ומאפשר מיפוי בו זמנית, כימות של מוטבע ribonucleotides12. שיטה זו ישימה לאורגניזם כמעט כל נתון כי ניתן להפיק תמציות DNA מאוד ללא פגע, גנום התייחסות מתאימה הינו זמין. השיטה יכול להיות מותאם quantitate, לקבוע את המיקום של כל הנגע יכול להיות מתעכל על ידי נוקלאז ולא יוצאת 5´-פוספט או קצה 5´-הו.
כדי למפות quantitate ribonucleotides ב- DNA גנומי, השיטה משלבת המחשוף מאת endonuclease ספציפי רצף ומסתיים הידרוליזה אלקליין יצירת 5´-פוספט אתרי שבו ממוקם רצף זיהוי ספציפיות עבור endonuclease ו 5´- הו מסתיים עמדות איפה שהו ribonucleotides. כיוון הפנויות שנוצר כתוצאה מכך מאתרים עם מתאמי וסודרו באמצעות הדור הבא רצפי, יש חשיבות להשתמש DNA ללא פגע מאוד ולמנוע פיצול אקראי במהלך הכנת מיצוי וספריית הדנ א. הערכת אלה קריאות מנורמל ל הקריאות באתרים המחשוף endonuclease מאפשר כימות סימולטני של מיפוי של ribonucleotides זיהה. 5´ חינם-קצוות זוהו בניסויים שליטה בו אלקליין הידרוליזה של ה-DNA מוחלף על ידי טיפול עם אשלגן כלורי. הנתונים שהושגו לספק תובנות ribonucleotide מיקום וכמות ומאפשר ניתוח לגבי תוכן ribonucleotide ותדירות ההתאגדות.

<table>
	<tbody>
		<tr>
			<td>10x T4 Polynucleotide Kinase Reaction Buffer</td>
			<td>New England Biolabs</td>
			<td>B0201S</td>
			<td></td>
		</tr>
		<tr>
			<td>10x T4 RNA Ligase Reaction Buffer</td>
			<td>New England Biolabs</td>
			<td>B0216L</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS</td>
			<td>Medicago</td>
			<td>09-9400-100</td>
			<td>dissolve 1 tablet in H2O to a final volume of 1 L</td>
		</tr>
		<tr>
			<td>2-Propanol</td>
			<td>Sigma-Aldrich</td>
			<td>33539-1L-GL-R</td>
			<td></td>
		</tr>
		<tr>
			<td>2100 Bioanalyzer</td>
			<td>Agilent Technologies</td>
			<td>G2940CA</td>
			<td></td>
		</tr>
		<tr>
			<td>50 mL Centrifuge Tube</td>
			<td>VWR</td>
			<td>525-0610</td>
			<td></td>
		</tr>
		<tr>
			<td>Adenosine 5&#39;-Triphosphate (ATP, 10 mM)</td>
			<td>New England Biolabs</td>
			<td>P0756S</td>
			<td>dilute with EB to 2 mM</td>
		</tr>
		<tr>
			<td>Agilent DNA 1000 Kit</td>
			<td>Agilent Technologies</td>
			<td>5067-1504</td>
			<td></td>
		</tr>
		<tr>
			<td>BSA, Molecular Biology Grade (20 mg/mL)</td>
			<td>New England Biolabs</td>
			<td>B9000S</td>
			<td>diltue with nuclease-free H2O to 1 mg/mL</td>
		</tr>
		<tr>
			<td>Buffer EB</td>
			<td>QIAGEN</td>
			<td>19086</td>
			<td>referred to as EB</td>
		</tr>
		<tr>
			<td>CleanPCR paramagnetic beads</td>
			<td>CleanNA</td>
			<td>CPCR-0050</td>
			<td></td>
		</tr>
		<tr>
			<td>Deoxynucleotide (dNTP) Solution Mix (10 mM each)</td>
			<td>New England Biolabs</td>
			<td>N0447L</td>
			<td>dilute with EB to 2 mM</td>
		</tr>
		<tr>
			<td>DMEM, high glucose, GlutaMAX Supplement</td>
			<td>Gibco</td>
			<td>61965026</td>
			<td></td>
		</tr>
		<tr>
			<td>DynaMag 96 Side</td>
			<td>Thermo Fisher</td>
			<td>12331D</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol 99.5% analytical grade</td>
			<td>Solveco</td>
			<td>1395</td>
			<td>dilute with milliQ water to 70%</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid solution (EDTA, 0.5 M)</td>
			<td>Sigma-Aldrich</td>
			<td>03690-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum</td>
			<td>Gibco</td>
			<td>10500056</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES buffer pH 8.0 (1 M) sterile BC</td>
			<td>AppliChem</td>
			<td>A6906,0125</td>
			<td></td>
		</tr>
		<tr>
			<td>Hexammine cobalt(III) chloride (CoCl3(NH3)6)</td>
			<td>Sigma-Aldrich</td>
			<td>H7891-5G</td>
			<td>dissolve in nuclease-free H2O for 10&#160;M solution, sterile filter. CAUTION: carcinogenic, sensitizing and hazardous to aquatic environment.</td>
		</tr>
		<tr>
			<td>HincII</td>
			<td>New England Biolabs</td>
			<td>R0103S</td>
			<td>supplied with NEBuffer 3.1</td>
		</tr>
		<tr>
			<td>Hybridiser HB-1D</td>
			<td>Techne</td>
			<td>FHB4DD</td>
			<td></td>
		</tr>
		<tr>
			<td>KAPA HiFi HotStart ReadyMix (2X)</td>
			<td>Kapa Biosystems</td>
			<td>KK2602</td>
			<td></td>
		</tr>
		<tr>
			<td>Lysis buffer</td>
			<td></td>
			<td></td>
			<td>50 mM EDTA, 20 mM HEPES, NaCl 75 mM, Proteinase K (200 &#181;g/mL), 1% SDS</td>
		</tr>
		<tr>
			<td>Micro tube 1.5 mL</td>
			<td>Sarstedt</td>
			<td>72.690.001</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge 5424R</td>
			<td>Eppendorf</td>
			<td>5404000014</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge MiniStar silverline</td>
			<td>VWR</td>
			<td>521-2844</td>
			<td></td>
		</tr>
		<tr>
			<td>Multiply&#160;&#181;StripPro 0.2 mL tube</td>
			<td>Sarstedt</td>
			<td>72.991.992</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>Ambion</td>
			<td>AM9937</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol &#8211; chloroform &#8211; isoamyl alcohol (25:24:1)</td>
			<td>Sigma-Aldrich</td>
			<td>77617-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium chloride (KCl)</td>
			<td>VWR</td>
			<td>26764.232</td>
			<td>dissolve in nuclease-free H2O for 3&#160;M solution, sterile filter</td>
		</tr>
		<tr>
			<td>Potassium hydroxide (KOH)</td>
			<td>VWR</td>
			<td>26668.296</td>
			<td>dissolve in nuclease-free H2O for 3&#160;M solution, sterile filter</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Ambion</td>
			<td>AM2546</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 3.0 Fluorometer</td>
			<td>Invitrogen</td>
			<td>Q33216</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit Assay Tubes</td>
			<td>Invitrogen</td>
			<td>Q32856</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit dsDNA BR Assay Kit</td>
			<td>Invitrogen</td>
			<td>Q32850</td>
			<td>CAUTION: Contains flammable and toxic components</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS Assay Kit</td>
			<td>Invitrogen</td>
			<td>Q32851</td>
			<td>CAUTION: Contains flammable and toxic components</td>
		</tr>
		<tr>
			<td>Refrigerated Centrifuge 4K15</td>
			<td>Sigma Laboratory Centrifuges</td>
			<td>No. 10740</td>
			<td></td>
		</tr>
		<tr>
			<td>SDS Solution, 10%</td>
			<td>Invitrogen</td>
			<td>15553-035</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium acetate buffer solution, pH 5.2, 3 M (NaAc)</td>
			<td>Sigma-Aldrich</td>
			<td>S7899</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride (NaCl)</td>
			<td>VWR</td>
			<td>27810.295</td>
			<td>dissolve in nuclease-free H2O for 5&#160;M solution, sterile filter</td>
		</tr>
		<tr>
			<td>T100 Thermal Cycler</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 Polynucleotide Kinase (3&#39; phosphatase minus)</td>
			<td>New England Biolabs</td>
			<td>M0236L</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 RNA Ligase 1 (ssRNA Ligase)</td>
			<td>New England Biolabs</td>
			<td>M0204L</td>
			<td>supplied with PEG 8000 (50%)</td>
		</tr>
		<tr>
			<td>T7 DNA Polymerase (unmodified)</td>
			<td>New England Biolabs</td>
			<td>M0274S</td>
			<td>supplied with 10x T7 DNA Polymerase Reaction Buffer</td>
		</tr>
		<tr>
			<td>TE Buffer</td>
			<td>Invitrogen</td>
			<td>12090015</td>
			<td></td>
		</tr>
		<tr>
			<td>ThermoMixer F2.0</td>
			<td>Eppendorf</td>
			<td>5387000013</td>
			<td></td>
		</tr>
	</tbody>
</table>

simultaneous mapping and quantitation of ribonucleotides in human mitochondrial dna

גישות הוקמה כדי להעריך את מספר ribonucleotides נוכח גנום מוגבלות כימות של ribonucleotides incorporated שימוש קצר שברי DNA סינטטיים או פלסמידים כתבניות והשערות ואז התוצאות לכל הגנום. לחלופין, מספר ribonucleotides נוכח גנום עשוי להיות מוערך באמצעות ג'ל אלקליין או שהכלים הדרומי. גישות ויוו עדכנית יותר מעסיקים הדור הבא רצפי ומאפשר מיפוי הגנום כולו של ribonucleotides, מספק את המיקום ואת זהותו של ribonucleotides מוטבע. עם זאת, הם אינם מאפשרים כימות של מספר ribonucleotides אשר משולבים לתוך הגנום. כאן נתאר כיצד למפות בו זמנית, quantitate מספר ribonucleotides אשר משולבים האנושי מיטוכונדריאלי DNA ויוו מאת הדור הבא רצפי. עלינו להשתמש DNA מאוד ללא פגע, להציג רצף ספציפי גדיל כפול מעברי מאת לעכל את זה עם endonuclease, לאחר מכן hydrolyzing ribonucleotides incorporated עם אלקלי. הקצוות שנוצר מאתרים עם מתאמי, הקצוות האלה הם וסודרו על מכונת רצף הדור הבא. ניתן לחשב את המספר המוחלט של ribonucleotides כמספר הקריאות באתר זיהוי לפי המספר הממוצע של קריאות באתר זיהוי עבור endonuclease ספציפית הרצף. פרוטוקול זה עשוי גם להיות מנוצל כדי למפות quantitate ניקס חינם ב- DNA ומאפשר התאקלמות למיפוי נגעים אחרים-DNA זה ניתן לעבד 5´-הו מסתיים או מסתיים 5´-פוספט. יתר על כן, שיטה זו ניתן ליישם כל אורגניזם, בהתחשב בכך גנום התייחסות מתאימה זמין. פרוטוקול זה ולכן מספק כלי חשוב ללמוד שכפול ה-DNA, עיבוד 5´-end, נזק לדנ א ו- DNA לתקן.

הממחישות את המתודולוגיה תוארו לעיל, נציג נתונים נוצרו ניתוח דנ א מיטוכונדריאלי האנושי של הלה תאים12. איור 2B מציג קריאות מסוכמים בכלל HincII אתרים כבדים (HS), אור גדיל (LS) של האדם mtDNA לאחר הטיפול אשלגן כלורי (לוחות שמאלה). בסביבות 70% של כל שזוהו 5´-מסתיים בתרגום כדי לחתוך-האתרים, הממחיש את יעילות גבוהה של עיכול HincII. בטיפול ספריות עם קו כדי hydrolyze את ה-DNA-ribonucleotides מוטבע מקטין את מספר הקריאות של אתרי HincII כ-40% (איור 2B, לוחות נכון). זה צפוי מאז מספר רב של קצוות 5´ נוצרות באתרים התאגדות ribonucleotide, מעידה על איכות הספרייה מספקת. איור 2C ממחיש את לוקליזציה ואת התדירות של 5´ שאינו נגמר (ירוק) לאחר טיפול אשלגן כלורי וקורא שנוצר מאת היידן-seq (מגנטה) לאחר טיפול קו, גילוי 5´ חינם-מסתיים והן הקצוות שנוצרו בשעה ribonucleotides על-ידי הידרוליזה אלקליין. 5´ חינם-קצוות, ribonucleotides ההתאמה לשפות אחרות כדי HS של האדם mtDNA מוצגים בחלונית השמאלית, אלה ההתאמה לשפות אחרות האם מוצגים בחלונית הימנית. המספרים היחסית הקריאות raw ribonucleotides (איור דו-ממדי, החלונית העליונה) או HincII אתרים (החלונית התחתונה) ב- HS ו- LS של mtDNA מציגים, בהתאמה, כיסוי חזק יותר 14-fold או 31-fold של הוא יחסי HS, בעוד דעה קדומה דומה נצפתה לא עבור DNA גרעיני. הנטיה סטרנד הזו עשויה להיות מוסברת על ידי ההבדל מובהק בהרכב בסיס שני הגדילים, ממחיש את החשיבות של נירמול כדי קריאות באתרים HincII.
נרמול לקריאה סופרת כדי HincII נותן מדד כמותי של מספר ribonucleotides לכל גנום מיטוכונדריאלי (איור 3 א). כמופיע ב- 3B איור, קריאות אחרי קו טיפול עבור כל ribonucleotide מנורמל להרכב רצף של גדיל אחד הראה יחס שונה מ- 1, המציין בהתפלגות שאינן אקראיות של קריאות רומז ribonucleotide נפרדים דפוס ואיכות גבוהה הספרייה. יחס זה אינו מושפע על ידי עיכול הקודם עם HincII, אימות המחשוף ירידה לפרטים של האנזים. נרמול הקורא את המקומות של ribonucleotides מוטבע לאלה באתרים פצילות HincII, כמו גם התוכן של נוקלאוטיד של הגנום, יוצרת מידה כמותית של כמה ribonucleotide כל משולבים לכל 1000 בסיסים משלימים ( איור 3C).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56551/56551fig1.jpg"> 
איור 1: סכימטי של ה-DNA עיבוד והכנת ספריית. (1) הדנ א כל הוא ביקע מאת HincII עבור נרמול ב כימות עוקבות של ribonucleotides, יצירת קצוות קהים באתרים HincII (ראש חץ שחור). (2) ה-DNA הוא טיפל עם קו כדי hydrolyze באתרים ribonucleotide, המוביל 2´, 3´-מחזורית פוספט (מחומש אדום)-3´-מסתיים ומסתיים 5´-אוו. (3) 5´-הו הקצוות הן phosphorylated על ידי T4 Polynucleotide קינאז 3´-פוספטאז-מינוס. (4) נגמר 5´ כל נושא קבוצת פוספט מאתרים כדי oligonucleotide ARC140 על ידי T4 RNA ליגאז. (5) יותר סטרנד השני הוא מסונתז באמצעות T7 DNA פולימראז ואת oligonucleotides ARC76-77 המכיל רצף אקראי של6 N. (6) הספרייה מוגבר על ידי אמינות גבוהה DNA פולימראז באמצעות ARC49 ו לאחד ARC78 כדי ARC107 תחל אינדקס המכיל ברקוד ייחודי עבור ריבוב. (7) 5´-הקצוות ממוקמות על ידי רצף לזווג-end. <a href="//ecsource.jove.com/files/ftp_upload/56551/56551fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56551/56551fig2.jpg"> 
איור 2: שיטת אימות. (א) electropherograms נציג שנוצר באמצעות מערכת אלקטרופורזה אוטומטית כדי לקבוע את האיכות שנוצר ספריות שטופלו אות קו או אשלגן-(B) Summarized HincII אתרים כבדים (HS), אור סטרנד (LS) mtDNA אנושי לאחר אשלגן כלורי (לוחות שמאלה) או טיפול קו (לוחות נכון). Circos (ג) איור של 5´ הפנויות (ירוק), היידן-Seq (הפנויות 5´ ו- ribonucleotides, מגנטה) HS (החלונית הימנית), mtDNA האנושי LS (לוח נכון). הפסגות הן מנורמל לכל קורא מיליון, הפסגה מרבי מותאם המספר המרבי של פעולות הקריאה של הספרייה היידן-seq. (ד) Summarized גלם קורא ribonucleotides (לוח העליון), HincII אתרים (החלונית התחתונה) כבד (H), אור (L) גדיל mtDNA אנושי (Mito.) או הפוכה (RV) או (FW) קדמי, תוך הגרעין (Nuc). ה-DNA. B, C ו- D הם ממאמרו של הפניה12. קווי שגיאה מייצגים שגיאת התקן של הממוצע. <a href="//ecsource.jove.com/files/ftp_upload/56551/56551fig2large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56551/56551fig3.jpg"> 
איור 3: תוצאות נציג. (א) היחסית מספר ribonucleotides מנורמל כדי קריאות באתרים HincII עבור ספריות KOH שטופלו על כבד (H) או סטרנד אור (L). (B) היחס בין הזהות ribonucleotide להרכב הגנום mtDNA עבור קו (קו) ובא HincII ביקע עם קו מטופלים (HincII + קו) ספריות כבד (H) או (L) אור, לשריד mtDNA. (ג) Ribonucleotide תדירות מנורמל ל 1000 בסיסים משלימים עבור HincII ו KOH מטופלים ספריות כבד (H) או אור (L) לשריד mtDNA. דמויות מותאמים הפניה12. קווי שגיאה מייצגים שגיאת התקן של הממוצע. <a href="//ecsource.jove.com/files/ftp_upload/56551/56551fig3large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>שם</td>
			<td colspan="4">רצף</td>
		</tr>
		<tr>
			<td>ARC49</td>
			<td colspan="4">AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC76</td>
			<td colspan="4">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNN * N * N</td>
		</tr>
		<tr>
			<td>ARC77</td>
			<td colspan="4">AGATCGGAAGAGCACACGTCTGAACTCCAGTC * A * C</td>
		</tr>
		<tr>
			<td>ARC78</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC84</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC85</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC86</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC87</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGA</td></tr></tbody></table>TCT
		
		<tr>
			<td>ARC88</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC89</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC90</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC91</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC93</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC94</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC95</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC96</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTGTTGACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC97</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATACGGAACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC98</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTCTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC99</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCGGGACGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC100</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATGTGCGGACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC101</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCGTTTCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC102</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATAAGGCCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC103</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTCCGAAACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC104</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTACGTACGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC105</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATATCCACTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC106</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATATATCAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC107</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATAAAGGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC140</td>
			<td colspan="4">/ 5AmMC6/ACACTCTTTCCCTACACGACGCTCTTCCGATCT</td>
		</tr>
	

טבלה 1: Oligonucleotides. נקובים oligonucleotides המשמש היידן-תת סעיף. הפנים מודגש מציין יצירת אינדקס. * מציין כי איגרת חוב של phosphorothioate. ARC140 מכיל קבוצת אמינו 5´ במקום קבוצת 5´-הו, בשילוב עם מקשר C6. שינוי זה מפחית היווצרות ARC140 concatemers במהלך מצדו.

Watch this Scientific Journal Video about Simultaneous Mapping and Quantitation of Ribonucleotides in Human Mitochondrial DNA at JoVE.com

Simultaneous Mapping and Quantitation of Ribonucleotides in Human Mitochondrial DNA

מיפוי בו זמנית, כימות של Ribonucleotides ב- DNA מיטוכונדריאלי אנושי

כאן נתאר שיטה לבצע בו זמנית quantitate ואת ribonucleotides מפה הגנום כולו ב- DNA מאוד שלם ברזולוציה נוקלאוטיד יחיד, המשלב המחשוף אנזימטי של דנ א גנומי עם הידרוליזה אלקליין שלה סוף-5´ הבאים . רצף.

Established approaches to estimate the number of ribonucleotides present in a genome are limited to the quantitation of incorporated ribonucleotides using ...

simultaneous-mapping-quantitation-ribonucleotides-human-mitochondrial

Research

JoVE Journal

Biology

9.4K Views.  University of Gothenburg. כאן נתאר שיטה לבצע בו זמנית quantitate ואת ribonucleotides מפה הגנום כולו ב- DNA מאוד שלם ברזולוציה נוקלאוטיד יחיד, המשלב המחשוף אנזימטי של דנ א גנומי עם הידרוליזה אלקליין שלה סוף-5´ הבאים . רצף.

Video: Simultaneous Mapping and Quantitation of Ribonucleotides in Human Mitochondrial DNA

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and programmed cell death. Mitochondria produce ATP, regulate the cytoplasmic redox state and Ca2+ balance, catabolize fatty acids, synthesize heme, nucleotides, steroid hormones, amino acids, and help assemble iron-sulfur clusters in proteins. Mitochondria also have an essential role in heat production. Mutations of the mitochondrial genome cause several types of human disorder. The accumulation of mtDNA mutations correlates with aging and is suspected to have an important role in the development of cancer. Due to their vitally important role in all cell types, the function of mitochondria must also be critical for stem cells. Key advances have been made in our understanding of stem cell viability, proliferation, and differentiation capacity. But the functional activity of stem cells, in particular their energy status, was not yet been studied in detail. Almost nothing is known about the mitochondrial properties of human embryonic stem cells (hESCs) and their differentiated precursor progeny. One way to understand and evaluate the role of mitochondria in hESC function and developmental potential is to directly measure the activity of mitochondrial respiratory complexes. Here, we describe high resolution clear native gel electrophoresis and subsequent in gel activity visualization as a method for analyzing the five respiratory chain complexes of hESCs.

In this video, we will show you how the mitochondrial respiratory chain complexes of human embryonic stem cells can be analyzed using in gel activity assays.

גשוש עבור פעילות קומפלקס מיטוכונדריאלי של בתאי גזע עובריים אנושיים

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation 

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

הגורל מיפוי בתאי גזע עובריים אנושיים על ידי גיבוש תפלצת

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three ...

Quantitation of &gamma;H2AX Foci in Tissue Samples

DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) processes or by exogenous factors, particularly ionizing radiation and radiomimetic compounds. Phosphorylation of the H2A histone variant, H2AX, at the serine-139 residue, in the highly conserved C-terminal SQEY motif, forming &gamma;H2AX, is an early response to DNA double-strand breaks1. This phosphorylation event is mediated by the phosphatidyl-inosito 3-kinase (PI3K) family of proteins, ataxia telangiectasia mutated (ATM), DNA-protein kinase catalytic subunit and ATM and RAD3-related (ATR)2. Overall, DSB induction results in the formation of discrete nuclear &gamma;H2AX foci which can be easily detected and quantitated by immunofluorescence microscopy2. Given the unique specificity and sensitivity of this marker, analysis of &gamma;H2AX foci has led to a wide range of applications in biomedical research, particularly in radiation biology and nuclear medicine. The quantitation of &gamma;H2AX foci has been most widely investigated in cell culture systems in the context of ionizing radiation-induced DSBs. Apart from cellular radiosensitivity, immunofluorescence based assays have also been used to evaluate the efficacy of radiation-modifying compounds. In addition, &gamma;H2AX has been used as a molecular marker to examine the efficacy of various DSB-inducing compounds and is recently being heralded as important marker of ageing and disease, particularly cancer3. Further, immunofluorescence-based methods have been adapted to suit detection and quantitation of &gamma;H2AX foci ex vivo and in vivo4,5. Here, we demonstrate a typical immunofluorescence method for detection and quantitation of &gamma;H2AX foci in mouse tissues.

Quantitation of &#947;H2AX Foci in Tissue Samples

Quantitation of DNA double-strand breaks on the basis of &gamma;H2AX foci has become an invaluable tool, particularly in radiation biology, for the evaluation of tissue radiosensitivity and effects of radiation modifying compounds. Here we demonstrate the use of an immunofluorescence assay for quantitation of &gamma;H2AX foci in tissue samples.

Quantitation של γH2AX מוקדים של דגימות רקמה

DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

לכידה סלקטיבית של 5-hydroxymethylcytosine מהדנ&quot;א הגנומי

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Isolation of Human Atrial Myocytes for Simultaneous Measurements of Ca2+ Transients and Membrane Currents

The study of electrophysiological properties of cardiac ion channels with the patch-clamp technique and the exploration of cardiac cellular Ca2+ handling abnormalities requires isolated cardiomyocytes. In addition, the possibility to investigate myocytes from patients using these techniques is an invaluable requirement to elucidate the molecular basis of cardiac diseases such as atrial fibrillation (AF).1 Here we describe a method for isolation of human atrial myocytes which are suitable for both patch-clamp studies and simultaneous measurements of intracellular Ca2+ concentrations. First, right atrial appendages obtained from patients undergoing open heart surgery are chopped into small tissue chunks ("chunk method") and washed in Ca2+-free solution. Then the tissue chunks are digested in collagenase and protease containing solutions with 20 &mu;M Ca2+. Thereafter, the isolated myocytes are harvested by filtration and centrifugation of the tissue suspension. Finally, the Ca2+ concentration in the cell storage solution is adjusted stepwise to 0.2 mM. We briefly discuss the meaning of Ca2+ and Ca2+ buffering during the isolation process and also provide representative recordings of action potentials and membrane currents, both together with simultaneous Ca2+ transient measurements, performed in these isolated myocytes.

Isolation of Human Atrial Myocytes for Simultaneous Measurements of Ca2+ Transients and Membrane Currents

We describe the isolation of human atrial myocytes which can be used for intracellular Ca2+ measurements in combination with electrophysiological patch-clamp studies.

בידוד של myocytes פרוזדורי אדם למדידות בו זמנית של Ca<sup&gt; 2 +</sup&gt; ארעי וזרמים הממברנה

The study of  electrophysiological properties of cardiac ion channels with the patch-clamp  technique and the exploration of cardiac cellular Ca2+ ...

Quantitation of Endothelial Cell Adhesiveness In Vitro

One of the cardinal processes of inflammation is the infiltration of immune cells from the lumen of the blood vessel to the surrounding tissue. This occurs when endothelial cells, which line blood vessels, become adhesive to circulating immune cells such as monocytes. In vitro measurement of this adhesiveness has until now been done by quantifying the total number of monocytes that adhere to an endothelial layer either as a direct count or by indirect measurement of the fluorescence of adherent monocytes. While such measurements do indicate the average adhesiveness of the endothelial cell population, they are confounded by a number of factors, such as cell number, and do not reveal the proportion of endothelial cells that are actually adhesive. Here we describe and demonstrate a method which allows the enumeration of adhesive cells within a tested population of endothelial monolayer. Endothelial cells are grown on glass coverslips and following desired treatment are challenged with monocytes (that may be fluorescently labeled). After incubation, a rinsing procedure, involving multiple rounds of immersion and draining, the cells are fixed. Adhesive endothelial cells, which are surrounded by monocytes are readily identified and enumerated, giving an adhesion index that reveals the actual proportion of endothelial cells within the population that are adhesive.

Quantitation of Endothelial Cell Adhesiveness In Vitro

We report an in vitro method that allows the quantitation of the actual number of adhesive cells within an endothelial cell monolayer.

כימות של דביקות תא האנדותל<em&gt; במבחנה</em

One of the cardinal processes of inflammation is the infiltration of immune cells from the lumen of the blood vessel to the surrounding tissue. This ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to dose-limiting toxicity and many adverse side effects. Targeting the genome with sequence-specific small molecules may enable molecules with increased therapeutic index and fewer off-target effects. N-methylpyrrole/N-methylimidazole polyamides are molecules that can be rationally designed to target specific DNA sequences with exquisite precision. And unlike most natural transcription factors, polyamides can bind to methylated and chromatinized DNA without a loss in affinity. The sequence specificity of polyamides has been extensively studied in vitro with cognate site identification (CSI) and with traditional biochemical and biophysical approaches, but the study of polyamide binding to genomic targets in cells remains elusive. Here we report a method, the crosslinking of small molecules to isolate chromatin (COSMIC), that identifies polyamide binding sites across the genome. COSMIC is similar to chromatin immunoprecipitation (ChIP), but differs in two important ways: (1) a photocrosslinker is employed to enable selective, temporally-controlled capture of polyamide binding events, and (2) the biotin affinity handle is used to purify polyamide&#8211;DNA conjugates under semi-denaturing conditions to decrease DNA that is non-covalently bound. COSMIC is a general strategy that can be used to reveal the genome-wide binding events of polyamides and other genome-targeting chemotherapeutic agents.

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Identifying the direct targets of genome-targeting molecules remains a major challenge. To understand how DNA-binding molecules engage the genome, we developed a method that relies on crosslinking of small molecules to isolate chromatin (COSMIC).

מיפוי הגנום של תרופות-DNA בתאי אינטראקציות עם COSMIC (Crosslinking של מולקולות קטנות לבודד הכרומטין)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID-seq: מיפוי הגנום של אינטראקציות החלבון-DNA על ידי תפוקה גבוהה רצף של קטעי DNA-מפוגל אדנין

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...

Quantitation of Protein Expression and Co-localization Using Multiplexed Immuno-histochemical Staining and Multispectral Imaging

Immunohistochemistry is a commonly used clinical and research lab detection technique for investigating protein expression and localization within tissues. Many semi-quantitative systems have been developed for scoring expression using immunohistochemistry, but inherent subjectivity limits reproducibility and accuracy of results. Furthermore, the investigation of spatially overlapping biomarkers such as nuclear transcription factors is difficult with current immunohistochemistry techniques. We have developed and optimized a system for simultaneous investigation of multiple proteins using high throughput methods of multiplexed immunohistochemistry and multispectral imaging. Multiplexed immunohistochemistry is performed by sequential application of primary antibodies with secondary antibodies conjugated to horseradish peroxidase or alkaline phosphatase. Different chromogens are used to detect each protein of interest. Stained slides are loaded into an automated slide scanner and a protocol is created for automated image acquisition. A spectral library is created by staining a set of slides with a single chromogen on each. A subset of representative stained images are imported into multispectral imaging software and an algorithm for distinguishing tissue type is created by defining tissue compartments on images. Subcellular compartments are segmented by using hematoxylin counterstain and adjusting the intrinsic algorithm. Thresholding is applied to determine positivity and protein co-localization. The final algorithm is then applied to the entire set of tissues. Resulting data allows the user to evaluate protein expression based on tissue type (ex. epithelia vs. stroma) and subcellular compartment (nucleus vs. cytoplasm vs. plasma membrane). Co-localization analysis allows for investigation of double-positive, double-negative, and single-positive cell types. Combining multispectral imaging with multiplexed immunohistochemistry and automated image acquisition is an objective, high-throughput method for investigation of biomarkers within tissues.

Immunohistochemistry is a powerful lab technique for evaluating protein localization and expression within tissues. Current semi-automated methods for quantitation introduce subjectivity and often create irreproducible results. Herein, we describe methods for multiplexed immunohistochemistry and objective quantitation of protein expression and co-localization using multispectral imaging.

כימות של ביטוי חלבון ו Co-לוקליזציה שימוש חיסונית-histochemical Multiplexed מכתים והדמיה Multispectral

Immunohistochemistry is a commonly used clinical and research lab detection technique for investigating protein expression and localization within ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

הגברה, רצף הדור הבא, ואת הגנום מיפוי ה- DNA של אתרי אינטגרצית retroviral

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

מיפוי בו זמנית, כימות של Ribonucleotides ב- DNA מיטוכונדריאלי אנושי

Summary

Explore More Videos

Chapters in this video