Este estudo foi suportado pelo Conselho de pesquisa Sueco (www.vr.se) concede ao arco (2014-6466 e a Fundação sueca para a investigação estratégica (www.stratresearch.se) ao arco (ICA14-0060). Chalmers University of Technology prestou apoio financeiro à MKME durante este trabalho. Os financiadores não tinham qualquer papel no projeto de estudo, coleta de dados e análise, a decisão de publicar ou preparação do manuscrito.

este protocolo é descrito na Figura 1 e inclui o isolamento de gDNA, digestão com enzimas de restrição para ser capaz de quantificar o número de ribonucleotídeos, tratamento com álcali para hidrolisar as ligações fosfodiéster de ribonucleotídeos incorporada a gDNA, fosforilação das extremidades livre 5´-OH, ssDNA ligadura dos adaptadores, segunda vertente de síntese e amplificação por PCR antes sequenciamento.
 1. índice de Primers e adaptadores <ol><li>ARC49 obter, ARC140 oligonucleotides, ARC76/77, adaptador e ARC78-ARC107 as primeiras demão índice (ver tabela 1). 
	Nota: Oligonucleotides devem ser purificado de HPLC. ARC76/77 são ordenados como duplex.</li>
	<li>Preparar 100 µM as soluções de cada oligonucleotide em tampão Tris-EDTA (TE) (consulte a Tabela de materiais) e armazenar a -20 ° C.</li>
	Soluções de <li>soluções de preparar 10 µM de ARC67/77 e 2 µM de primers ARC49 e índice diluindo em tampão de eluição (EB; consulte a Tabela de materiais). Loja a-20 ° C.</li>
</ol> 2. Crescimento e colheita de células <ol><li>células HeLa crescer em 70 mL Dulbecco &#39; s Modified Eagle Medium (DMEM) suplementado com 10% de soro bovino fetal em um balão de 250 mL Spinner em 37 ° C.</li>
	<li>Contar o número de células e coletar 5 x 10 6 células em um tubo de 50 mL, centrifugar por 5 min a 200 x g e descartar o sobrenadante.</li>
	<li>Lavar as células com 20 mL 1X PBS, centrifugar por 5 min a 200 x g e descartar o sobrenadante.</li>
	<li>Congelar as bolinhas a-20 ° C ou continuar com a purificação de DNA.</li>
</ol> 3. Purificação de DNA e quantificação <ol><li>purificar gDNA usando extração fenol-clorofórmio, conforme descrito abaixo.
	<ol><li>Ressuspender as células em 2 mL de tampão de lise (consulte a Tabela de materiais) e incube por 30 min a 42 ° C em um bloco de aquecimento. 
		Cuidado: Lise contém componentes perigosos. Solução de SDS é irritante, Proteinase K é tóxico, irritante e sensibilização. Use roupas protetoras e luvas.</li>
		<li>Dividir a amostra em dois tubos de 2 mL e adicionar 1 volume (V) de álcool isoamílico-fenol-clorofórmio (25:24:1). 
		Cuidado: O álcool isoamílico-fenol-clorofórmio é tóxicos, mutagênicos, corrosivos e perigosos para ambientes aquáticos. Use em uma coifa, usar roupas protetoras e luvas e descarte de resíduos especiais de fenol-clorofórmio.</li>
		<li>Mix por inversão para 30-60 s e centrifugar durante 5 min à 15.000 x g à temperatura ambiente. 
		Nota: Fazer não vórtice DNA para evitar a introdução de quebras aleatórias, que iria distorcer os resultados.</li>
		<li>Transferir a fase aquosa, superior para um novo tubo de 2 mL e adicionar 1 V de álcool isoamílico-fenol-clorofórmio (25:24:1).</li>
		<li>Mix por inversão e centrifugar durante 5 min à 15.000 x g a 4 ° C.</li>
		<li>Transferir a fase aquosa, superior para um novo 2 mL tubo e adicionar 20 µ l NaCl (5 M) e 1 V de isopropanol frio. 
		Atenção: O Isopropanol é inflamável, irritante e tóxico. Armazená-lo em um gabinete ventilado, usar roupas protetoras e luvas e mantê-lo afastado de chamas.</li>
		<li>Mix por inversão e incubar durante pelo menos 1 h a -20 ° C.</li>
		<li>Centrífuga por 20 min em 15.000 x g, 4 ° C e descartar sobrenadante.</li>
		<li>Pellet de DNA de lavagem com 200 µ l 70% álcool etílico frio, centrifugar por 20 min a 15.000 x g a 4 ° C e descartar o sobrenadante. 
		Atenção: 70% de etanol é inflamável e irritante. Manter a solução de trabalho em-20 ° C, caso contrário loja no armário ventilado, roupas protetoras e luvas e mantê-lo afastado de chamas.</li>
		<li>Secar o sedimento de DNA à temperatura de 20-25 min.</li>
		<li>Pelotas de DNA dissolver em 100 µ l de TE do buffer e as amostras em um tubo do pool.</li>
	</ol></li> <li>Concentração de DNA dosar usando um reagente de quantificação de dsDNA de acordo com o fabricante &#39; s especificações (ver a Tabela de materiais). 
	Nota: Usar um reagente de quantificação de dsDNA, como quantificação espectrofotométrica do DNA pode ser afectada por fenol residual.</li>
	<li>DNA loja a-20 ° C ou continuar com o tratamento de HincII.</li>
</ol> 4. Hidrólise alcalina e tratamento de HincII <ol><li>Digest 1 µ g de DNA em uma reação de mistura contendo 5 µ l 10x buffer 3.1, 1 µ l (10 U) HincII e livre de nuclease H 2 O, até um volume final de 50 µ l. 
	Nota: Para conseguir condições óptimas para ligadura, segunda vertente de síntese e amplificação por PCR, pode ser necessário aumentar a quantidade de DNA de entrada se espera-se que o ADN contém um número muito baixo de ribonucleotídeos. Da mesma forma, pode ser necessário diminuir a entrada de DNA se o número de ribonucleotídeos é muito alto.</li>
	<li>Incubar durante 30 min a 37 ° C.</li>
	<li>HincII purificar tratados DNA com grânulos paramagnéticos. 
	Nota: Mantenha o tubo tampas abrir nas etapas a seguir para não perturbar pelotas abrindo os tubos.
	<ol><li>Adicionar 1,8 V de grânulos paramagnéticos para cada amostra, misturar cuidadosamente pipetando e incubar à temperatura ambiente durante 10 min.</li>
		<li>Usar um rack magnético para granular os grânulos por 5 min, em seguida, remover e descartar o sobrenadante.</li>
		<li>Lavar a pelota com 150 µ l de etanol 70% (temperatura ambiente) para cerca de 30 s em seguida, remover e descartar o sobrenadante.</li>
		<li>Lavagem a pelota com 200 µ l de etanol 70% (temperatura ambiente) por cerca de 30 s, então, remover e descartar o sobrenadante. 
		Nota: Etanol Residual pode ser removido com uma pipeta de 10 µ l. As gotas podem ser giradas para baixo brevemente antes.</li>
		<li>Secar as amostras em temperatura ambiente por cerca de 15-20 min. 
		Nota: O tempo exato depende do volume dos grânulos e a forma da pelota, portanto, as pastilhas devem ser verificadas visualmente.</li>
		<li>Remover tubos de rack magnético e eluir a pelota em µ l 45 EB, mistura pipetando cuidadosamente.</li>
		<li>Incubar por 5 min então granular os grânulos no rack magnético e use 45 µ l de DNA purificado na etapa 4.4.</li>
	</ol></li> <li>Adicionar 5 µ l de KOH (3 M) ou KCl (3 M) com o DNA criando um volume total de 50 µ l. 
	Cuidado: solução de KOH M 3 é corrosivo. Use roupas protetoras e luvas.</li>
	Forno de <li>incubar durante 2 h a 55 ° C em uma hibridação seguido por 5 min no gelo 
	Nota: Recomenda-se realizar o tratamento de KOH em um forno, ao invés de um bloco de aquecimento para manter um aquecimento uniforme do tubo e impedir a condensação na tampa.</li>
	<li>DNA precipitado pela adição de acetato de sódio 10 µ l (3 M, pH = 5,2) e 125 µ l 100% álcool etílico frio. Incubar no gelo por 5 min. 
	Atenção: 100% de etanol é inflamável e irritante. Armazenar em um gabinete ventilado, usar roupas protetoras e luvas e manter afastado de chamas.</li>
	<li>GDNA de pelotas por centrifugação a 21.000 x g, 4 ° C por 5 min e descartar o sobrenadante.</li>
	<li>Lavagem DNA pelota com 250 µ l frio 70% EtOH, centrifugar a 21.000 x g, 4 ° C por 5 min e descartar o sobrenadante. 
	Nota: Para remover as gotas, o tubo pode ser girado para baixo, brevemente novamente e sobrenadante pode ser removido com uma pipeta de 10 µ l.</li>
	<li>Deixar o sedimento secar em um tubo aberto por cerca de 5-10 min até visível todo o líquido tenha evaporado.</li>
	<li>DNA deixa pelota dissolvê-los em 20 µ l EB por 30 min à temperatura ambiente.</li>
</ol> 5. 5´ final fosforilação <ol><li>preparar a mistura de reação para cada amostra antecipadamente contrasome de 2,5 µ l 10 x T4 amortecedor da reação da quinase polinucleotídicas, 1 µ l (10 U) 3´-fosfatase-menos T4 polinucleotídicas da quinase e 2,5 µ l ATP (10 mM).</li>
	<li>Transferência 19 µ l de cada DNA para um novo tubo de 200 µ l da amostra e desnaturar por 3 min a 85 ° C em um thermo-cycler.</li>
	<li>Cool DNA amostras no gelo e adicione 6 µ l da mistura de reação para cada amostra.</li>
	<li>Mistura de reação de incubar a 37 ° C por 30 min e parar a reação incubando-se as amostras a 65 ° C por 20 min.</li>
	<li>Purificar DNA como descrito no ponto 4.3, usando 1.8 V dos grânulos paramagnéticos mas eluir em µ l 14 EB.</li>
</ol> 6. ssDNA ligadura <ol><li>preparar a mistura de reação para cada amostra antecipadamente consistindo de 0.5 µ l ATP (2 mM), 5 µ l 10 x amortecedor da reação do RNA T4 ligase, 5 µ l CoCl 3 (NH 3) 6 (10 mM), 0,5 µ l ARC140 (100 µM) e 25% de 50 µ l PEG 8000. Mistura bem pipetando. 
	Atenção: CoCl 3 (NH 3) 6 é cancerígeno, sensibilização e perigosas para o ambiente aquático. Use roupas protetoras e luvas.</li>
	<li>Transferência 13 µ l de DNA purificado de passo 5.5 para um novo tubo de 200 µ l e desnaturar por 3 min a 85 ° C em um thermo-cycler.</li>
	<li>Legal o DNA no gelo e adicione 36 µ l da mistura de reação para cada amostra, misturar pipetando spin para baixo brevemente.</li>
	<li>Adicionar 1 µ l (10 U) de T4 Ligase de RNA para cada reação, misturar pipetando e spin para baixo brevemente.</li>
	<li>Incubar as amostras à temperatura ambiente na noite escura.</li>
</ol> 7. Síntese segundo-Costa <ol><li>Purify ligado DNA, conforme descrito no ponto 4.3, mas usar 0,8 V de grânulos paramagnéticos, granular os grânulos por 10 min e eluir em 20 µ l EB. 
	Nota: Devido à maior viscosidade da mistura de reação da ligadura, a primeira etapa de granulação é prolongada.</li>
	<li>Transferência de 20 µ l de amostra de DNA para um novo tubo de PCR de 200 µ l. Repita a etapa de purificação usando 0.8 V de grânulos paramagnéticos seguindo o fabricante &#39; s especificações e eluir em µ l 14 EB.</li>
	<li>Preparar a mistura de reação para cada amostra antecipadamente consistindo de 2 µ l de 10 x T7 DNA polimerase amortecedor da reação, 2 µ l ARC76/77 (2 µM), 2 µ l dNTPs (2 mM) e 0,8 µ l BSA (1 mg/mL).</li>
	<li>µ L 12,8 transferir purificado DNA para um novo tubo de 200 µ l, desnaturar por 3 min a 85 ° C em um thermo-cycler.</li>
	<li>Legal o DNA no gelo e adicionar 6,8 µ l da mistura de reação de cada amostra, misturar pipetando, spin para baixo rapidamente e incubar durante 5 min à temperatura ambiente.</li>
	<li>Adicionar 0,4 µ l (4 U) T7 DNA polimerase para cada reação e incubar durante 5 min à temperatura ambiente.</li>
	<li>Purificar DNA como descrito no ponto 4.3, usando 0.8 V de grânulos paramagnéticos e eluir em 11 µ l EB.</li>
</ol> 8. Amplificação por PCR e quantificação da biblioteca tubo de <ol><li>Prepare a mistura de reação para cada amostra em um novo 200 µ l antecipadamente consistindo de 7,5 µ l ARC49 (2 µM), primeira demão de índice 7,5 µ l (2 µM, exclusivo para cada amostra) e 25 µ l 2 x começo quente mistura pronta.</li>
	<li>Adicionar 10 µ l de amostra de DNA para cada reação. Amplificar a biblioteca usando as seguintes condições: desnaturar a 95 ° C por 45 s, seguido de 18 ciclos de 98 ° C por 15 s, 65 ° C por 30 s, 72 ° C por 30 s, terminando com um alongamento final a 72 ° C para amostras de espera de 2 min. a 4 ° C após amplificação.</li>
	<li>Purificar bibliotecas conforme descrito no ponto 4.3, usando 0.8 V de grânulos paramagnéticos e eluir no buffer de TE 20 µ l.</li>
	<li>Dosar bibliotecas usando um reagente de quantificação de dsDNA, de acordo com o fabricante &#39; s especificações (ver a Tabela de materiais).</li>
	<li>Armazenar amostras a-20 º C ou continuar com a análise de biblioteca.</li>
</ol> 9. Análise de biblioteca e de <ol><li>determinar a qualidade de cada biblioteca e estimar o tamanho do fragmento média usando um sistema de eletroforese digital. 
	Nota: O tamanho do fragmento média é avaliado pela estimativa onde a área sob a curva da electroferograma é reduzido a metade, desconsiderando a picos de marcadores. Resultados representativos dos perfis de biblioteca apropriada após tratamento KOH ou KCl são dadas na Figura 2A.</li>
	<li>Calcular a concentração (nM) das bibliotecas como: 
	/(p*650) (c/10 3)] * 10 9 onde c é a concentração da biblioteca em ng / µ l e p é o tamanho do fragmento média na bp, como estimado em 9.1.</li>
	<li>Piscina molares quantidades iguais de até 24 bibliotecas amplificadas com primers de índice diferente para sequenciamento. Adicionar tampão TE para um volume final de 25 µ l e concentração de 10 nM. 
	Nota: Dependendo do número de bibliotecas seja agrupado, é ajustar a quantidade de DNA de cada biblioteca. Se dímeros cartilha foram detectados na etapa 9.1 como um distinto pico de cerca de 130 bp, o volume final da biblioteca piscina pode exceder 25 µ l, porque a etapa de purificação é repetida, conforme descrito no ponto 4.3, usando 0.8 V de grânulos paramagnéticos, e DNA é eluída em 25 µ l TE buf Fer.
	<ol><li>Determinar a concentração de piscina nova biblioteca usando um reagente de quantificação de dsDNA de acordo com o fabricante &#39; s especificações e a média de pico tamanho conforme descrito acima. Prossiga para sequenciamento e análise de dados (capítulo 10 e 11).</li>
	</ol></li></ol> 10. Sequenciamento de <ol><li>realizar 75-base emparelhado-final sequenciamento em bibliotecas em pool 12.</li></ol>
 11. análise de dados <ol><li>Trim todas as leituras para remover sequências de adaptador, filtro para qualidade e leia o comprimento. 
	Nota: Isto pode ser feito usando cutadapt 1.2.1 20 com o comando ' cutadapt -f fastq - jogo-leitura-curingas - silêncio - 15 m - q 10 - um NNNNNNN &#60; arquivo &#62;', onde NNNNNNN é substituído com a sequência de adaptador real e &#60; arquivo &#62; é substituído com o nome do arquivo fastq.</li>
	<li>Remover companheiros de leituras que foram descartados no passo anterior usando scripts personalizados.</li>
	<li>Pares de alinhar o companheiro 1 do restante a um índice que contém a sequência de todos os oligonucleotídeos utilizados para a preparação de biblioteca (por exemplo, usando Bowtie 0.12.8 21 e a linha de comando opções - m1-v2). Elimine todos os pares com alinhamentos bem sucedidos.</li>
	<li>Alinhar pares restantes para o genoma de referência de organismo usando gravata borboleta com a linha de comando opções - v2 -X 10000..--melhor.</li>
	<li>Mapa lê esse intervalo entre a molécula mitocondrial começo e fim, alinhando 1 companheiro de todos os pares desalinhados (usando gravata borboleta com a linha de comando opções - v2).</li>
	<li>Determinar a contagem de fins-de-5´ para todos os alinhamentos de fim único e emparelhados. Mude a posição destes por um base montante para a posição onde estavam os hidrolisado ribonucleotídeos.</li>
	<li>Dados de exportação do arquivo bowtie formato em um formato de arquivo de bedgraph usando scripts personalizados para visualização em comum navegadores do genoma. Normalizar as leituras para cada vertente de leituras por milhões.</li>
	<li>Usando a posição e contagens do arquivo bedgraph, referência a sequência genômica do organismo, para determinar a identidade do incorpditado ribonucleotídeos. 
	Nota: Para o genoma mitocondrial humano lê das regiões 16.200-300 e 5.747-5.847 para cada vertente deve ser excluído desde que estas regiões contêm muitos 5´-extremidades livres, não relacionados à incorporação ribonucleótido pela DNA polimerase γ.</li>
	<li>Dividir o lê total, não incluindo leituras dos onze locais de HincII, com o número médio de leituras por HincII site para obter o número de ribonucleotídeos por intervalo único filamento, (ou seja, o número de ribonucleotídeos por molécula mitocondrial).</li>
</ol>

<ol>
	<li>Traut, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+Concentrations+of+Purines+and+Pyrimidines.">Physiological Concentrations of Purines and Pyrimidines.</a> Mol. Cell. Biochem. 140, 1-22 (1994).</li><li>McElhinny, S. A. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abundant+ribonucleotide+incorporation+into+DNA+by+yeast+replicative+polymerases.">Abundant ribonucleotide incorporation into DNA by yeast replicative polymerases.</a> Proc. Natl. Acad. Sci. USA. 107, 4949-4954 (2010).</li><li>Williams, J. S., Lujan, S. A., Kunkel, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Processing+ribonucleotides+incorporated+during+eukaryotic+DNA+replication.">Processing ribonucleotides incorporated during eukaryotic DNA replication.</a> Nat. Rev. Mol. Cell Biol. 17, 350-363 (2016).</li><li>Clausen, A. R., Zhang, S., Burgers, P. M., Lee, M. Y., Kunkel, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribonucleotide+incorporation,+proofreading+and+bypass+by+human+DNA+polymerase+delta.">Ribonucleotide incorporation, proofreading and bypass by human DNA polymerase delta.</a> DNA Repair. 12, 121-127 (2013).</li><li>Potenski, C. J., Klein, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+the+misincorporation+of+ribonucleotides+into+genomic+DNA+can+be+both+harmful+and+helpful+to+cells.">How the misincorporation of ribonucleotides into genomic DNA can be both harmful and helpful to cells.</a> Nucleic Acids Res. 42, 10226 (2014).</li><li>Vengrova, S., Dalgaard, J. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase-sensitive+DNA+modification(s)+initiates+S.+pombe+mating-type+switching.">RNase-sensitive DNA modification(s) initiates S. pombe mating-type switching.</a> Gene. Dev. 18, 794-804 (2004).</li><li>Lujan, S. A., Williams, J. S., Clausen, A. R., Clark, A. B., Kunkel, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribonucleotides+Are+Signals+for+Mismatch+Repair+of+Leading-Strand+Replication+Errors.">Ribonucleotides Are Signals for Mismatch Repair of Leading-Strand Replication Errors.</a> Mol. Cell. 50, 437-443 (2013).</li><li>Ghodgaonkar, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribonucleotides+Misincorporated+into+DNA+Act+as+Strand-Discrimination+Signals+in+Eukaryotic+Mismatch+Repair.">Ribonucleotides Misincorporated into DNA Act as Strand-Discrimination Signals in Eukaryotic Mismatch Repair.</a> Mol. Cell. 50, 323-332 (2013).</li><li>DeRose, E. F., Perera, L., Murray, M. S., Kunkel, T. A., London, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+Structure+of+the+Dickerson+DNA+Dodecamer+Containing+a+Single+Ribonucleotide.">Solution Structure of the Dickerson DNA Dodecamer Containing a Single Ribonucleotide.</a> Biochemistry. 51, 2407-2416 (2012).</li><li>Li, Y. F., Breaker, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+RNA+degradation+by+specific+base+catalysis+of+transesterification+involving+the+2+'-hydroxyl+group.">Kinetics of RNA degradation by specific base catalysis of transesterification involving the 2 '-hydroxyl group.</a> J. Am. Chem. Soc. 121, 5364-5372 (1999).</li><li>McElhinny, S. A. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+instability+due+to+ribonucleotide+incorporation+into+DNA.">Genome instability due to ribonucleotide incorporation into DNA.</a> Nat. Chem. Biol. 6, 774-781 (2010).</li><li>Berglund, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+pools+dictate+the+identity+and+frequency+of+ribonucleotide+incorporation+in+mitochondrial+DNA.">Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA.</a> Plos Genet. 13, (2017).</li><li>Brown, J. A., Suo, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unlocking+the+Sugar+"Steric+Gate"+of+DNA+Polymerases.">Unlocking the Sugar "Steric Gate" of DNA Polymerases.</a> Biochemistry. 50, 1135-1142 (2011).</li><li>Sparks, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+H2-Initiated+Ribonucleotide+Excision+Repair.">RNase H2-Initiated Ribonucleotide Excision Repair.</a> Mol. Cell. 47, 980-986 (2012).</li><li>Miyabe, I., Kunkel, T. A., Carr, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Major+Roles+of+DNA+Polymerases+Epsilon+and+Delta+at+the+Eukaryotic+Replication+Fork+Are+Evolutionarily+Conserved.">The Major Roles of DNA Polymerases Epsilon and Delta at the Eukaryotic Replication Fork Are Evolutionarily Conserved.</a> Plos Genet. 7, (2011).</li><li>Clausen, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+replication+enzymology+in+vivo+by+genome-wide+mapping+of+ribonucleotide+incorporation.">Tracking replication enzymology in vivo by genome-wide mapping of ribonucleotide incorporation.</a> Nat. Struct. Mol. Biol. 22, 185-191 (2015).</li><li>Koh, K. D., Balachander, S., Hesselberth, J. R., Storici, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribose-seq:+global+mapping+of+ribonucleotides+embedded+in+genomic+DNA.">Ribose-seq: global mapping of ribonucleotides embedded in genomic DNA.</a> Nat. Methods. 12, 251 (2015).</li><li>Keszthelyi, A., Daigaku, Y., Ptasinska, K., Miyabe, I., Carr, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+ribonucleotides+in+genomic+DNA+and+exploring+replication+dynamics+by+polymerase+usage+sequencing+(Pu-seq).">Mapping ribonucleotides in genomic DNA and exploring replication dynamics by polymerase usage sequencing (Pu-seq).</a> Nat. Protoc. 10, 1786-1801 (2015).</li><li>Ding, J., Taylor, M. S., Jackson, A. P., Reijns, M. A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+embedded+ribonucleotides+and+other+noncanonical+nucleotides+using+emRiboSeq+and+EndoSeq.">Genome-wide mapping of embedded ribonucleotides and other noncanonical nucleotides using emRiboSeq and EndoSeq.</a> Nat. Protoc. 10, 1433-1444 (2015).</li><li>Martin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutadapt+removes+adapter+sequences+from+high-throughput+sequencing+reads.">Cutadapt removes adapter sequences from high-throughput sequencing reads.</a> EMBnet.journal. 17, 10-12 (2011).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10, (2009).</li></ol>

Os autores declaram que eles têm não tem interesses financeiro concorrente.

Aqui apresentamos uma técnica para mapear e quantificar ribonucleotídeos em gDNA e DNA mitocondrial, em particular, pela simples introdução de clivagem de DNA em locais específicos de sequência no genoma como um complemento para o protocolo de HydEn-seq estabelecido simultaneamente. Enquanto este estudo centra-se no DNA mitocondrial humano, originalmente, o método de HydEn-seq foi desenvolvido em Saccharomyces cerevisiae, ilustrando a tradução do método para outros organismos12,16.
Para confiáveis resultados obtidos com esta abordagem, devem notar-se alguns passos importantes: (A) desde que adaptadores de sequenciamento ligam para todos os fins-de-5´ disponíveis, é fundamental trabalhar com DNA altamente intacta. DNA deve ser isolado e bibliotecas devem ser feitas de preferência imediatamente após o isolamento do DNA, ou o DNA pode ser armazenado a-20 ° C. Não é recomendável armazenar DNA na geladeira por muito tempo ou para congelar e descongelar repetidamente. (B) para gerar bibliotecas adequadas com este método, é crucial realizar o tratamento de KOH do DNA em um forno de incubação, ao invés de um bloco de aquecimento, garantindo o aquecimento homogêneo da amostra inteira e hidrólise quantitativa. (C) Além disso, é fundamental para controlar a qualidade das bibliotecas antes de pool e sequenciamento. O DNA devem ser quantificadas e analisadas usando um sistema automatizado de eletroforese para assegurar quantidades adequadas de biblioteca de DNA, confirmar tamanhos apropriados do fragmento e verifique dímeros da primeira demão.
Para uma análise de dados significativos, também é importante notar que o valor informativo desse método é dependente de controles apropriados para avaliar fundo contagens e sequência ou vertente de preconceitos. Nós rotineiramente atingir uma eficiência de mapeamento em amostras de KCl de cerca de 70% quando apenas digerindo com a endonuclease específica sequência (Figura 2B, painéis à esquerda). Além disso, é importante confirmar que o tratamento de endonuclease não está afetando o total detecção de ribonucleotídeos incorporados, comparando HincII tratada e não tratada amostras (Figura 3B). Nesses experimentos, usamos HincII apresentar cortes de local específico, embora outras enzimas de restrição de alta-fidelidade também poderia ser usadas.
O protocolo pode ser adaptado estudar outros tipos de lesões do ADN que podem ser processados para 5´-fosfato ou 5´-OH termina. A precisão dos resultados depende da especificidade do processamento e requer controles adequados (por exemplo, o tipo selvagem ou não tratada) para verificação. Além disso, quando adaptar esse método para outros aplicativos ou para uso com outros organismos, deve-se considerar que o método em sua configuração atual requer cerca de 1 µ g de DNA que é processado em uma biblioteca. Desde que o número de extremidades é dependente do número de ribonucleotídeos incorporados, que varia de acordo com o organismo ou mutante, amostras, incluindo um número menor de ribonucleotídeos exigiria mais entrada de DNA para gerar um número suficiente de extremidades na construção de biblioteca subsequentes. Da mesma forma, se as amostras de DNA têm um número muito maior de ribonucleotídeos, também exigiria usando menos entrada de DNA para obter condições óptimas para ligadura, segunda vertente de síntese e amplificação por PCR. Vale ressaltar que a construção de biblioteca, conforme descrito neste protocolo também gerou dados cobrindo o genoma nuclear (conforme exibido na Figura 2D) e somente a análise de dados centrou-se no DNA mitocondrial. Isso ilustra que genomas maiores com frequências ribonucleótido moderadamente baixas também são capturadas por esse método.
Ao considerar este método, certas limitações devem ser consideradas: embora este método deve, em teoria, ser aplicável a virtualmente qualquer organismo, um genoma de referência adequada é necessário para o alinhamento de leituras. Além disso, os resultados obtidos do nosso protocolo representam as leituras de um grande número de células. Padrões de incorporação ribonucleótido específicas de um subconjunto de células não podem ser identificados por esta abordagem. Se ribonucleotídeos são mapeados em genomas maiores com um número muito baixo de ribonucleotídeos, pode ser um desafio para discriminar ribonucleotídeos de nicks aleatórios e controlos adequados, portanto, são necessários.
O método que descrevemos aqui, estende as técnicas disponíveis na vivo como HydEn-Seq16, Ribose-Seq17, Pu-Seq18ou emRiboSeq19. Essas abordagens aproveitar-se da sensibilidade dos ribonucleotídeos incorporado à alcalina ou tratamento de RNase H2, respectivamente, empregando sequenciamento de próxima geração para identificar ribonucleotídeos todo o genoma, que permite o mapeamento e comparação de incorporação de relativa. Por fendendo a sequência do DNA, especificamente, como descrito acima, além de hidrólise alcalina a ribonucleotídeos incorporados, o lê para ribonucleotídeos pode ser normalizado para esses sites de clivagem, que permite não só a identificação e o mapeamento de ribonucleotídeos, mas também sua quantificação para cada molécula de DNA. A aplicação da nossa técnica no contexto das doenças relacionadas com a replicação do DNA, reparo do DNA e TLS poderia fornecer uma compreensão mais profunda do papel de ribonucleotídeos no subjacente mecanismos moleculares e a integridade do genoma em geral.

Em uma célula eucariótica, a concentração de ribonucleotídeos (rNTPs) é muito maior do que a concentração de desoxirribonucleicos (dNTPs)1. As polimerases de DNA discriminam ribonucleotídeos, mas esta discriminação não é perfeita e, como consequência, ribonucleotídeos em vez de deoxyribonucleotides podem ser incorporados em genomas durante a replicação do DNA. Ribonucleotídeos podem ser mais comuns não-canônicos nucleotídeos incorporados ao genoma2. A maioria destes ribonucleotídeos é removida durante o amadurecimento de fragmento de Okazaki por reparo de excisão de iniciados ribonucleótido RNase H2 (RER) ou Topoisomerase 1 (revisto em referência3). Ribonucleotídeos que não podem ser removidos ficar estàvel incorporados no DNA2,4 e podem afetá-lo de maneiras prejudiciais e benéficas (revistas em revista5). Além de ser capaz de agir como sinais positivos, por exemplo tipo de acasalamento alternar no Schizosaccharomyces pombe6 e marcando a sequência de DNA nascente durante a incompatibilidade de reparar (MMR)7,8, ribonucleotídeos afetam o estrutura9 e estabilidade do DNA circundante devido ao grupo hidroxila-2´ de seus ribose10, resultando em replicative stress e genoma instabilidade11. A abundância de ribonucleotídeos no DNA genômico (gDNA) e sua relevância na replicação e mecanismos de reparação, bem como as implicações para a estabilidade do genoma, dá razão para investigar a sua exacta ocorrência e a frequência de uma forma de todo o genoma.
Atividade RNase H2 não foi encontrada na mitocôndria humana e ribonucleotídeos são, portanto, não eficientemente removidos no DNA mitocondrial (mtDNA). Diversas vias estão envolvidas no fornecimento de nucleotídeos à mitocôndria humana e para investigar se distúrbios na piscina nucleotídica mitocondrial causam um número elevado de ribonucleotídeos no DNA mitocondrial humano, desenvolvemos um protocolo para mapear e quantificar Esses ribonucleotídeos no DNA mitocondrial humano isolado de fibroblastos, células HeLa e linhas de célula paciente12.
A maioria das abordagens em vitro (revistas em revista13) para determinar a seletividade dos polymerases DNA contra rNTPs baseiam-se único ribonucleótido inserção ou primeira demão extensão experiências onde rNTPs concorrentes estão incluídos na reação mistura, permitindo a identificação ou quantificação relativa de incorporação ribonucleotídeo em breve modelos de DNA. Abordagens quantitativas em sequências curtas podem não refletir piscinas dNTP e rNTP em concentrações celulares e, portanto, fornecer insights sobre seletividade do polymerase, mas são de importância limitada sobre genomas toda. Tem sido demonstrado que a quantidade relativa de ribonucleotídeos incorporado durante a replicação de um modelo de DNA mais longo, como um plasmídeo, pode ser visualizada em um gel de sequenciamento usando radiolabeled dNTPs e hidrólise de DNA em um meio alcalino14. Além disso, foram analisado gDNA sobre os borrões do Sul após hidrólise alcalina, permitindo que a vertente específica de sondagem e determinação das taxas absolutas de ribonucleotídeo incorporação na vivo15. Essas abordagens permitem uma comparação relativa de frequência de incorporação mas não entregam nenhum insight sobre a posição ou a identidade de ribonucleotídeos os incorporado. Abordagens mais recentes para analisar o conteúdo de ribonucleotídeo no gDNA na vivo, como HydEn-Seq16, Ribose-Seq17, Pu-Seq18ou emRiboSeq19, aproveite dos ribonucleotídeos incorporados sensibilidade à alcalina ou tratamento de RNase H2, respectivamente e empregar o sequenciamento de próxima geração para identificar todo o genoma de ribonucleotídeos. Esses métodos não fornecer a introspecção a frequência absoluta de incorporação dos ribonucleotídeos detectados. Adicionando a etapa de clivagem enzimática específica de sequência para o protocolo de HydEn-seq, o método que aqui descrevemos convenientemente estende a informação adquirida com uma abordagem de sequenciamento, permitindo mapeamento simultâneo e quantificação de incorporado ribonucleotídeos12. Este método é aplicável a praticamente qualquer organismo, dado que extratos de DNA altamente intactos podem ser gerados e um genoma de referência adequada está disponível. O método pode ser adaptado para dosar e determinar a localização de qualquer lesão que não pode ser digerida por uma nuclease e deixa um 5´-fosfato ou um fim de 5´-OH.
Para mapear e dosar ribonucleotídeos no DNA genômico, o método combina clivagem por uma endonuclease específica sequência e hidrólise alcalina, gerando 5´-fosfato termina em locais onde se encontra a sequência de reconhecimento específica para a endonuclease e 5´- OH termina em posições onde se localizavam ribonucleotídeos. Desde que as extremidades livres geradas são posteriormente ligadas com adaptadores e sequenciado usando sequenciamento de próxima geração, é de importância usar DNA altamente intacta e evitar a fragmentação aleatória durante a preparação de extração e biblioteca de DNA. Avaliar estas leituras normalizadas para as leituras dos locais de clivagem de endonuclease permite uma quantificação simultânea e mapeamento de ribonucleotídeos os detectado. 5´-extremidades livres são detectados em experimentos de controle onde a hidrólise alcalina de DNA é substituída pelo tratamento com KCl. Os dados adquiridos fornecem a introspecção do ribonucleotídeo localização e quantidade e permite análises em relação a frequência de conteúdos e incorporação de ribonucleotídeo.

<table>
	<tbody>
		<tr>
			<td>10x T4 Polynucleotide Kinase Reaction Buffer</td>
			<td>New England Biolabs</td>
			<td>B0201S</td>
			<td></td>
		</tr>
		<tr>
			<td>10x T4 RNA Ligase Reaction Buffer</td>
			<td>New England Biolabs</td>
			<td>B0216L</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS</td>
			<td>Medicago</td>
			<td>09-9400-100</td>
			<td>dissolve 1 tablet in H2O to a final volume of 1 L</td>
		</tr>
		<tr>
			<td>2-Propanol</td>
			<td>Sigma-Aldrich</td>
			<td>33539-1L-GL-R</td>
			<td></td>
		</tr>
		<tr>
			<td>2100 Bioanalyzer</td>
			<td>Agilent Technologies</td>
			<td>G2940CA</td>
			<td></td>
		</tr>
		<tr>
			<td>50 mL Centrifuge Tube</td>
			<td>VWR</td>
			<td>525-0610</td>
			<td></td>
		</tr>
		<tr>
			<td>Adenosine 5&#39;-Triphosphate (ATP, 10 mM)</td>
			<td>New England Biolabs</td>
			<td>P0756S</td>
			<td>dilute with EB to 2 mM</td>
		</tr>
		<tr>
			<td>Agilent DNA 1000 Kit</td>
			<td>Agilent Technologies</td>
			<td>5067-1504</td>
			<td></td>
		</tr>
		<tr>
			<td>BSA, Molecular Biology Grade (20 mg/mL)</td>
			<td>New England Biolabs</td>
			<td>B9000S</td>
			<td>diltue with nuclease-free H2O to 1 mg/mL</td>
		</tr>
		<tr>
			<td>Buffer EB</td>
			<td>QIAGEN</td>
			<td>19086</td>
			<td>referred to as EB</td>
		</tr>
		<tr>
			<td>CleanPCR paramagnetic beads</td>
			<td>CleanNA</td>
			<td>CPCR-0050</td>
			<td></td>
		</tr>
		<tr>
			<td>Deoxynucleotide (dNTP) Solution Mix (10 mM each)</td>
			<td>New England Biolabs</td>
			<td>N0447L</td>
			<td>dilute with EB to 2 mM</td>
		</tr>
		<tr>
			<td>DMEM, high glucose, GlutaMAX Supplement</td>
			<td>Gibco</td>
			<td>61965026</td>
			<td></td>
		</tr>
		<tr>
			<td>DynaMag 96 Side</td>
			<td>Thermo Fisher</td>
			<td>12331D</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol 99.5% analytical grade</td>
			<td>Solveco</td>
			<td>1395</td>
			<td>dilute with milliQ water to 70%</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid solution (EDTA, 0.5 M)</td>
			<td>Sigma-Aldrich</td>
			<td>03690-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum</td>
			<td>Gibco</td>
			<td>10500056</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES buffer pH 8.0 (1 M) sterile BC</td>
			<td>AppliChem</td>
			<td>A6906,0125</td>
			<td></td>
		</tr>
		<tr>
			<td>Hexammine cobalt(III) chloride (CoCl3(NH3)6)</td>
			<td>Sigma-Aldrich</td>
			<td>H7891-5G</td>
			<td>dissolve in nuclease-free H2O for 10&#160;M solution, sterile filter. CAUTION: carcinogenic, sensitizing and hazardous to aquatic environment.</td>
		</tr>
		<tr>
			<td>HincII</td>
			<td>New England Biolabs</td>
			<td>R0103S</td>
			<td>supplied with NEBuffer 3.1</td>
		</tr>
		<tr>
			<td>Hybridiser HB-1D</td>
			<td>Techne</td>
			<td>FHB4DD</td>
			<td></td>
		</tr>
		<tr>
			<td>KAPA HiFi HotStart ReadyMix (2X)</td>
			<td>Kapa Biosystems</td>
			<td>KK2602</td>
			<td></td>
		</tr>
		<tr>
			<td>Lysis buffer</td>
			<td></td>
			<td></td>
			<td>50 mM EDTA, 20 mM HEPES, NaCl 75 mM, Proteinase K (200 &#181;g/mL), 1% SDS</td>
		</tr>
		<tr>
			<td>Micro tube 1.5 mL</td>
			<td>Sarstedt</td>
			<td>72.690.001</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge 5424R</td>
			<td>Eppendorf</td>
			<td>5404000014</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge MiniStar silverline</td>
			<td>VWR</td>
			<td>521-2844</td>
			<td></td>
		</tr>
		<tr>
			<td>Multiply&#160;&#181;StripPro 0.2 mL tube</td>
			<td>Sarstedt</td>
			<td>72.991.992</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>Ambion</td>
			<td>AM9937</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol &#8211; chloroform &#8211; isoamyl alcohol (25:24:1)</td>
			<td>Sigma-Aldrich</td>
			<td>77617-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium chloride (KCl)</td>
			<td>VWR</td>
			<td>26764.232</td>
			<td>dissolve in nuclease-free H2O for 3&#160;M solution, sterile filter</td>
		</tr>
		<tr>
			<td>Potassium hydroxide (KOH)</td>
			<td>VWR</td>
			<td>26668.296</td>
			<td>dissolve in nuclease-free H2O for 3&#160;M solution, sterile filter</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Ambion</td>
			<td>AM2546</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 3.0 Fluorometer</td>
			<td>Invitrogen</td>
			<td>Q33216</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit Assay Tubes</td>
			<td>Invitrogen</td>
			<td>Q32856</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit dsDNA BR Assay Kit</td>
			<td>Invitrogen</td>
			<td>Q32850</td>
			<td>CAUTION: Contains flammable and toxic components</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS Assay Kit</td>
			<td>Invitrogen</td>
			<td>Q32851</td>
			<td>CAUTION: Contains flammable and toxic components</td>
		</tr>
		<tr>
			<td>Refrigerated Centrifuge 4K15</td>
			<td>Sigma Laboratory Centrifuges</td>
			<td>No. 10740</td>
			<td></td>
		</tr>
		<tr>
			<td>SDS Solution, 10%</td>
			<td>Invitrogen</td>
			<td>15553-035</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium acetate buffer solution, pH 5.2, 3 M (NaAc)</td>
			<td>Sigma-Aldrich</td>
			<td>S7899</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride (NaCl)</td>
			<td>VWR</td>
			<td>27810.295</td>
			<td>dissolve in nuclease-free H2O for 5&#160;M solution, sterile filter</td>
		</tr>
		<tr>
			<td>T100 Thermal Cycler</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 Polynucleotide Kinase (3&#39; phosphatase minus)</td>
			<td>New England Biolabs</td>
			<td>M0236L</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 RNA Ligase 1 (ssRNA Ligase)</td>
			<td>New England Biolabs</td>
			<td>M0204L</td>
			<td>supplied with PEG 8000 (50%)</td>
		</tr>
		<tr>
			<td>T7 DNA Polymerase (unmodified)</td>
			<td>New England Biolabs</td>
			<td>M0274S</td>
			<td>supplied with 10x T7 DNA Polymerase Reaction Buffer</td>
		</tr>
		<tr>
			<td>TE Buffer</td>
			<td>Invitrogen</td>
			<td>12090015</td>
			<td></td>
		</tr>
		<tr>
			<td>ThermoMixer F2.0</td>
			<td>Eppendorf</td>
			<td>5387000013</td>
			<td></td>
		</tr>
	</tbody>
</table>

simultaneous mapping and quantitation of ribonucleotides in human mitochondrial dna

Abordagens estabelecidas para estimar o número de ribonucleotídeos presentes em um genoma são limitadas para a quantificação de ribonucleotídeos incorporados usando fragmentos de DNA sintéticos curtos ou plasmídeos como modelos e em seguida a extrapolação dos resultados para toda a genoma. Alternativamente, o número de ribonucleotídeos presentes em um genoma pode ser estimado usando gel alcalina ou os borrões do Sul. Mais recente na vivo abordagens empregam sequenciamento de próxima geração, permitindo o mapeamento de todo o genoma de ribonucleotídeos, fornecendo a posição e a identidade de ribonucleotídeos incorporados. No entanto, não permitem a quantificação do número de ribonucleotídeos que são incorporados em um genoma. Aqui descrevemos como simultaneamente mapear e quantificar o número de ribonucleotídeos incorporadas humana mitochondrial DNA na vivo por sequenciamento de próxima geração. Vamos usar DNA altamente intacta e introduzir quebras da cadeia dupla específico de sequência digerindo-a com uma endonuclease, posteriormente hidrólise de ribonucleotídeos incorporados com alcaloide. As extremidades geradas são ligadas com adaptadores e essas extremidades são sequenciadas em uma máquina de sequenciamento de nova geração. O número absoluto de ribonucleotídeos pode ser calculado como o número de leituras fora do site de reconhecimento por número médio de leituras no local de reconhecimento para a endonuclease específica de sequência. Este protocolo também pode ser utilizado para mapear e dosar cortes grátis no DNA e permite a adaptação mapear outras lesões do ADN que podem ser processados para 5´-OH pontas ou extremidades 5´-fosfato. Além disso, este método pode ser aplicado a qualquer organismo, dado que um genoma de referência adequada está disponível. Este protocolo, portanto, fornece uma ferramenta importante para estudar a replicação do DNA, processamento de 5´ final, danos ao DNA e reparação do DNA.

Ilustrando a metodologia descritos acima, representativos de dados foram gerados, analisando o DNA mitocondrial humano HeLa células12. Figura 2B mostra as leituras resumidas em todos os sites HincII em pesados (HS) e fio de luz (LS) de DNA mitocondrial humano após tratamento de KCl (painéis à esquerda). Aproximadamente 70% de todos os fins-de-5´ detectados localizar para os corte-sites, demonstrando a alta eficiência da digestão HincII. Tratamento de bibliotecas com KOH para hidrolisar o ADN ribonucleotídeos incorporados diminui o número de leituras em sites HincII para cerca de 40% (Figura 2B, painéis certo). Isto é esperado desde que um grande número de fins-de-5´ é gerado aos sítios de incorporação ribonucleotídeo e é indicativo de uma qualidade suficiente da biblioteca. Figura 2 ilustra a localização e a frequência de fins-de-5´ (verde) após leituras e tratamento de KCl geraram por HydEn-seq (magenta) após o tratamento de KOH, detectar tanto 5´-extremidades livres e extremidades geradas no ribonucleotídeos por hidrólise alcalina. 5´-extremidades livres e ribonucleotídeos localizando o SH de DNA mitocondrial humano são mostrados no painel da esquerda e aqueles localizando para o LS são mostradas no painel direito. Os números relativos de leituras crus em ribonucleotídeos (Figura 2D, painel superior) ou sites de HincII (painel inferior) em HS e LS do mtDNA mostram, respectivamente, uma cobertura mais forte 14-fold ou 31-fold do LS em relação a HS, enquanto um viés semelhante não foi observado para DNA nuclear. Este viés de vertente podem ser explicada pela diferença na composição de base das duas vertentes distinta e ilustra a importância da normalização para leituras em sites HincII.
Normalizando a leitura conta para HincII dá uma medida quantitativa do número de ribonucleotídeos por genoma mitocondrial (Figura 3A). Conforme ilustrado na Figura 3B, as leituras após tratamento de KOH para cada ribonucleótido normalizado para a composição de sequência de cada vertente mostram uma relação diferente de 1, indicando uma distribuição não aleatória de leituras sugerindo um ribonucleótido distinto padrão e uma qualidade elevada de biblioteca. Essa proporção é afetada pela digestão anterior com HincII, verificar a especificidade de clivagem da enzima. Normalizar as leituras aos sítios de ribonucleotídeos incorporados aos sítios de clivagem de HincII, bem como o conteúdo de nucleotídeos do genoma, gera uma medida quantitativa de quantos de cada ribonucleótido são incorporados por 1.000 bases complementares ( Figura 3).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56551/56551fig1.jpg"> 
Figura 1: esquemático para processamento de DNA e biblioteca preparação. (1) DNA genômico todo é clivado pela HincII para normalização na quantificação subsequente de ribonucleotídeos, gerando extremidades sem corte em HincII locais (seta preta). (2) o DNA é tratado com KOH para hidrolisar em sites ribonucleotídeo, levando a 2´, 3´-cíclico fosfato (Pentágono vermelho) em fins-de-3´ e 5´-OH livre termina. (3) 5´-OH extremidades são fosforiladas por T4 polinucleotídicas quinase 3´-fosfatase-subtração. (4) todos os fins-de-5´ um grupo de fosfato são ligados para do oligonucleotide ARC140 pela ligase do RNA do T4. (5) a segunda vertente é sintetizado usando T7 DNA polimerase e os oligonucleotides ARC76-77 contendo sequências de6 N aleatórias. (6) a biblioteca é amplificada por um Polymerase de ADN de alta-fidelidade usando ARC49 e um do ARC78 de ARC107 primeiras demão de índice que contém um único código de barras para multiplexação. (7) 5´-extremidades estão localizados por sequenciamento emparelhado-final. <a href="//ecsource.jove.com/files/ftp_upload/56551/56551fig1large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56551/56551fig2.jpg"> 
Figura 2: validação do método. (A) electropherograms representante gerado usando um sistema automatizado de electroforese para determinar a qualidade do gerado bibliotecas tratadas com KOH ou resumidos KCl. (B) sinal em locais HincII pesado (HS) e luz strand (LS) DNA mitocondrial humano depois de KCl (painéis esquerdos) ou tratamento de KOH (painéis de certo). (C) Circos figura de 5´-extremidades livres (verde) e de HydEn-Seq (5´-extremidades livres e ribonucleotídeos, magenta) no HS (painel esquerdo) e o DNA mitocondrial humano LS (painel direito). Picos são normalizados por milhões leituras e o pico máximo é ajustado para o máximo número de leituras da biblioteca HydEn-seq. (D) resumidos cru lê ribonucleotídeos (painel superior) e sites de HincII (painel inferior) em pesados (H) e fio de luz (L) no DNA mitocondrial humano (Mito.) ou no sentido inverso (RV) ou para a frente (FW) costa, no nuclear (Nuc). DNA. Figuras B, C e D são adaptadas de referência12. Barras de erro representam o erro padrão da média. <a href="//ecsource.jove.com/files/ftp_upload/56551/56551fig2large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56551/56551fig3.jpg"> 
Figura 3: resultados do representante. (A), o relativo número de ribonucleotídeos normalizada para leituras em HincII locais para bibliotecas KOH tratado no fio de luz (L) ou pesados (H). (B) relação de identidade ribonucleótido para composição de genoma de DNA mitocondrial para KOH tratados (KOH) e HincII clivado com KOH Tratado (HincII + KOH) bibliotecas no pesado (H) ou luz (L) fio de DNA mitocondrial. (C) frequência ribonucleótido normalizada para 1.000 bases complementares por HincII e KOH tratados bibliotecas no pesado (H) ou fio de luz (L) de DNA mitocondrial. Figuras são adaptadas de referência12. Barras de erro representam o erro padrão da média. <a href="//ecsource.jove.com/files/ftp_upload/56551/56551fig3large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Nome</td>
			<td colspan="4">Sequência de</td>
		</tr>
		<tr>
			<td>ARC49</td>
			<td colspan="4">AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC76</td>
			<td colspan="4">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNN * N * N</td>
		</tr>
		<tr>
			<td>ARC77</td>
			<td colspan="4">AGATCGGAAGAGCACACGTCTGAACTCCAGTC * A * C</td>
		</tr>
		<tr>
			<td>ARC78</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC84</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC85</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC86</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC87</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGA</td></tr></tbody></table>TCT
		
		<tr>
			<td>ARC88</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC89</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC90</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC91</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC93</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC94</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC95</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC96</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTGTTGACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC97</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATACGGAACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC98</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTCTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC99</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCGGGACGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC100</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATGTGCGGACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC101</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATCGTTTCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC102</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATAAGGCCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC103</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTCCGAAACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC104</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATTACGTACGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC105</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATATCCACTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC106</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATATATCAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC107</td>
			<td colspan="4">CAAGCAGAAGACGGCATACGAGATAAAGGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>ARC140</td>
			<td colspan="4">/ 5AmMC6/ACACTCTTTCCCTACACGACGCTCTTCCGATCT</td>
		</tr>
	

Tabela 1: Oligonucleotides. Estão listados os oligonucleotides usados para HydEn-Seq. Negrito indica a indexação. * indica um vínculo phosphorothioate. ARC140 contém um grupo amino-5´ em vez de um grupo de 5´-OH, em combinação com um vinculador de C6. Esta alteração reduz a formação de concatemers ARC140 durante a ligadura.

Watch this Scientific Journal Video about Simultaneous Mapping and Quantitation of Ribonucleotides in Human Mitochondrial DNA at JoVE.com

Simultaneous Mapping and Quantitation of Ribonucleotides in Human Mitochondrial DNA

Mapeamento simultâneo e quantificação de ribonucleotídeos no DNA mitocondrial humano

Aqui nós descrevemos um método passível de dosar simultaneamente e ribonucleotídeos mapa de todo o genoma em DNA altamente intacta na resolução de single-nucleotide, combinando a clivagem enzimática do DNA genômico com sua hidrólise alcalina e subsequente 5´-final sequenciamento.

Established approaches to estimate the number of ribonucleotides present in a genome are limited to the quantitation of incorporated ribonucleotides using ...

simultaneous-mapping-quantitation-ribonucleotides-human-mitochondrial

Research

JoVE Journal

Biology

9.4K visualizações.  University of Gothenburg. Aqui nós descrevemos um método passível de dosar simultaneamente e ribonucleotídeos mapa de todo o genoma em DNA altamente intacta na resolução de single-nucleotide, combinando a clivagem enzimática do DNA genômico com sua hidrólise alcalina e subsequente 5´-final sequenciamento.

Vídeo: Simultaneous Mapping and Quantitation of Ribonucleotides in Human Mitochondrial DNA

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and programmed cell death. Mitochondria produce ATP, regulate the cytoplasmic redox state and Ca2+ balance, catabolize fatty acids, synthesize heme, nucleotides, steroid hormones, amino acids, and help assemble iron-sulfur clusters in proteins. Mitochondria also have an essential role in heat production. Mutations of the mitochondrial genome cause several types of human disorder. The accumulation of mtDNA mutations correlates with aging and is suspected to have an important role in the development of cancer. Due to their vitally important role in all cell types, the function of mitochondria must also be critical for stem cells. Key advances have been made in our understanding of stem cell viability, proliferation, and differentiation capacity. But the functional activity of stem cells, in particular their energy status, was not yet been studied in detail. Almost nothing is known about the mitochondrial properties of human embryonic stem cells (hESCs) and their differentiated precursor progeny. One way to understand and evaluate the role of mitochondria in hESC function and developmental potential is to directly measure the activity of mitochondrial respiratory complexes. Here, we describe high resolution clear native gel electrophoresis and subsequent in gel activity visualization as a method for analyzing the five respiratory chain complexes of hESCs.

In this video, we will show you how the mitochondrial respiratory chain complexes of human embryonic stem cells can be analyzed using in gel activity assays.

Sondagem para a Atividade Complexo mitocondrial em células estaminais embrionárias humanas

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

Biologia

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation 

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Mapeamento de destino de células estaminais embrionárias humanas por formação de teratomas

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three ...

Quantitation of &gamma;H2AX Foci in Tissue Samples

DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) processes or by exogenous factors, particularly ionizing radiation and radiomimetic compounds. Phosphorylation of the H2A histone variant, H2AX, at the serine-139 residue, in the highly conserved C-terminal SQEY motif, forming &gamma;H2AX, is an early response to DNA double-strand breaks1. This phosphorylation event is mediated by the phosphatidyl-inosito 3-kinase (PI3K) family of proteins, ataxia telangiectasia mutated (ATM), DNA-protein kinase catalytic subunit and ATM and RAD3-related (ATR)2. Overall, DSB induction results in the formation of discrete nuclear &gamma;H2AX foci which can be easily detected and quantitated by immunofluorescence microscopy2. Given the unique specificity and sensitivity of this marker, analysis of &gamma;H2AX foci has led to a wide range of applications in biomedical research, particularly in radiation biology and nuclear medicine. The quantitation of &gamma;H2AX foci has been most widely investigated in cell culture systems in the context of ionizing radiation-induced DSBs. Apart from cellular radiosensitivity, immunofluorescence based assays have also been used to evaluate the efficacy of radiation-modifying compounds. In addition, &gamma;H2AX has been used as a molecular marker to examine the efficacy of various DSB-inducing compounds and is recently being heralded as important marker of ageing and disease, particularly cancer3. Further, immunofluorescence-based methods have been adapted to suit detection and quantitation of &gamma;H2AX foci ex vivo and in vivo4,5. Here, we demonstrate a typical immunofluorescence method for detection and quantitation of &gamma;H2AX foci in mouse tissues.

Quantitation of &#947;H2AX Foci in Tissue Samples

Quantitation of DNA double-strand breaks on the basis of &gamma;H2AX foci has become an invaluable tool, particularly in radiation biology, for the evaluation of tissue radiosensitivity and effects of radiation modifying compounds. Here we demonstrate the use of an immunofluorescence assay for quantitation of &gamma;H2AX foci in tissue samples.

Quantificação de γH2AX Focos em amostras de tecido

DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

Captura selectivo de 5-hydroxymethylcytosine a partir de DNA genómico

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Isolation of Human Atrial Myocytes for Simultaneous Measurements of Ca2+ Transients and Membrane Currents

The study of electrophysiological properties of cardiac ion channels with the patch-clamp technique and the exploration of cardiac cellular Ca2+ handling abnormalities requires isolated cardiomyocytes. In addition, the possibility to investigate myocytes from patients using these techniques is an invaluable requirement to elucidate the molecular basis of cardiac diseases such as atrial fibrillation (AF).1 Here we describe a method for isolation of human atrial myocytes which are suitable for both patch-clamp studies and simultaneous measurements of intracellular Ca2+ concentrations. First, right atrial appendages obtained from patients undergoing open heart surgery are chopped into small tissue chunks ("chunk method") and washed in Ca2+-free solution. Then the tissue chunks are digested in collagenase and protease containing solutions with 20 &mu;M Ca2+. Thereafter, the isolated myocytes are harvested by filtration and centrifugation of the tissue suspension. Finally, the Ca2+ concentration in the cell storage solution is adjusted stepwise to 0.2 mM. We briefly discuss the meaning of Ca2+ and Ca2+ buffering during the isolation process and also provide representative recordings of action potentials and membrane currents, both together with simultaneous Ca2+ transient measurements, performed in these isolated myocytes.

Isolation of Human Atrial Myocytes for Simultaneous Measurements of Ca2+ Transients and Membrane Currents

We describe the isolation of human atrial myocytes which can be used for intracellular Ca2+ measurements in combination with electrophysiological patch-clamp studies.

Isolamento de miócitos atriais humanos para Medições Simultâneas de Ca<sup&gt; 2 +</sup&gt; Transitórios e correntes de membrana

The study of  electrophysiological properties of cardiac ion channels with the patch-clamp  technique and the exploration of cardiac cellular Ca2+ ...

Real-time Imaging of Single Engineered RNA Transcripts in Living Cells Using Ratiometric Bimolecular Beacons

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the development of diverse techniques to visualize individual RNA transcripts in single living cells. One promising technique that has recently been described utilizes an oligonucleotide-based optical probe, ratiometric bimolecular beacon (RBMB), to detect RNA transcripts that were engineered to contain at least four tandem repeats of the RBMB target sequence in the 3&#8217;-untranslated region. RBMBs are specifically designed to emit a bright fluorescent signal upon hybridization to complementary RNA, but otherwise remain quenched. The use of a synthetic probe in this approach allows photostable, red-shifted, and highly emissive organic dyes to be used for imaging. Binding of multiple RBMBs to the engineered RNA transcripts results in discrete fluorescence spots when viewed under a wide-field fluorescent microscope. Consequently, the movement of individual RNA transcripts can be readily visualized in real-time by taking a time series of fluorescent images. Here we describe the preparation and purification of RBMBs, delivery into cells by microporation and live-cell imaging of single RNA transcripts.

Ratiometric bimolecular beacons (RBMBs) can be used to image single engineered RNA transcripts in living cells. Here, we describe the preparation and purification of RBMBs, delivery of RBMBs into cells by microporation and fluorescent imaging of single RNA transcripts in real-time.

Imagens em tempo real de uma única Engineered RNA transcritos em células vivas usando raciométrica Bimolecular Beacons

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the ...

Quantitation of Endothelial Cell Adhesiveness In Vitro

One of the cardinal processes of inflammation is the infiltration of immune cells from the lumen of the blood vessel to the surrounding tissue. This occurs when endothelial cells, which line blood vessels, become adhesive to circulating immune cells such as monocytes. In vitro measurement of this adhesiveness has until now been done by quantifying the total number of monocytes that adhere to an endothelial layer either as a direct count or by indirect measurement of the fluorescence of adherent monocytes. While such measurements do indicate the average adhesiveness of the endothelial cell population, they are confounded by a number of factors, such as cell number, and do not reveal the proportion of endothelial cells that are actually adhesive. Here we describe and demonstrate a method which allows the enumeration of adhesive cells within a tested population of endothelial monolayer. Endothelial cells are grown on glass coverslips and following desired treatment are challenged with monocytes (that may be fluorescently labeled). After incubation, a rinsing procedure, involving multiple rounds of immersion and draining, the cells are fixed. Adhesive endothelial cells, which are surrounded by monocytes are readily identified and enumerated, giving an adhesion index that reveals the actual proportion of endothelial cells within the population that are adhesive.

Quantitation of Endothelial Cell Adhesiveness In Vitro

We report an in vitro method that allows the quantitation of the actual number of adhesive cells within an endothelial cell monolayer.

A quantificação da Adesividade celular endotelial<em&gt; In Vitro</em

One of the cardinal processes of inflammation is the infiltration of immune cells from the lumen of the blood vessel to the surrounding tissue. This ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to dose-limiting toxicity and many adverse side effects. Targeting the genome with sequence-specific small molecules may enable molecules with increased therapeutic index and fewer off-target effects. N-methylpyrrole/N-methylimidazole polyamides are molecules that can be rationally designed to target specific DNA sequences with exquisite precision. And unlike most natural transcription factors, polyamides can bind to methylated and chromatinized DNA without a loss in affinity. The sequence specificity of polyamides has been extensively studied in vitro with cognate site identification (CSI) and with traditional biochemical and biophysical approaches, but the study of polyamide binding to genomic targets in cells remains elusive. Here we report a method, the crosslinking of small molecules to isolate chromatin (COSMIC), that identifies polyamide binding sites across the genome. COSMIC is similar to chromatin immunoprecipitation (ChIP), but differs in two important ways: (1) a photocrosslinker is employed to enable selective, temporally-controlled capture of polyamide binding events, and (2) the biotin affinity handle is used to purify polyamide&#8211;DNA conjugates under semi-denaturing conditions to decrease DNA that is non-covalently bound. COSMIC is a general strategy that can be used to reveal the genome-wide binding events of polyamides and other genome-targeting chemotherapeutic agents.

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Identifying the direct targets of genome-targeting molecules remains a major challenge. To understand how DNA-binding molecules engage the genome, we developed a method that relies on crosslinking of small molecules to isolate chromatin (COSMIC).

Mapeamento de todo o genoma de DNA Interações medicamentosas-em células com COSMIC (reticulação de moléculas pequenas para isolar Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID-seq: Genoma-wide Mapeamento das Interações Proteína-DNA por High Throughput Sequencing de fragmentos de DNA metilado-Adenina

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...

Quantitation of Protein Expression and Co-localization Using Multiplexed Immuno-histochemical Staining and Multispectral Imaging

Immunohistochemistry is a commonly used clinical and research lab detection technique for investigating protein expression and localization within tissues. Many semi-quantitative systems have been developed for scoring expression using immunohistochemistry, but inherent subjectivity limits reproducibility and accuracy of results. Furthermore, the investigation of spatially overlapping biomarkers such as nuclear transcription factors is difficult with current immunohistochemistry techniques. We have developed and optimized a system for simultaneous investigation of multiple proteins using high throughput methods of multiplexed immunohistochemistry and multispectral imaging. Multiplexed immunohistochemistry is performed by sequential application of primary antibodies with secondary antibodies conjugated to horseradish peroxidase or alkaline phosphatase. Different chromogens are used to detect each protein of interest. Stained slides are loaded into an automated slide scanner and a protocol is created for automated image acquisition. A spectral library is created by staining a set of slides with a single chromogen on each. A subset of representative stained images are imported into multispectral imaging software and an algorithm for distinguishing tissue type is created by defining tissue compartments on images. Subcellular compartments are segmented by using hematoxylin counterstain and adjusting the intrinsic algorithm. Thresholding is applied to determine positivity and protein co-localization. The final algorithm is then applied to the entire set of tissues. Resulting data allows the user to evaluate protein expression based on tissue type (ex. epithelia vs. stroma) and subcellular compartment (nucleus vs. cytoplasm vs. plasma membrane). Co-localization analysis allows for investigation of double-positive, double-negative, and single-positive cell types. Combining multispectral imaging with multiplexed immunohistochemistry and automated image acquisition is an objective, high-throughput method for investigation of biomarkers within tissues.

Immunohistochemistry is a powerful lab technique for evaluating protein localization and expression within tissues. Current semi-automated methods for quantitation introduce subjectivity and often create irreproducible results. Herein, we describe methods for multiplexed immunohistochemistry and objective quantitation of protein expression and co-localization using multispectral imaging.