이 연구는 스웨덴 연구 위원회에 의해 지원 되었다 (www.vr.se) 호를 부여 (2014-6466와 전략 연구 (www.stratresearch.se) 호 (ICA14-0060)에 대 한 스웨덴 재단. Chalmers 기술 대학이이 작품 MKME에 재정 지원 제공. Funders 연구 설계, 데이터 수집 및 분석, 결정 게시 또는 원고의 준비에 전혀 역할을 했다.

이 그림 1에서 설명 하는 프로토콜과 gDNA, ribonucleotides, 치료는에 알칼리 수를 quantitate 수 금지 효소로 소화의 절연 ribonucleotides의 phosphodiester 채권 gDNA, 무료 5´ 오 끝의 인 산화, 어댑터, 두 번째 가닥 합성 및 PCR 증폭 시퀀싱 전에 ssDNA 결 찰에 통합.
 1. 어댑터 및 인덱스 뇌관 <ol><li>얻을 ARC49 ARC140 oligonucleotides, ARC76/77, 어댑터, ARC78-ARC107 인덱스 뇌관 (표 1 참조). 
	참고: Oligonucleotides HPLC 정화 해야 합니다. ARC76/77 이중으로 정렬 됩니다.</li>
	<li>트리 스-EDTA (테) 버퍼에 각 oligonucleotide의 준비 100 µ M 재고 솔루션 (재료의 표 참조)-20에서 저장 ° c.</li>
	<li>차입 버퍼 (EB, 참조 테이블의 재료)에 희석 하 여 ARC67/77의 10 µ M 솔루션 및 ARC49 및 인덱스 뇌관의 2 µ M 솔루션을 준비 합니다. -20 ° c.에 게</li>
</ol> 2. 성장과 수확의 셀 <ol><li>성장 HeLa 세포 70 ml Dulbecco &#39; s 37에 250 mL 스피너 플라스 크에서 10% 태아 둔감 한 혈 청으로 보완 수정이 글 매체 (DMEM) ° c.</li>
	<li>셀의 수를 계산 하 고 50 mL 튜브, 200 x g에 5 분 동안 원심 분리기에서에서 5 x 10 6 세포를 수집 하 고는 상쾌한 삭제.</li>
	<li>1 x 20 mL PBS, 200 x g에 5 분 동안 원심 분리기를 가진 세포를 세척 하 고는 상쾌한 삭제.</li>
	<li>동결-20 ° C에서 펠 릿 또는 DNA 정화 계속.</li>
</ol> 3. DNA 정제 및 정량 <ol><li>gDNA 아래에 설명 된 페 놀-클로 프롬 적 출을 사용 하 여 정화.
	<ol><li>Resuspend 2 mL 세포의 용 해 버퍼의 셀 (테이블의 자료 참조)와 열 블록에 42 ° C에서 30 분 동안 품 어. 
		주의: 세포의 용 해 버퍼 유해 구성 요소를 포함합니다. SDS 솔루션은 자극, 가수분해 K은 sensitizing, 자극, 및 독성. 보호 옷과 장갑을 착용.</li>
		<li>두 2 mL 튜브에 샘플을 분할 하 고 페 놀-클로 프롬-isoamyl 알콜 (25:24:1)의 1 볼륨 (V) 추가. 
		주의: 페 놀-클로 프롬-isoamyl 알콜은 독성, 변이 원 성, 부식성, 및 수생 환경에 유해. 증기 두건에서 사용 하 고, 보호 옷과 장갑을, 착용 하 고 특별 한 페 놀-클로 프롬 폐기물에서 폐기.</li>
		실 온에서 30-60 s에 대 한 반전 및 15000 x 5 분 원심 분리기 <li>믹스 g. 
		참고: 결과 왜곡할 것 이다 무작위 스트랜드 나누기 소개 피하려고 하지 소용돌이 DNA 할.</li>
		<li>새 2 mL 튜브 위, 수성 단계 전송 및 페 놀-클로 프롬-isoamyl 알콜 (25:24:1)의 V 1.</li>
		<li>반전 및 원심 분리기에서 15000 x g 4에 5 분 동안 혼합 ° c.</li>
		<li>전송 20 µ L을 추가 하 고 새로운 2 mL 튜브에 위, 수성 단계 NaCl (5m)과 차가운 소 프로 파 놀의 V 1. 
		주의: 소 프로 파 놀, 자극, 가연성 및 독성입니다. 통풍이 캐비닛에 그것을 저장, 보호 옷과 장갑, 착용 하 고 화 염에서 멀리 유지.</li>
		<li>반전 하 여 혼합 및 적어도 1 h-20에 대 한 품 어 ° c.</li>
		<li>G, 4 ° C와 폐기 상쾌한 x 15, 000에서 20 분 동안 원심 분리기.</li>
		<li>세척 DNA 펠 릿 200 µ L 찬 70% 에탄올, 4 ° C에서 15000 x g에서 20 분 동안 원심 및 상쾌한 삭제. 
		주의: 70% 에탄올은 가연성 및 자극. 통풍이 캐비닛, 보호 옷을 입고, 장갑,-20 ° C, 그렇지 않으면 저장소에서 작업 솔루션을 유지 하 고 화 염에서 멀리 유지.</li>
		<li>DNA 펠 릿 20-25 분에 대 한 실 온에서 건조</li>
		<li>100 µ L 테 펠 릿 분해 DNA 버퍼링 하 고 1 개의 관에 샘플 수영장.</li>
	</ol></li> <li>Quantitate DNA 농도 제조 업체에 따르면 dsDNA 정량 시 약을 사용 하 여 &#39; s 사양 (재료의 표 참조). 
	참고: dsDNA 정량 시 약을 사용 하는 spectrophotometric DNA 정량 잔여 페 놀에 의해 영향을 받을 수 있기 때문에.</li>
	<li>-20 ° C에 게 DNA HincII 치료를 계속 하거나.</li>
</ol> 4. HincII 치료와 알칼리 가수분해 5 µ L 10 x 버퍼 3.1, 1 µ L (10 U)를 포함 하는 <ol><li>반응에서 다이제스트 1 µ g의 DNA 혼합 HincII, 및 nuclease 무료 H 2 O 50 µ L의 최종 볼륨을. 
	참고: 결 찰에 대 한 최적의 조건을 달성 하기 위해, 두 번째 가닥 합성 및 PCR 증폭, 그것은 필요할 수 있습니다 예상 된다 DNA ribonucleotides의 매우 낮은 수를 포함 하는 경우 입력된 DNA 양을 증가 시키는. 마찬가지로, 그것은 ribonucleotides의 수는 매우 높은 경우 입력된 DNA를 감소 해야 할 수도 있습니다.</li>
	<li>37 ° c.에 30 분 동안 품 어</li>
	<li>정화 HincII 치료 DNA 상자성 구슬. 
	참고: 관 뚜껑 열고 튜브를 열어서 펠 렛을 방해 하지 하려면 다음 단계에 계속.
	<ol><li>각 상자성 구슬의 1.8 V 추가 샘플, 신중 하 게 pipetting, 혼합 및 10 분에 대 한 실 온에서 품 어</li>
		<li>작은 구슬 5 분에 대 한 다음 제거 하 고 상쾌한을 버리고 자기 랙 사용.</li>
		<li>약 30 s 다음 제거 및 삭제는 상쾌한 70% 에탄올 (실내 온도)의 150 µ L와 펠 릿을 세척.</li>
		<li>세척 약 30 70% 에탄올 (실내 온도)의 200 µ L와 펠 릿 s 다음 제거 하 고 삭제는 상쾌한. 
		참고: 잔여 에탄올 10 µ L 피 펫으로 제거할 수 있습니다. 방울 짧게 미리 내려 버리고 수.</li>
		<li>건조 약 15-20 분에 대 한 실 온에서 샘플 
		참고: 정확한 시간 구슬의 볼륨 및 펠 릿의 모양에 따라 달라 집니다, 산 탄을 시각적으로 확인 한다 따라서.</li>
		<li>자석 선반에서 튜브를 제거 하 고 45 µ L EB, 신중 하 게 pipetting으로 혼합에에서 펠 릿을 elute.</li>
		<li>5 분 다음 작은 자석 선반에 구슬 하 고 순화 된 DNA의 45 µ L를 사용 하 여 단계 4.4에서에서 품 어.</li>
	</ol></li> <li>코 (3 M) 또는 50 µ L의 총 볼륨을 만드는 DNA에 KCl (3 M)의 추가 5 µ L. 
	주의: 3 M 코 솔루션 부식성입니다. 보호 옷과 장갑을 착용.</li>
	<li>품은 교 잡에서 55 ° C에서 2 h 오븐 얼음에 5 분 뒤 
	참고: 것이 좋습니다 튜브의 균일 한가 열을 유지 하 고 뚜껑에 결로 방지 난방 블록 보다는 오븐에 코 치료를 수행 하.</li>
	<li>침전 DNA 10 µ L 나트륨 아세테이트를 추가 하 여 (3 M, pH = 5.2) 및 125 µ L 감기 100% 에탄올. 5 분 ice에 품 어 
	주의: 100% 에탄올은 가연성 및 자극. 통풍이 캐비닛에 저장, 보호 옷과 장갑을, 착용 하 고 화 염에서 유지.</li>
	<li>Centrifuging 21000 x g, 5 분 동안 4 ° C에 의해 gDNA를 펠 렛 하 고는 상쾌한 삭제.</li>
	<li>세척 DNA 펠 릿 250 µ L 찬 70 %EtOH, 21000 x g, 5 분, 4 ° C에서 원심 및 삭제는 상쾌한. 
	참고: 제거 하려면 방울, 튜브 수 수 스핀 다운 짧게 다시 하 고 상쾌한 10 µ l 피 펫 제거 될 수 있다.</li>
	<li>게 보이는 어떤 액체 증발 될 때까지 약 5-10 분 동안 열려 튜브에서 건조 하는 펠 릿.</li>
	<li>실 온에서 30 분 동안 20 µ L EB에에서 게 DNA 펠 릿 디졸브.</li>
</ol> 5. 5´ 끝 인 산화 <ol>각 샘플 미리 죄수 <li>반응 혼합 준비T4 polynucleotide 키 니 아 제 반응 버퍼, 1 µ L (10 U) 3´-인산 가수분해 효소-마이너스 T4 polynucleotide 키 니 아 제, 및 2.5 µ L ATP (10mm) x 2.5 µ L 10의 isting.</li>
	<li>전송 19 µ L 각 DNA의 새로운 200 µ L 관으로 샘플 및 열 cycler에서 85 ° C에서 3 분 변성.</li>
	<li>멋진 DNA 얼음에 샘플링 하 고 반응 혼합의 6 µ L 각 샘플 추가.</li>
	<li>30 분 및 중지 20 분 65 ° C에서 샘플을 배양 하 여 반응 하는 37 ° C에서 품 반응 혼합</li>
	<li>정화 DNA로 4.3에 상자성 구슬의 1.8 V를 사용 하 여 설명 하지만 14 µ L EB에에서 elute.</li>
</ol> 6. ssDNA 결 찰 <ol><li>0.5 µ L ATP (2mm), T4 RNA 리가 반응 버퍼, 5 µ L CoCl 3 (NH 3) 6 (10 m m), x 5 µ L 10의 사전에 구성 된 각 샘플에 대 한 반응 혼합 준비 0.5 µ L ARC140 (100 µ M), 25 µ L 50% 말뚝 8000. Pipetting으로 잘 믹스. 
	주의: CoCl 3 (NH 3) 6 이며 발암, sensitizing, 수생 환경 유해. 보호 옷과 장갑을 착용.</li>
	<li>전송 13 µ L에서 순화 된 DNA의 새로운 200 µ L 튜브 5.5 단계와 열 cycler에서 85 ° C에서 3 분 변성.</li>
	<li>차가운 얼음에 DNA 각 샘플, pipetting, 혼합 반응 혼합의 36 µ L을 추가 하 고 간단히 스핀 다운.</li>
	<li>추가 1 µ L (10 U) T4 RNA 리가의 각 반응에 pipetting, 혼합 하 고 짧게 스핀 다운.</li>
	<li>어두운 하룻밤에 실 온에서 샘플을 품 어.</li>
</ol> 7. 두 번째 가닥 합성 4.3에 설명 된 대로 <ol><li>Purify DNA 출혈 하지만 상자성 구슬의 0.8 V를 사용 하 여, 작은 구슬 10 분 및 20 µ L EB에에서 elute. 
	참고: 결 찰 반응 혼합의 높은 점도 인해 pelleting의 첫 번째 단계는 연장.</li>
	<li>전송 20 µ L 새로운 200 µ L PCR 튜브에 DNA 샘플의. 제조 업체에 따라 상자성 구슬의 0.8 V를 사용 하 여 정화 단계 반복 &#39; s 사양 및 14 µ L EB에에서 elute.</li>
	<li>10 x T7 DNA 중 합 효소 반응 버퍼, 2 µ L의 2 µ L의 사전에 구성 된 각 샘플에 대 한 반응 혼합 준비 ARC76/77 (2 µ M), 2 µ L dNTPs (2mm), 및 0.8 µ L BSA (1 mg/mL).</li>
	<li>새 200 µ L 튜브에 DNA를 정화 하는 전송 12.8 µ L, 열 cycler에서 85 ° C에서 3 분 변성.</li>
	<li>얼음에 DNA를 냉각 하 고 각 샘플, pipetting으로 혼합, 짧게, 스핀 다운 및 실 온에서 5 분 동안 품 어 반응 혼합의 6.8 µ L 추가.</li>
	<li>각 반응에 0.4 µ L (4 U) T7 DNA 중 합 효소를 추가 하 고 실 온에서 5 분 동안 품 어.</li>
	<li>정화 DNA로 4.3에 상자성 구슬의 0.8 V를 사용 하 여 설명과 11 µ L EB에에서 elute.</li>
</ol> 8. PCR 증폭 및 라이브러리 정량 <ol><li>준비 새로운 200에서 각 샘플에 대 한 반응 혼합물 µ L 튜브 7.5 µ L의 미리 구성 된 ARC49 (2 µ M), 7.5 µ L 인덱스 뇌관 (2 µ M, 각 샘플에 대 한 독특한), 그리고 뜨거운 시작 x 25 µ L 2 준비 믹스.</li>
	<li>각 반응에 DNA 샘플의 추가 10 µ L. 다음 조건을 사용 하 여 라이브러리를 증폭: 95 ° C 45에서 변성 15 98 ° C의 18 주기 다음 s s, 30 위한 65 ° C s, 72 ° C 30에 대 한 s, 72 ° c에서 4 °에서 2 분 대기 샘플에 대 한 최종 신장으로 끝나는 증폭 후 C.</li>
	<li>4.3, 상자성 구슬의 0.8 V를 사용 하 여에 설명 된 대로 라이브러리를 정화 하 고 20 µ L TE 버퍼에 elute.</li>
	<li>제조 업체에 따르면 dsDNA 정량 시 약을 사용 하 여 라이브러리를 quantitate &#39; s 사양 (재료의 표 참조).</li>
	<li>샘플-20 ° C에서 저장 하거나 라이브러리 분석 계속.</li>
</ol> 9. 라이브러리 분석 및 풀링은 <ol><li>각 라이브러리의 품질을 결정 하 고 디지털 전기 시스템을 사용 하 여 평균 조각 크기를 추정. 
	참고: 평균 조각 크기는 electropherogram의 곡선 아래의 영역은 절반으로 추정 하 여 평가 무시 하는 표식에서 봉우리. 코 또는 KCl 치료 후 적당 한 라이브러리 프로필의 대표적인 결과 그림 2A에 부여 됩니다.</li>
	<li>계산으로 라이브러리의 농도 (nM): 
	(c/10 3) /(p*650)] * 10 9 어디 c ng / µ L에서 라이브러리의 농도 이며 p 혈압, 평균 조각 크기에 예상된 9.1로.</li>
	<li>풀 같은 어 금 니 양의 최대 24 라이브러리 시퀀싱에 대 한 다른 인덱스 뇌관으로 증폭. 25 µ L의 최종 볼륨을 10의 농도 테 버퍼를 추가 nM. 
	참고: 라이브러리 풀링할 수에 따라 각 도서관에서 DNA의 금액은 조정 됩니다. 뇌관 이합체 경우 단계에서 9.1 약 130의 뚜렷한 피크로 정화 단계 4.3, 상자성 구슬, 0.8 V를 사용 하 여에 설명 된 대로 반복 되 고 DNA는 eluted 25 µ L 테 buf에 때문에 bp, 라이브러리 풀의 최종 볼륨 25 µ L를 초과할 수 그다지입니다.
	<li>결정 제조 업체에 따르면 dsDNA 정량 시 약을 사용 하 여 새 라이브러리 풀 농도 <ol>&#39; s 사양 및 평균 피크 크기 위에서 설명한. 시퀀싱 및 데이터 분석 (섹션 10 및 11) 진행.</li>
	</ol></li></ol> 10. 시퀀싱 <ol><li>풀링된 라이브러리 12 75-자료 쌍-엔드 시퀀싱을 수행.</li></ol>
 11. 데이터 분석 <ol><li>트림 어댑터 시퀀스를 제거 하려면 모든 읽기 품질에 대 한 필터링 및 길이 읽기. 
	참고:이 수행할 수 명령으로 cutadapt 1.2.1 20을 사용 하 여 ' cutadapt-f fastq-와일드 카드 일치-읽기--조용한-m 15-q 10-한 NNNNNNN &#60; 파일 &#62;', NNNNNNN 실제 어댑터 시퀀스로 대체 됩니다 및 &#60; 파일 &#62;는 fastq 파일 이름으로 바뀝니다.</li>
	<li>사용자 지정 스크립트를 사용 하 여 이전 단계에서 삭제 된 읽기의 동료를 제거.</li>
	<li>남은 친구 1 정렬 라이브러리 준비에 사용 되는 모든 oligonucleotides의 시퀀스를 포함 하는 인덱스에 쌍 (예를 들어, Bowtie 0.12.8 21와 명령줄을 사용 하 여 옵션-m1-v2). 성공적인 정렬 모든 쌍 삭제.</li>
	<li>Bowtie 명령줄과 함께 사용 하 여 유기 체 참조 게놈을 나머지 쌍 정렬 옵션-v 2-X 10000-최고.</li>
	<li>지도 모든 정렬 되지 않은 쌍의 친구 1을 정렬 하 여 미토 콘 드 리아 분자 시작과 끝 사이의 간격을 읽고 (Bowtie 명령줄과 함께 사용 하 여 옵션-v2).</li>
	<li>모든 단일 및 결합 끝 정렬에 대 한 5´-끝의 수를 결정합니다. 분해 된 ribonucleotides가 있던 위치에 이러한 기본 상류의 위치를 이동.</li>
	<li>Bowtie 파일에서 데이터를 내보낼 게놈 브라우저 공통 시각화에 대 한 사용자 지정 스크립트를 사용 하 여 bedgraph 파일 형식으로 서식을. 각 가닥 당 읽기에 대 한 읽기를 정상화 백만.</li>
	<li>Incorp의 정체성을 결정 하는 유기 체 게놈 시퀀스를 참조 bedgraph 파일에서 위치 및 개수를 사용 하 여ribonucleotides orated. 
	참고: 인간 미토 콘 드리 아 게놈 16,200-300 및 5,747-5,847에 대 한 영역에서 읽기에 대 한 각 제외 되어야 이후이 지역 많은 무료 5´-끝 ribonucleotide 법인 DNA 중 합 효소 γ에 의해 무관 포함.</li>
	<li>분할 단일 가닥 휴식, (즉, 미토 콘 드 리아 분자 당 ribonucleotides의 수) 당 ribonucleotides의 번호를 HincII 사이트 당 읽기 평균 수와 11 HincII 사이트에서 읽기를 제외한 총 읽습니다.</li>
</ol>

<ol><li>Traut, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Physiological+Concentrations+of+Purines+and+Pyrimidines%5BTitle%5D)+AND+%22Mol.+Cell.+Biochem%22%5BJournal%5D)">Physiological Concentrations of Purines and Pyrimidines.</a> Mol. Cell. Biochem. 140, 1-22 (1994).</li>
<li>McElhinny, S. A. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Abundant+ribonucleotide+incorporation+into+DNA+by+yeast+replicative+polymerases%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+USA%22%5BJournal%5D)">Abundant ribonucleotide incorporation into DNA by yeast replicative polymerases.</a> Proc. Natl. Acad. Sci. USA. 107, 4949-4954 (2010).</li>
<li>Williams, J. S., Lujan, S. A., Kunkel, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Processing+ribonucleotides+incorporated+during+eukaryotic+DNA+replication%5BTitle%5D)+AND+%22Nat.+Rev.+Mol.+Cell+Biol%22%5BJournal%5D)">Processing ribonucleotides incorporated during eukaryotic DNA replication.</a> Nat. Rev. Mol. Cell Biol. 17, 350-363 (2016).</li>
<li>Clausen, A. R., Zhang, S., Burgers, P. M., Lee, M. Y., Kunkel, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ribonucleotide+incorporation%2C+proofreading+and+bypass+by+human+DNA+polymerase+delta%5BTitle%5D)+AND+%22DNA+Repair%22%5BJournal%5D)">Ribonucleotide incorporation, proofreading and bypass by human DNA polymerase delta.</a> DNA Repair. 12, 121-127 (2013).</li>
<li>Potenski, C. J., Klein, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((How+the+misincorporation+of+ribonucleotides+into+genomic+DNA+can+be+both+harmful+and+helpful+to+cells%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">How the misincorporation of ribonucleotides into genomic DNA can be both harmful and helpful to cells.</a> Nucleic Acids Res. 42, 10226(2014).</li>
<li>Vengrova, S., Dalgaard, J. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNase-sensitive+DNA+modification%28s%29+initiates+S.+pombe+mating-type+switching%5BTitle%5D)+AND+%22Gene.+Dev%22%5BJournal%5D)">RNase-sensitive DNA modification(s) initiates S. pombe mating-type switching.</a> Gene. Dev. 18, 794-804 (2004).</li>
<li>Lujan, S. A., Williams, J. S., Clausen, A. R., Clark, A. B., Kunkel, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ribonucleotides+Are+Signals+for+Mismatch+Repair+of+Leading-Strand+Replication+Errors%5BTitle%5D)+AND+%22Mol.+Cell%22%5BJournal%5D)">Ribonucleotides Are Signals for Mismatch Repair of Leading-Strand Replication Errors.</a> Mol. Cell. 50, 437-443 (2013).</li>
<li>Ghodgaonkar, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ribonucleotides+Misincorporated+into+DNA+Act+as+Strand-Discrimination+Signals+in+Eukaryotic+Mismatch+Repair%5BTitle%5D)+AND+%22Mol.+Cell%22%5BJournal%5D)">Ribonucleotides Misincorporated into DNA Act as Strand-Discrimination Signals in Eukaryotic Mismatch Repair.</a> Mol. Cell. 50, 323-332 (2013).</li>
<li>DeRose, E. F., Perera, L., Murray, M. S., Kunkel, T. A., London, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Solution+Structure+of+the+Dickerson+DNA+Dodecamer+Containing+a+Single+Ribonucleotide%5BTitle%5D)+AND+%22Biochemistry%22%5BJournal%5D)">Solution Structure of the Dickerson DNA Dodecamer Containing a Single Ribonucleotide.</a> Biochemistry. 51, 2407-2416 (2012).</li>
<li>Li, Y. F., Breaker, R. R. <a target="_blank" href="http://pubs.acs.org/doi/abs/10.1021/ja990592p">Kinetics of RNA degradation by specific base catalysis of transesterification involving the 2 '-hydroxyl group.</a> J. Am. Chem. Soc. 121, 5364-5372 (1999).</li>
<li>McElhinny, S. A. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+instability+due+to+ribonucleotide+incorporation+into+DNA%5BTitle%5D)+AND+%22Nat.+Chem.+Biol%22%5BJournal%5D)">Genome instability due to ribonucleotide incorporation into DNA.</a> Nat. Chem. Biol. 6, 774-781 (2010).</li>
<li>Berglund, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nucleotide+pools+dictate+the+identity+and+frequency+of+ribonucleotide+incorporation+in+mitochondrial+DNA%5BTitle%5D)+AND+%22Plos+Genet%22%5BJournal%5D)">Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA.</a> Plos Genet. 13, (2017).</li>
<li>Brown, J. A., Suo, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Unlocking+the+Sugar+%22Steric+Gate%22+of+DNA+Polymerases%5BTitle%5D)+AND+%22Biochemistry%22%5BJournal%5D)">Unlocking the Sugar "Steric Gate" of DNA Polymerases.</a> Biochemistry. 50, 1135-1142 (2011).</li>
<li>Sparks, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNase+H2-Initiated+Ribonucleotide+Excision+Repair%5BTitle%5D)+AND+%22Mol.+Cell%22%5BJournal%5D)">RNase H2-Initiated Ribonucleotide Excision Repair.</a> Mol. Cell. 47, 980-986 (2012).</li>
<li>Miyabe, I., Kunkel, T. A., Carr, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Major+Roles+of+DNA+Polymerases+Epsilon+and+Delta+at+the+Eukaryotic+Replication+Fork+Are+Evolutionarily+Conserved%5BTitle%5D)+AND+%22Plos+Genet%22%5BJournal%5D)">The Major Roles of DNA Polymerases Epsilon and Delta at the Eukaryotic Replication Fork Are Evolutionarily Conserved.</a> Plos Genet. 7, (2011).</li>
<li>Clausen, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tracking+replication+enzymology+in+vivo+by+genome-wide+mapping+of+ribonucleotide+incorporation%5BTitle%5D)+AND+%22Nat.+Struct.+Mol.+Biol%22%5BJournal%5D)">Tracking replication enzymology in vivo by genome-wide mapping of ribonucleotide incorporation.</a> Nat. Struct. Mol. Biol. 22, 185-191 (2015).</li>
<li>Koh, K. D., Balachander, S., Hesselberth, J. R., Storici, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ribose-seq%3A+global+mapping+of+ribonucleotides+embedded+in+genomic+DNA%5BTitle%5D)+AND+%22Nat.+Methods%22%5BJournal%5D)">Ribose-seq: global mapping of ribonucleotides embedded in genomic DNA.</a> Nat. Methods. 12, 251(2015).</li>
<li>Keszthelyi, A., Daigaku, Y., Ptasinska, K., Miyabe, I., Carr, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mapping+ribonucleotides+in+genomic+DNA+and+exploring+replication+dynamics+by+polymerase+usage+sequencing+%28Pu-seq%29%5BTitle%5D)+AND+%22Nat.+Protoc%22%5BJournal%5D)">Mapping ribonucleotides in genomic DNA and exploring replication dynamics by polymerase usage sequencing (Pu-seq).</a> Nat. Protoc. 10, 1786-1801 (2015).</li>
<li>Ding, J., Taylor, M. S., Jackson, A. P., Reijns, M. A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+mapping+of+embedded+ribonucleotides+and+other+noncanonical+nucleotides+using+emRiboSeq+and+EndoSeq%5BTitle%5D)+AND+%22Nat.+Protoc%22%5BJournal%5D)">Genome-wide mapping of embedded ribonucleotides and other noncanonical nucleotides using emRiboSeq and EndoSeq.</a> Nat. Protoc. 10, 1433-1444 (2015).</li>
<li>Martin, M. <a target="_blank" href="http://journal.embnet.org/index.php/embnetjournal/article/view/200">Cutadapt removes adapter sequences from high-throughput sequencing reads.</a> EMBnet.journal. 17, 10-12 (2011).</li>
<li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome%5BTitle%5D)+AND+%22Genome+Biol%22%5BJournal%5D)">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10, (2009).</li>
</ol>

저자 들은 아무 경쟁 금융 관심사 선언 합니다.

여기 우리는 동시에 지도 하 고 시퀀스 특정 사이트 설립된 하이든-seq 프로토콜에 추가로 게놈에서 DNA 분열의 간단한 소개에 의해 gDNA, 및 mtDNA에서 ribonucleotides 특히, 계량 기법 제시. 이 연구는 인간 mtDNA에 초점을 맞추고, 하는 동안 원래 하이든 seq 메서드 Saccharomyces cerevisiae, 다른 유기 체12,16메서드의 번역 설명에서 개발 되었다.
신뢰할 수 있는 결과 위해,이 접근 방식에서 얻은 몇 가지 중요 한 단계를 주목 해야 한다: (A) 시퀀싱 어댑터가 모든 사용 가능한 5´ 끝에 선 이후, 그것은 매우 손상 DNA와 함께 작동 하도록 중요 한. DNA는 격리 되어야 합니다 라이브러리 DNA 분리 직후 선호 여야 한다 또는-20 ° c.에 DNA를 저장 될 수 있다 오랜 동안 DNA는 냉장고에서 저장 반복적으로 동결 하 고 그것을 재개 하는 권장 하지 않습니다. (B)를이 방법으로 적합 한 라이브러리를 생성, 전체 샘플 및 양적 가수분해의 균일가 열을 보장 하는 난방 블록 보다는 외피 오븐에서 DNA의 코 치료를 수행 하기 위해 결정적 이다. (C) 또한, 그것은 풀링 및 시퀀싱 하기 전에 라이브러리의 품질을 제어 하는 중요 한입니다. DNA 계량 한다 고 적절 한 조각 크기를 확인 하 고 뇌관 이합체 검사 라이브러리 DNA의 적절 한 금액을 보장 하는 자동된 전기 영동 시스템을 사용 하 여 분석.
의미 있는 데이터 분석을 위해 그것은 또한이 방법의 유익한 값은 배경 및 시퀀스 또는 가닥 편견을 평가 하기 위해 적절 한 컨트롤에 의존 하는 것이 중요. 우리는 정기적으로 때만 시퀀스 특정 endonuclease (그림 2B, 왼쪽된 패널)와 소화 KCl 샘플의 70%에서 매핑 효율성 달성. 또한, 그것은 endonuclease 치료 전체에는 영향을 미치지 않습니다 확인 하는 중요 한 HincII를 비교 하 여 법인된 ribonucleotides의 검색 치료 및 치료 샘플 (그림 3B). 이 실험에서 우리는 HincII 소개 사용 특정 사이트 컷, 다른 높은-충실도 제한 효소를 사용 될 수도 있지만.
프로토콜 적응 시킬 수 있는 종료 5´-인산 염 또는 5´ 오를 처리할 수 있는 DNA 장애의 다른 유형을 공부 하. 결과의 정확도 처리의 특이성에 의존 하며 적당 한 컨트롤 (예: 야생 타입 또는 치료) 확인에 대 한. 또한 때이 메서드를 다른 응용 프로그램 또는 다른 유기 체와 함께 사용 하기 위해 적응, 그것의 현재 설치에서 메서드 라이브러리에 처리 되는 DNA의 약 1 µ g 필요 고려해 야 하나. 포함 된 ribonucleotides의 수에 끝 수 이므로,이 따라 유기 체 또는 돌연변이, ribonucleotides의 더 낮은 숫자를 포함 하는 샘플 필요 이상의 DNA 끝에의 충분 한 번호를 입력 합니다 이후 도서관 건설입니다. 마찬가지로, DNA 샘플 ribonucleotides의 훨씬 더 높은 수 있다면, 그것은 요구할 것입니다 또한 결 찰, 두 번째 가닥 합성 및 PCR 증폭에 대 한 최적의 조건을 얻기 위해 덜 입력된 DNA를 사용 하 여. 그것은 주목할 만한 도서관 건축이이 프로토콜에서 설명 된 대로 또한 생성 된 데이터 ( 2D 그림에 표시 된) 대로 핵 게놈을 취재 하 고만 데이터 분석 mtDNA에 집중 했다. 이것은 온건 하 게 낮은 ribonucleotide 주파수로 더 큰 게놈이이 방법으로도 캡처되지는 보여줍니다.
이 메서드를 고려할 경우 특정 제한 한다 고려해:이 방법, 이론, 해야 거의 모든 유기 체에 적용 적합 한 참조 게놈 읽기의 정렬에 대 한 필요는. 또한, 우리의 프로토콜에서 얻은 결과 세포의 많은 수에서 읽기를 나타냅니다. 셀의 하위 집합의 특정 ribonucleotide 설립 패턴이 접근이 방식에 의해 확인 될 수 없습니다. Ribonucleotides ribonucleotides의 매우 낮은 수를 가진 더 큰 게놈에 매핑된, 임의의 닉스에서 ribonucleotides를 구별할 수 어려울 수 있습니다 하 고 적절 한 컨트롤 따라서 필요.
우리가 여기, 설명 방법 하이든-Seq16, Ribose Seq17, Pu Seq18또는 emRiboSeq19같은 기술을 사용할 수 비보에 확장 합니다. 이 접근의 활용 포함 된 ribonucleotides의 감도를 알칼리 또는 RNase h 2 치료, 각각, 그들의 지도의 비교를 허용 하는 ribonucleotides 게놈 넓은 식별 하 다음-세대 시퀀싱을 채용 상대 설립입니다. DNA 순서를 구체적으로 고착 하 여 알칼리 가수분해 포함된 ribonucleotides에서 뿐만 아니라, 위에서 설명한 대로 ribonucleotides에 대 한 읽기 정규화 할 수 있습니다 그 분열 사이트 뿐만 아니라 식별을 허용 하 고의 매핑 ribonucleotides, 뿐만 아니라 각 DNA 분자에 대 한 그들의 정량. DNA 복제와 관련 된 질병의 맥락에서 우리의 기술 응용 DNA 수리, 및 TLS은 분자 메커니즘 및 게놈 무결성을 일반적으로 기본에서 ribonucleotides의 역할에 대 한 깊은 이해를 제공할 수 있습니다.

진 핵 세포에서 ribonucleotides (rNTPs)의 농도 deoxyribonucleotides (dNTPs)1의 농도 보다 훨씬 높다. DNA polymerases ribonucleotides, 차별만이 차별 완벽 한 이며, 결과적으로, deoxyribonucleotides 대신 ribonucleotides 수 있습니다 통합할 수 게놈 DNA 복제 하는 동안. Ribonucleotides 가장 일반적인 정식이 아닌 뉴클레오티드 게놈2에 통합 될 수 있습니다. 대부분 이러한 ribonucleotides의 RNase h 2 시작된 ribonucleotide 절단 선 (RER) 또는 Topoisomerase 1 (참조3검토) 오카자키 조각 성숙 하는 동안 제거 됩니다. Ribonucleotides는 제거할 수 없습니다 DNA2,4 에 안정적으로 통합 유지 하 고 (검토5검토) 하는 유해 하 고 유익한 방법으로 그것을 영향을 미칠 수 있습니다. 긍정적인 신호 역할을 할 수 있는, 게다가 예 유형 짝짓기에 스위치 Schizosaccharomyces pombe 6 와 불일치 하는 동안 초기 DNA 가닥을 표시 복구 (MMR)7,8, ribonucleotides에 영향을 미칠는 구조9 그리고 일차 스트레스 및 게놈 불안정성11의 결과로 그들의 ribose10, 2´-수 산 기 그룹이 주변 DNA의 안정성. 게놈 DNA (gDNA)에 ribonucleotides와 복제 및 복구 메커니즘으로 게놈 안정성에 대 한 의미에 그들의 관련성의 풍부한 게놈 넓은 방법에 있는 그들의 정확한 발생과 주파수를 조사 하는 이유를 제공 합니다.
RNase h 2 활동 인간의 미토 콘 드리 아에서 발견 되지 않은 그리고 ribonucleotides는 따라서 미토 콘 드리 아 DNA (mtDNA)에 효율적으로 되지 제거. 여러 경로 인간의 미토 콘 드리 아에 뉴클레오티드의 공급에 참여 하 고 미토 콘 드리 아 뉴클레오티드 풀에서 교란 인간 mtDNA에 ribonucleotides의 높은 수를 발생 시키는 지 여부를 조사, 우리 지도를 quantitate 프로토콜 개발 섬유 아 세포, HeLa 세포, 및 환자 셀 라인12에서 고립 된 인간 mtDNA에 이러한 ribonucleotides.
경쟁 rNTPs 반응에 포함 되어 단일 ribonucleotide 삽입 또는 뇌관 연장 실험을 기반으로하는 대부분의 생체 외에서 (검토 검토13) DNA polymerases' rNTPs에 대 한 선택도 결정 방식 믹스, 식별 또는 ribonucleotide 관 상대 정량 짧은 DNA 템플렛에 허용. 짧은 시퀀스에 양적 접근 하지 dNTP와 rNTP 풀 세포 농도 반영 하 고 따라서 제공 중 합 효소 선택도에 대 한 통찰력 하지만 전체 게놈에 관한 제한 된 의미의 수 있습니다. 그것은 보였다 ribonucleotides는 플라스 미드와 같은 더 긴 DNA 템플렛의 복제 하는 동안 통합의 상대적인 양이 방사선된 dNTPs를 사용 하 여 hydrolyzing14는 알칼리 성 환경 DNA 시퀀싱 젤에 구상 될 수 있다. 또한, gDNA 남쪽 오 점 다음 알칼리 가수분해, 물가 관련 조사 및 ribonucleotide 법인 vivo에서15의 절대 속도의 결정에 분석 되어 있다. 이러한 접근 법인 주파수의 상대 비교를 허용 하지만 위치 또는 법인된 ribonucleotides의 id에 아무 대 한 통찰력을 제공. 더 최근 접근 gDNA에서 vivo에서, 하이든-Seq16, Ribose Seq17, Pu Seq18또는 emRiboSeq19활용 포함 된 ribonucleotides' 같은 ribonucleotide 콘텐츠 분석 감도를 알칼리 또는 RNase h 2 치료, 각각, 다음-세대 시퀀싱 ribonucleotides 게놈 넓은 식별 하 고. 이러한 메서드는 검색 된 ribonucleotides의 절대 법인 주파수에 대 한 통찰력을 제공 하지 않습니다. 하이든-seq 프로토콜 시퀀스 특정 효소 분열의 단계를 추가 하 여 우리가 여기에 편리 하 게 설명 하는 방법은 동시 매핑 수 있도록 시퀀싱 접근에서 얻은 정보를 확장 하 고 정량의 임베디드 ribonucleotides12. 이 방법은 매우 그대로 DNA 추출 생성 될 수 있고 적합 한 참조 게놈은 사용할 수 있는 거의 모든 유기 체에 적용 됩니다. 메서드 quantitate는 nuclease에 의해 소화 될 수 있는 잎 5´ 인산 염 또는 5´ 오 끝을는 병 변의 위치 확인을 적용할 수 있습니다.
지도 및 genomic DNA에서 ribonucleotides을 quantitate, 메서드 시퀀스 특정 endonuclease에 의해 분열을 결합 하 고는 endonuclease에 대 한 특정 인식 순서는 및 5´-5´-인산 염을 생성 하는 알칼리 가수분해 사이트 끝 오 ribonucleotides 있었다 위치에서 끝납니다. 생성 된 무료 끝 어댑터와 출혈 이후에 있기 때문에 차세대 시퀀싱을 사용 하 여 시퀀싱, 그것 매우 그대로 DNA를 사용 하 여 DNA 추출 및 라이브러리 준비 하는 동안 임의의 조각화 방지 중요성 이다. 이러한 읽기 endonuclease 분열에 읽기로 표준화 평가 동시 정량 및 매핑 검색된 ribonucleotides 수 있습니다. 무료 5´ 끝 제어 실험 KCl와 치료에 의해 DNA의 알칼리 가수분해가 대체 어디에서 검색 됩니다. 인수 데이터 ribonucleotide 위치 및 수량에 대 한 통찰력을 제공 하 고 ribonucleotide 콘텐츠 및 법인 주파수에 관하여 분석을 수 있습니다.

<table><tbody><tr><td>10x T4 Polynucleotide Kinase Reaction Buffer</td><td>New England Biolabs</td><td>B0201S</td><td></td></tr><tr><td>10x T4 RNA Ligase Reaction Buffer</td><td>New England Biolabs</td><td>B0216L</td><td></td></tr><tr><td>1x PBS</td><td>Medicago</td><td>09-9400-100</td><td>dissolve 1 tablet in H&lt;sub&gt;2&lt;/sub&gt;O to a final volume of 1 L</td></tr><tr><td>2-Propanol</td><td>Sigma-Aldrich</td><td>33539-1L-GL-R</td><td></td></tr><tr><td>2100 Bioanalyzer</td><td>Agilent Technologies</td><td>G2940CA</td><td></td></tr><tr><td>50 mL Centrifuge Tube</td><td>VWR</td><td>525-0610</td><td></td></tr><tr><td>Adenosine 5&#039;-Triphosphate (ATP, 10 mM)</td><td>New England Biolabs</td><td>P0756S</td><td>dilute with EB to 2 mM</td></tr><tr><td>Agilent DNA 1000 Kit</td><td>Agilent Technologies</td><td>5067-1504</td><td></td></tr><tr><td>BSA, Molecular Biology Grade (20 mg/mL)</td><td>New England Biolabs</td><td>B9000S</td><td>diltue with nuclease-free H&lt;sub&gt;2&lt;/sub&gt;O to 1 mg/mL</td></tr><tr><td>Buffer EB</td><td>QIAGEN</td><td>19086</td><td>referred to as EB</td></tr><tr><td>CleanPCR paramagnetic beads</td><td>CleanNA</td><td>CPCR-0050</td><td></td></tr><tr><td>Deoxynucleotide (dNTP) Solution Mix (10 mM each)</td><td>New England Biolabs</td><td>N0447L</td><td>dilute with EB to 2 mM</td></tr><tr><td>DMEM, high glucose, GlutaMAX Supplement</td><td>Gibco</td><td>61965026</td><td></td></tr><tr><td>DynaMag 96 Side</td><td>Thermo Fisher</td><td>12331D</td><td></td></tr><tr><td>Ethanol 99.5% analytical grade</td><td>Solveco</td><td>1395</td><td>dilute with milliQ water to 70%</td></tr><tr><td>Ethylenediaminetetraacetic acid solution (EDTA, 0.5 M)</td><td>Sigma-Aldrich</td><td>03690-100ML</td><td></td></tr><tr><td>Fetal bovine serum</td><td>Gibco</td><td>10500056</td><td></td></tr><tr><td>HEPES buffer pH 8.0 (1 M) sterile BC</td><td>AppliChem</td><td>A6906,0125</td><td></td></tr><tr><td>Hexammine cobalt(III) chloride (CoCl&lt;sub&gt;3&lt;/sub&gt;(NH&lt;sub&gt;3&lt;/sub&gt;)&lt;sub&gt;6&lt;/sub&gt;)</td><td>Sigma-Aldrich</td><td>H7891-5G</td><td>dissolve in nuclease-free H&lt;sub&gt;2&lt;/sub&gt;O for 10&amp;nbsp;M solution, sterile filter. CAUTION: carcinogenic, sensitizing and hazardous to aquatic environment.</td></tr><tr><td>HincII</td><td>New England Biolabs</td><td>R0103S</td><td>supplied with NEBuffer 3.1</td></tr><tr><td>Hybridiser HB-1D</td><td>Techne</td><td>FHB4DD</td><td></td></tr><tr><td>KAPA HiFi HotStart ReadyMix (2X)</td><td>Kapa Biosystems</td><td>KK2602</td><td></td></tr><tr><td>Lysis buffer</td><td></td><td></td><td>50 mM EDTA, 20 mM HEPES, NaCl 75 mM, Proteinase K (200 &amp;micro;g/mL), 1% SDS</td></tr><tr><td>Micro tube 1.5 mL</td><td>Sarstedt</td><td>72.690.001</td><td></td></tr><tr><td>Microcentrifuge 5424R</td><td>Eppendorf</td><td>5404000014</td><td></td></tr><tr><td>Microcentrifuge MiniStar silverline</td><td>VWR</td><td>521-2844</td><td></td></tr><tr><td>Multiply&amp;nbsp;&amp;micro;StripPro 0.2 mL tube</td><td>Sarstedt</td><td>72.991.992</td><td></td></tr><tr><td>Nuclease-free water</td><td>Ambion</td><td>AM9937</td><td></td></tr><tr><td>Phenol &amp;ndash; chloroform &amp;ndash; isoamyl alcohol (25:24:1)</td><td>Sigma-Aldrich</td><td>77617-500ML</td><td></td></tr><tr><td>Potassium chloride (KCl)</td><td>VWR</td><td>26764.232</td><td>dissolve in nuclease-free H&lt;sub&gt;2&lt;/sub&gt;O for 3&amp;nbsp;M solution, sterile filter</td></tr><tr><td>Potassium hydroxide (KOH)</td><td>VWR</td><td>26668.296</td><td>dissolve in nuclease-free H&lt;sub&gt;2&lt;/sub&gt;O for 3&amp;nbsp;M solution, sterile filter</td></tr><tr><td>Proteinase K</td><td>Ambion</td><td>AM2546</td><td></td></tr><tr><td>Qubit 3.0 Fluorometer</td><td>Invitrogen</td><td>Q33216</td><td></td></tr><tr><td>Qubit Assay Tubes</td><td>Invitrogen</td><td>Q32856</td><td></td></tr><tr><td>Qubit dsDNA BR Assay Kit</td><td>Invitrogen</td><td>Q32850</td><td>CAUTION: Contains flammable and toxic components</td></tr><tr><td>Qubit dsDNA HS Assay Kit</td><td>Invitrogen</td><td>Q32851</td><td>CAUTION: Contains flammable and toxic components</td></tr><tr><td>Refrigerated Centrifuge 4K15</td><td>Sigma Laboratory Centrifuges</td><td>No. 10740</td><td></td></tr><tr><td>SDS Solution, 10%</td><td>Invitrogen</td><td>15553-035</td><td></td></tr><tr><td>Sodium acetate buffer solution, pH 5.2, 3 M (NaAc)</td><td>Sigma-Aldrich</td><td>S7899</td><td></td></tr><tr><td>Sodium chloride (NaCl)</td><td>VWR</td><td>27810.295</td><td>dissolve in nuclease-free H&lt;sub&gt;2&lt;/sub&gt;O for 5&amp;nbsp;M solution, sterile filter</td></tr><tr><td>T100 Thermal Cycler</td><td>Bio-Rad</td><td>1861096</td><td></td></tr><tr><td>T4 Polynucleotide Kinase (3&#039; phosphatase minus)</td><td>New England Biolabs</td><td>M0236L</td><td></td></tr><tr><td>T4 RNA Ligase 1 (ssRNA Ligase)</td><td>New England Biolabs</td><td>M0204L</td><td>supplied with PEG 8000 (50%)</td></tr><tr><td>T7 DNA Polymerase (unmodified)</td><td>New England Biolabs</td><td>M0274S</td><td>supplied with 10x T7 DNA Polymerase Reaction Buffer</td></tr><tr><td>TE Buffer</td><td>Invitrogen</td><td>12090015</td><td></td></tr><tr><td>ThermoMixer F2.0</td><td>Eppendorf</td><td>5387000013</td><td></td></tr></tbody></table>

simultaneous mapping and quantitation of ribonucleotides in human mitochondrial dna

Ribonucleotides는 게놈에 존재의 수를 추정 하 설립된 접근은 제한 법인된 ribonucleotides 템플릿으로 짧은 합성 DNA 파편 또는 플라스 미드를 사용 하 고 전체 결과 추정 하는 다음의 정량 게놈입니다. 또는, 알칼리 젤 또는 남부도 말을 사용 하 여 ribonucleotides는 게놈에 존재의 수를 견적 될 수 있습니다. 최근 비보에 접근 위치와 포함 된 ribonucleotides의 id를 제공 하는 ribonucleotides의 게놈 넓은 매핑 허용 다음-세대 시퀀싱을 사용 합니다. 그러나, 그들은 정량의 게놈으로 통합 되는 ribonucleotides의 수를 허용 하지 않습니다. 여기는 동시에 지도 하 고 차세대 시퀀싱에 의해 인간의 미토 콘 드리 아 DNA에서 에 비보에 통합 하는 ribonucleotides의 수를 quantitate 하는 방법에 설명 합니다. 우리가 매우 그대로 DNA를 사용 하 고 시퀀스 특정 이중 가닥 나누기는 endonuclease, 알칼리 이후에 hydrolyzing 법인된 ribonucleotides와 함께 그것을 소화 하 여 소개. 생성 된 끝은 어댑터와 출혈 그리고이 끝 다음-세대 시퀀싱 컴퓨터에서 시퀀싱 되. Ribonucleotides의 절대 수는 순서 특정 endonuclease 인식 사이트에서 읽기 평균 수 당 인식 사이트 밖에 서 읽기의 수로 계산할 수 있습니다. 이 프로토콜 또한 지도 및 DNA에 무료 흠을 quantitate 활용 될 수 있습니다 및 수 5´ 오를 처리할 수 있는 다른 DNA 병 변 지도를 적응 또는 5´-인산 염 끝. 또한,이 방법은 적합 한 참조 게놈은 사용할 수 있는 모든 유기 체에 적용할 수 있습니다. 이 프로토콜은 따라서 DNA 복제, 5´ 간 처리, DNA 손상, 및 DNA 복구 하는 중요 한 도구를 제공 합니다.

12를셀 위에서 설명한, 대표적인 데이터 생성 헬러에서 인간의 미토 콘 드리 아 DNA를 분석 하는 방법론을 설명 합니다. 그림 2B 요약된 읽기 모든 HincII 사이트에 보여줍니다 무거운 (HS)와 인간 mtDNA의 가벼운 물가 (LS) KCl 치료 (왼쪽된 패널) 후. 약 70% 모든 검색된 5´ 끝의 HincII 소화의 높은 효율을 보여주는 컷 사이트에 지역화 합니다. 라이브러리 포함 된 ribonucleotides에서 DNA를은 하 코 치료 약 40% (그림 2B, 오른쪽 패널)에 HincII 사이트에서 읽기 수가 감소 합니다. 이 많은 5´ 끝 ribonucleotide 관의 사이트에서 생성 되므로 충분 한 라이브러리 품질 지표입니다. 그림 2C 보여줍니다 지역화 및 5´-끝 (녹색)의 주파수 KCl 치료 및 읽기 생성 후 하이든-seq (마젠타)에 의해 코 치료 후, 무료 5´-끝과 끝에 ribonucleotides 알칼리 가수분해에 의해 생성 된. 무료 5´ 끝 및 ribonucleotides 인간 mtDNA의 HS에 지역화 왼쪽된 패널에 표시 되 고 그는 ls 지역화 오른쪽 패널에 표시 됩니다. Ribonucleotides (2D 그림, 상단 패널) 또는 HincII 사이트 (하단 패널) HS와 LS mtDNA의 원시 읽기의 상대적 숫자 표시, 각각, HS, 기준으로 LS의 14-fold 또는 31-fold 강한 범위 비슷한 편견에 대 한 관찰 하지 핵 한 DNA 이 스트랜드 바이어스 두 가닥의 기본 구성에 뚜렷한 차이 의해 설명 될 수 있습니다 고 HincII 사이트에 읽기에 정상화의 중요성을 보여 줍니다.
읽기를 정상화 미토 콘 드리 아 게놈 (그림 3A) 당 ribonucleotides의 수의 양적 측정 HincII 제공을 계산 합니다. 그림 3B에서 볼 수 있듯이 각 ribonucleotide 코 치료 각 가닥의 시퀀스 구성으로 정규화 후 읽기 표시 비율 1, 뚜렷한 ribonucleotide 제안 읽기의 비 무작위 분포를 나타내는 다른 패턴 및 높은 라이브러리 품질입니다. 그 비율은 이전 소화 효소의 분열 특이성을 확인 하는 HincII와의 영향을 받지 않습니다. 얼마나 많은 각 ribonucleotide 1000 보완 기지 ( 당 통합의 양적 측정을 생성 HincII 분열 사이트에서 그 뿐만 아니라 게놈 뉴클레오티드 내용에 포함 된 ribonucleotides의 사이트에서 읽기를 정상화 그림 3C).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56551/56551fig1.jpg"> 
그림 1: DNA 처리 및 라이브러리 준비에 대 한 도식. (1) 전체 게놈 DNA는 죽 습 HincII에 의해 ribonucleotides의 후속 정량에 정규화에 대 한 생성 하는 HincII 사이트 (검은 화살표)에서 무뚝뚝한 끝. (2) DNA 2´, 3´ 끝 및 무료 5´ 오 끝에 3´ 순환 인산 염 (빨간 국방부)로 이어지는 코 ribonucleotide 사이트에서은 하와 함께 처리 됩니다. (3) 5´-오 끝 T4 Polynucleotide 키 니 아 제 3´-인산 가수분해 효소-빼기에 의해 phosphorylated는. (4) 모든 5´ 끝 인산 염 그룹을 들고 T4 RNA 리가 여 ARC140 oligonucleotide를 출혈 됩니다. (5) 두 번째 가닥 T7 DNA 중 합 효소를 사용 하 여 임의의 N6 시퀀스를 포함 하는 ARC76-77 oligonucleotides 합성 됩니다. (6) 도서관은 한 고 충실도 DNA 중 합 효소 ARC49 및 다중화 고유 바코드를 포함 하는 ARC107 인덱스 뇌관을 ARC78 중 하나를 사용 하 여에 의해 증폭 된다. (7) 5´-끝 쌍 간 연속 있습니다. <a href="//ecsource.jove.com/files/ftp_upload/56551/56551fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56551/56551fig2.jpg"> 
그림 2: 유효성 검사 메서드. (A) 대표 electropherograms의 품질을 결정 하는 자동화 된 전기 시스템을 사용 하 여 생성 생성 중 (HS)와 가벼운 물가 (LS) HincII 사이트에서 코 또는 KCl. (B) 요약 신호 처리 라이브러리 인간 mtDNA KCl (왼쪽된 패널) 또는 코 (오른쪽 패널) 치료 후. (C) Circos 무료 5´-끝 (녹색)의 하이든-Seq (무료 5´ 끝 및 ribonucleotides, 마젠타색) HS (왼쪽된 패널)과 LS (오른쪽 패널) 인간 mtDNA에서에서 그림. 봉우리는 백만 읽기 당으로 정규화 하 고 최대 피크 하이든-seq 라이브러리의 읽기의 최대 수를 조정 됩니다. (D) 요약 원시 ribonucleotides (위 패널)와 HincII (하단 패널) 무거운 (H)와 빛 (L) 가닥 인간 mtDNA (미토.) 또는 반전 (RV) 또는 핵 (Nuc.)에서 포워드 (FW) 가닥에서 읽습니다. DNA입니다. 그림 B, C 및 D는 참조12에서 적응. 오차 막대는 뜻의 표준 오류를 나타냅니다. <a href="//ecsource.jove.com/files/ftp_upload/56551/56551fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56551/56551fig3.jpg"> 
그림 3: 대표 결과. (A) 상대 수 코 처리 라이브러리 무거운 (H) 또는 빛 (L) 물가에 대 한 HincII 사이트에서 읽기를 정규화 하는 ribonucleotides입니다. 코에 대 한 mtDNA 게놈에 ribonucleotide 정체성의 (B) 비 (코)를 취급 하 고 HincII 코 취급 (HincII + 코)와 무거운 (H) 또는 mtDNA의 빛 (L) 물가에 라이브러리 죽 습. (C) HincII 및 코 처리 라이브러리 무거운 (H) 또는 mtDNA의 빛 (L) 물가에 대 한 Ribonucleotide 주파수 1000 보완 기지를 정규화. 수치는 참조12에서 적응. 오차 막대는 뜻의 표준 오류를 나타냅니다. <a href="//ecsource.jove.com/files/ftp_upload/56551/56551fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>이름</td>
			<td colspan="4">시퀀스</td>
		</tr>
		<tr>
			<td>ARC49</td>
			<td colspan="4">AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC76</td>
			<td colspan="4">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNN * N * N</td>
		</tr>
		<tr>
			<td>ARC77</td>
			<td colspan="4">AGATCGGAAGAGCACACGTCTGAACTCCAGTC * A * C</td>
		</tr>
		<tr>
			<td>ARC78</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC84</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC85</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC86</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC87</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGA</td></tr></tbody></table>TCT
		
		<tr>
			<td>ARC88</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC89</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC90</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC91</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC93</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC94</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC95</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC96</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTGTTGACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC97</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATACGGAACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC98</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTCTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC99</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCGGGACGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC100</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATGTGCGGACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC101</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCGTTTCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC102</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATAAGGCCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC103</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTCCGAAACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC104</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTACGTACGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC105</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATATCCACTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC106</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATATATCAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC107</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATAAAGGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC140</td>
			<td colspan="4">/ 5AmMC6/ACACTCTTTCCCTACACGACGCTCTTCCGATCT</td>
		</tr>
	

표 1: Oligonucleotides. 하이든이 사용 oligonucleotides 같습니다 대담한 얼굴 색인을 나타냅니다. * phosphorothioate 본드를 나타냅니다. ARC140 C6 링커 함께에서 5´ 오 그룹 대신 5´ 아미노 그룹을 포함 되어 있습니다. 이 수정 결 찰 하는 동안 ARC140 concatemers의 형성을 감소 시킨다.

Watch this Scientific Journal Video about Simultaneous Mapping and Quantitation of Ribonucleotides in Human Mitochondrial DNA at JoVE.com

Simultaneous Mapping and Quantitation of Ribonucleotides in Human Mitochondrial DNA

동시 매핑 및 인간 미토 콘 드리 아 DNA에 Ribonucleotides의 정량

여기 우리는 동시에 quantitate 의무가 메서드와 알칼리 가수분해와 후속 5´-엔드 genomic DNA의 효소 분열을 결합 하 여 단일 뉴클레오티드 해상도 높은 그대로 DNA에 게놈 넓은 지도 ribonucleotides 설명 시퀀싱.

Established approaches to estimate the number of ribonucleotides present in a genome are limited to the quantitation of incorporated ribonucleotides using ...

simultaneous-mapping-quantitation-ribonucleotides-human-mitochondrial

Research

JoVE Journal

Biology

9.4K 조회수.  University of Gothenburg. 여기 우리는 동시에 quantitate 의무가 메서드와 알칼리 가수분해와 후속 5´-엔드 genomic DNA의 효소 분열을 결합 하 여 단일 뉴클레오티드 해상도 높은 그대로 DNA에 게놈 넓은 지도 ribonucleotides 설명 시퀀싱.

비디오: Simultaneous Mapping and Quantitation of Ribonucleotides in Human Mitochondrial DNA

Visualization of Mitochondrial DNA Replication in Individual Cells by EdU Signal Amplification

Mitochondria are key regulators of cellular energy and mitochondrial biogenesis is an essential component of regulating mitochondria numbers in healthy cells1-3. One approach for monitoring mitochondrial biogenesis is to measure the rate of mitochondrial DNA (mtDNA) replication4. We developed a sensitive technique to label newly synthesized mtDNA in individual cells in order to study mtDNA biogenesis. The technique combines the incorporation of 5-ethynyl-2'-deoxyuridine (EdU)5-7 with a tyramide signal amplification (TSA)8 protocol to visualize mtDNA replication within subcellular compartments of neurons. EdU is superior to other thymidine analogs, such as 5-bromo-2-deoxyuridine (BrdU), because the initial click reaction to label EdU5-7 does not require the harsh acid treatments or enzyme digests that are required for exposing the BrdU epitope. The milder labeling of EdU allows for direct comparison of its incorporation with other cellular markers9-10. The ability to visualize and quantify mtDNA biogenesis provides an essential tool for investigating the mechanisms used to regulate mitochondrial biogenesis and would provide insight into the pathogenesis associated with drug toxicity, aging, cancer and neurodegenerative diseases. Our technique is applicable to sensory neurons as well as other cell types. The use of this technique to measure mtDNA biogenesis has significant implications in furthering the understanding of both normal cellular physiology as well as impaired disease states.

We developed a sensitive technique to label newly synthesized mitochondrial DNA (mtDNA) in individual cells in order to study mtDNA biogenesis. The technique combines the incorporation of EdU together with a tyramide signal amplification (TSA) protocol to visualize mtDNA replication within subcellular compartments of neurons.

에듀 신호 증폭 개별 세포 Mitochondrial DNA 복제의 시각화

Mitochondria are key regulators of cellular energy and mitochondrial biogenesis is an essential component of regulating mitochondria numbers in healthy ...

연구

신경과학

Methodology for Accurate Detection of Mitochondrial DNA Methylation

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert unmethylated cytosine into uracil, in a single-stranded DNA context. Bisulfite sequencing can be targeted (using PCR) or performed on the whole genome and provides absolute quantification of cytosine methylation at the single base-resolution. Given the distinct nature of nuclear- and mitochondrial DNA, notably in the secondary structure, adaptions of bisulfite sequencing methods for investigating cytosine methylation in mtDNA should be made. Secondary and tertiary structure of mtDNA can indeed lead to bisulfite sequencing artifacts leading to false-positives due to incomplete denaturation poor access of bisulfite to single-stranded DNA. Here, we describe a protocol using an enzymatic digestion of DNA with BamHI coupled with bioinformatic analysis pipeline to allow accurate quantification of cytosine methylation levels in mtDNA. In addition, we provide guidelines for designing the bisulfite sequencing primers specific to mtDNA, in order to avoid targeting undesirable NUclear MiTochondrial segments (NUMTs) inserted into the nuclear genome.

Here, we present a protocol to allow accurate quantification of mitochondrial DNA (mtDNA) methylation. In this protocol, we describe an enzymatic digestion of DNA with BamHI coupled with a bioinformatic analysis pipeline which can be used to avoid overestimation of mtDNA methylation levels caused by the secondary structure of mtDNA.

미토 콘 드리 아 DNA 메 틸 화의 정확한 탐지를 위한 방법론

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert ...

유전학

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and programmed cell death. Mitochondria produce ATP, regulate the cytoplasmic redox state and Ca2+ balance, catabolize fatty acids, synthesize heme, nucleotides, steroid hormones, amino acids, and help assemble iron-sulfur clusters in proteins. Mitochondria also have an essential role in heat production. Mutations of the mitochondrial genome cause several types of human disorder. The accumulation of mtDNA mutations correlates with aging and is suspected to have an important role in the development of cancer. Due to their vitally important role in all cell types, the function of mitochondria must also be critical for stem cells. Key advances have been made in our understanding of stem cell viability, proliferation, and differentiation capacity. But the functional activity of stem cells, in particular their energy status, was not yet been studied in detail. Almost nothing is known about the mitochondrial properties of human embryonic stem cells (hESCs) and their differentiated precursor progeny. One way to understand and evaluate the role of mitochondria in hESC function and developmental potential is to directly measure the activity of mitochondrial respiratory complexes. Here, we describe high resolution clear native gel electrophoresis and subsequent in gel activity visualization as a method for analyzing the five respiratory chain complexes of hESCs.

In this video, we will show you how the mitochondrial respiratory chain complexes of human embryonic stem cells can be analyzed using in gel activity assays.

인간 배아 줄기 세포에서 Mitochondrial 복잡한 활동에 대한 탐색

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

생물학

Discrimintion and Mapping of the Primary and Processed Transcripts in Maize Mitochondrion Using a Circular RT-PCR-based Strategy

In plant mitochondria, some steady-state transcripts have 5&#39; triphosphate derived from transcription initiation (primary transcripts), while the others contain 5&#39; monophosphate generated post-transcriptionally (processed transcripts). To discriminate between the two types of transcripts, several strategies have been developed, and most of them depend on presence/absence of 5&#39; triphosphate. However, the triphosphate at primary 5&#39; termini is unstable, and it hinders a clear discrimination of the two types of transcripts. To systematically differentiate and map the primary and processed transcripts stably accumulated in maize mitochondrion, we have developed a circular RT-PCR (cRT-PCR)-based strategy by combining cRT-PCR, RNA 5&#39; polyphoshpatase treatment, quantitative RT-PCR (RT-qPCR), and Northern blot. As an improvement, this strategy includes an RNA normalization step to minimize the influence of unstable 5&#39; triphosphate.
In this protocol, the enriched mitochondrial RNA is pre-treated by RNA 5&#39; polyphosphatase, which converts 5&#39; triphsophate to monophosphate. After circularization and reverse transcription, the two cDNAs derived from 5&#39; polyphosphatase-treated and non-treated RNAs are normalized by maize 26S mature rRNA, which has a processed 5&#39; end and is insensitive to 5&#39; polyphosphatase. After normalization, the primary and processed transcripts are discriminated by comparing cRT-PCR and RT-qPCR products obtained from the treated and non-treated RNAs. The transcript termini are determined by cloning and sequencing of the cRT-PCR products, and then verified by Northern blot.
By using this strategy, most steady-state transcripts in maize mitochondrion have been determined. Due to the complicated transcript pattern of some mitochondrial genes, a few steady-state transcripts were not differentiated and/or mapped, though they were detected in a Northern blot. We are not sure whether this strategy is suitable to discriminate and map the steady-state transcripts in other plant mitochondria or in plastids.

We present a circular RT-PCR-based strategy by combining circular RT-PCR, quantitative RT-PCR, RNA 5&#39; polyphosphatase-treatment, and Northern blot. This protocol includes a normalization step to minimize the influence of unstable 5&#39; triphosphate, and it is suitable for discriminating and mapping the primary and processed transcripts stably accumulated in maize mitochondrion.

원형 RT-PCR 기반 전략을 사용하여 옥수수 미토콘드리아의 기본 및 처리된 성적증명서의 차별 및 매핑

In plant mitochondria, some steady-state transcripts have 5&#39; triphosphate derived from transcription initiation (primary transcripts), while the ...

A Rapid High-throughput Method for Mapping Ribonucleoproteins (RNPs) on Human pre-mRNA

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding location often influences function of a splicing factor.  However, as with any sampling strategy the chance of identifying an RNA bound to a splicing factor is proportional to its cellular abundance.  We have developed a novel in vitro approach for surveying binding specificity on otherwise transient pre-mRNA. This approach utilizes a specifically designed oligonucleotide pool that tiles across introns, exons, splice junctions, or other pre-mRNA.  The pool is subjected to some kind of molecular selection. Here, we demonstrate the method by separating the oligonucleotide into a bound and unbound fraction and utilize a two color array strategy to record the enrichment of each oligonucleotide in the bound fraction. The array data generates high-resolution maps with the ability to identify sequence-specific and structural determinates of ribonucleoprotein (RNP) binding on pre-mRNA.  A unique advantage to this method is its ability to avoid the sampling bias towards mRNA associated with current IP and SELEX techniques, as the pool is specifically designed and synthesized from pre-mRNA sequence. The flexibility of the oligonucleotide pool is another advantage since the experimenter chooses which regions to study and tile across, tailoring the pool to their individual needs.  Using this technique, one can assay the effects of polymorphisms or mutations on binding on a large scale or clone the library into a functional splicing reporter and identify oligonucleotides that are enriched in the included fraction.  This novel in vitro high-resolution mapping scheme provides a unique way to study RNP interactions with transient pre-mRNA species, whose low abundance makes them difficult to study with current in vivo techniques.  



A Rapid High-throughput Method for Mapping Ribonucleoproteins RNPs on Human pre-mRNA

Due to the transient nature of pre-mRNA, it can be difficult to isolate and study in vivo. Here, we present a novel in vitro approach to investigate RNA-protein interactions using a synthetic oligo pool that tiles across selected regions of pre-mRNA.

인간 사전 mRNA에 매핑 Ribonucleoproteins에 대한 신속한 하이 스루풋 방법 (RNPs)

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation 

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

기형 종의 형성에 의해 인간 배아 줄기 세포의 운명 매핑

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three ...

mtDNA의 합성 및 분포에 대한 고처리량 정량화

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells produce most of their ATP in the mitochondria by oxidative phosphorylation. Mitochondria are unique organelles because they have their own genome that is replicated and passed on to the next generation of cells. In contrast to the nuclear genome, there are multiple copies of the mitochondrial genome in the cell. The detailed study of the mechanisms responsible for the replication, repair, and maintenance of the mitochondrial genome is essential for understanding the proper functioning of mitochondria and whole cells under both normal and disease conditions. Here, a method that allows the high-throughput quantification of the synthesis and distribution of mitochondrial DNA (mtDNA) in human cells cultured in vitro is presented. This approach is based on the immunofluorescence detection of actively synthesized DNA molecules labeled by 5-bromo-2'-deoxyuridine (BrdU) incorporation and the concurrent detection of all the mtDNA molecules with anti-DNA antibodies. Additionally, the mitochondria are visualized with specific dyes or antibodies. The culturing of cells in a multi-well format and the utilization of an automated fluorescence microscope make it easier to study the dynamics of mtDNA and the morphology of mitochondria under a variety of experimental conditions in a relatively short time.

저자 스포트라이트: 미토콘드리아 DNA 합성 및 분포의 고처리량 이미지 기반 정량화  

A procedure for studying the dynamics of mitochondrial DNA (mtDNA) metabolism in cells using a multi-well plate format and automated immunofluorescence imaging to detect and quantify mtDNA synthesis and distribution is described. This can be further used to investigate the effects of various inhibitors, cellular stresses, and gene silencing on mtDNA metabolism.

미토콘드리아 DNA 합성 및 분포의 고처리량 이미지 기반 정량화

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells ...

생화학

Simultaneous Measurement of Mitochondrial Calcium and Mitochondrial Membrane Potential in Live Cells by Fluorescent Microscopy

Apart from their essential role in generating ATP, mitochondria also act as local calcium (Ca2+) buffers to tightly regulate intracellular Ca2+ concentration. To do this, mitochondria utilize the electrochemical potential across their inner membrane (&#916;&#936;m) to sequester Ca2+. The influx of Ca2+ into the mitochondria stimulates three rate-limiting dehydrogenases of the citric acid cycle, increasing electron transfer through the oxidative phosphorylation (OXPHOS) complexes. This stimulation maintains &#916;&#936;m, which is temporarily dissipated as the positive calcium ions cross the mitochondrial inner membrane into the mitochondrial matrix.
We describe here a method for simultaneously measuring mitochondria Ca2+ uptake and &#916;&#936;m in live cells using confocal microscopy. By permeabilizing the cells, mitochondrial Ca2+ can be measured using the fluorescent Ca2+ indicator Fluo-4, AM, with measurement of &#916;&#936;m using the fluorescent dye tetramethylrhodamine, methyl ester, perchlorate (TMRM). The benefit of this system is that there is very little spectral overlap between the fluorescent dyes, allowing accurate measurement of mitochondrial Ca2+ and &#916;&#936;m simultaneously. Using the sequential addition of Ca2+ aliquots, mitochondrial Ca2+ uptake can be monitored, and the concentration at which Ca2+ induces mitochondrial membrane permeability transition and the loss of &#916;&#936;m determined.

Mitochondria can utilize the electrochemical potential across their inner membrane (&#916;&#936;m) to sequester calcium (Ca2+), allowing them to shape cytosolic Ca2+ signaling within the cell. We describe a method for simultaneously measuring mitochondria Ca2+ uptake and &#916;&#936;m in live cells using fluorescent dyes and confocal microscopy.

동시 매핑 및 인간 미토 콘 드리 아 DNA에 Ribonucleotides의 정량

요약

더 많은 비디오 탐색

에듀 신호 증폭 개별 세포 Mitochondrial DNA 복제의 시각화

미토 콘 드리 아 DNA 메 틸 화의 정확한 탐지를 위한 방법론

인간 배아 줄기 세포에서 Mitochondrial 복잡한 활동에 대한 탐색

원형 RT-PCR 기반 전략을 사용하여 옥수수 미토콘드리아의 기본 및 처리된 성적증명서의 차별 및 매핑

인간 사전 mRNA에 매핑 Ribonucleoproteins에 대한 신속한 하이 스루풋 방법 (RNPs)

기형 종의 형성에 의해 인간 배아 줄기 세포의 운명 매핑

미토콘드리아 DNA 합성 및 분포의 고처리량 이미지 기반 정량화

미토콘드리아 DNA 합성 및 분포의 고처리량 이미지 기반 정량화

미토콘드리아 DNA 합성 및 분포의 고처리량 이미지 기반 정량화

형광 현미경으로 살아있는 세포의 잠재적 인 미토콘드리아의 칼슘과 미토콘드리아 막의 동시 측정