עבודה זו נתמכה על ידי המענק מדגיש NERC (NE N016777 1). Ensis בע מ, שירותי מדעי הסביבה, המרכז לחקר שינוי סביבתי, אוניברסיטת קולג '-לונדון שנדגמו, יצאתי עם ליבת משקעים.

המחברים אין לחשוף

עקב מוליכות חום גבוהה של מים, מערכות אקולוגיות מים מתוקים הם בסיכון גבוה יותר של המגוון הביולוגי אובדן מאשר המערכות האקולוגיות יבשתי מול הכללית התחממות34 חיוני, לכן, כדי להבין את התגובה של keystone מינים של מערכות אקולוגיות אלו ולזהות מנגנוני ההתמודדות לשרוד מתח תרמי. ההבנה של מנגנונים אלה ברמות מינים והקהילה יכול לעזור לחזות כיצד מינים שמושפעים התחממות וגולש איך ההשפעה על מינים בודדים לרמות אחרות הזנה. בסופו של דבר, הבנת מנגנוני תגובות על התחממות כדור הארץ מאפשר הזיהוי של תיקונים אסטרטגיות להפחתת extinctions.
מחקרים המובאים כאן מראים כי תגובת מגנה ד בטמפרטורה pervasively מתווך על ידי פלסטיות של תכונות היסטוריית החיים ולא כי בתגובה בטמפרטורה לבד לכפות עלויות כושר ברורה, לפחות האוכלוסייה למד כאן. פלסטיות גבוהה בתכונות היסטוריית החיים נתמך על ידי הבדלים שאינם משמעותיים ביכולות מתחרות של האוכלוסיות (sub) בנוכחות התחממות כדור הארץ. עם זאת, התחרות וקהילותיהם, ניסויים אוכלוסיות מרובות ייתכן שיהיה צורך להכליל ממצאים אלה.
תחייתו של שלבים רדום מספק משאב חסר תקדים ללמוד מנגנוני הסתגלות ואת מסלולי התפתחות של זן עד שעה10. זואופלנקטון מינים תועלת זמן דור מהירה (כשבועיים), ואת הכדאיות של שלבים רדום, אשר מאפשר קדום. כדי להתחרות headtohead נגד צאצאיו משלו, או 'החוזר' האבולוציה שמתחיל ממדינות שונות בעבר. תחיית המתים אקולוגיה בעיקרו של דבר מאפשר החקירה של תוצאה אבולוציונית מיוחדת נמדדת לפי כמה אירועים קודמים. זיהוי מרכיבים גנטיים של אבולוציה אפשרית כיום בניסויים במעבדה בעזרת מיקרואורגניזמים שעבורם 'שורות אב קדמון' קפוא, להחיות אותו לניתוח השוואתי עם צאצא מפותחת שלהם6. עם זאת, אחת המגבלות העיקריות של עבודה עם מעבדה אורגניזמים הוא 'המדינה אב קדמון' הוא בסיסית שהוסטו כבר. המחקר של שלבים רדום מאפשר הדוגמאות של דגימות מן הזמן לגירושן לכל אירוע דחק (למשל, תנאים סביבתיים וטהור) וכדי למדוד מסלולים אבולוציונית מתנאי הסביבה ללא הפרעה למדינות שונות בעבר עד לתקופה המודרנית. בשנים האחרונות, המחקר של ה-DNA פולימורפיזם בשלבים זואופלנקטון לתחייה או עדיין רדום סיפקה תובנות חשובות האחרונות תהליכים דמוגרפיים, מסתגלת תרמו הגנטי של אוכלוסיות של ימינו14 , 16 , 25 , 33 , 35 , 36. עם נגישות גבוהה יותר של טכנולוגיות רצף תפוקה גבוהה, הגנום ואת transcriptome של שלבי לתחייה או עדיין רדום יכול להיות רציף, סוג ומספר שינויים גנטיים שנצבר המתפתחת אוכלוסיות מעל הזמן נמדד.
התקומה SOP המוצג כאן יש ליישומים חשובים בתחום של מולטי-טכנולוגיות על שתי רמות. טכנולוגיות רב ניתן ליישם דגימות לתחייה, המאפשר ניתוח ממצה של היסודות המולקולריים המעורבים בתגובות הסתגלות ללחץ הסביבה הבחירה. בנוסף, טכנולוגיות ניתן ליישם decapsulated אלא שלבי עדיין רדום. עד כה, היישום של טכנולוגיות רצף תפוקה גבוהה לנוח שלבים היה מוגבל על ידי הדרישה של כמות גדולה של חומר קלט. מגבלות אלה מתבצעת והרימה אותה37. עם הדרישות להורדת חומר קלט ולהתקדם בעזרת nanofluidics, רצף הגנום כולו (WGS) אפשרי עכשיו מ קטנה כמו 1 ng או כמה pg להתחיל גשמי38. השימוש של הגנום כולו הגברה (WGA) וטכניקות הגברה (של WTA) כל transcriptome, המאפשרת את העשרת של DNA ו- RNA של כמויות קטנות מאוד של רקמות, יש מהפכה39,metagenomics40 וגם רפואי מחקר41. טכנולוגיות אלה חלה על ביצים רדום decapsulated לאפשר את חריגה של מגבלות הקשורים הכדאיות של שלבים רדום של חוקרים של תקופות זמן ממושך (למשל, מאות שנים).
תחייתו של קהילות הגעה בהפקת שלבים מנוחתו מאפשר היישור של סיפורי הקהילה בשינויים ידועים של הנופים הטבעיים, או עם שינויים סביבתיים להסיק מניתוחי של משקעים orsoils2. הניתוח של הקהילה משתנה בתגובה לשינוי סביבתי מספק לנו את היכולת לכמת פידבקים eco-אבולוציונית42 שיש להם השלכות משמעותית על ההתמדה האוכלוסייה43, אינטראקציות עם מחלות44 , הקהילה הרכבה45, ושינויים במערכת האקולוגית פונקציות ושירותים46. לבסוף, תחזיות מדויקות לגבי תגובות ביולוגיות שינוי סביבתי הם הכרחיים כדי להנחות את ההגנה של המגוון הביולוגי47 מודלים הנוכחית אינם מדויקים בהקשר זה כי הם לא עשה חשבון מנגנונים ביולוגיים חשובים כגון דמוגרפיה, פיזור, האבולוציה מינים אינטראקציות. הבנה כיצד תהליכים אלה משתנים במשך הזמן ושימוש במידע זה כמו לכהן ב דוגמנות תחזית ישפר את היכולת שלנו לחזות מינים ושנה הקהילה התמדה אל מול הסביבה2.
היישום של ה-SOP המובאת כאן אינה ללא אתגרים. המגבלה העיקרית של לאוהדיו שלבים רדום הוא הצורך של ציוד מיוחד עבור הדגימה. בנוסף, התהליך כולו, מן המשקעים ניפוי להקמה של תרבויות המשובטים, דורש זמן ניכר על הידיים.
חלק מהשלבים SOP המובאת כאן המתעכבים ברצון מינים דפניה אחרים. אלה הם: דגימה, הקמת קווי המשובטים, תכנון ניסויים. עם זאת, צעדים אחרים של ה-SOP עשויים לדרוש עוד יותר אופטימיזציה המותאמים למין שנבחנה. Decapsulation לעיתים קרובות חלה על דגימות מגנה ד כדי לשפר את ההצלחה הבקיעה. עם זאת, גישה זו עשוי לא להיות מתאים דגימות קטנות יותר. הבקיעה גירויים יכול להשתנות גם בין המינים48 ובין הדגימה conspecific49. לפיכך, לאופטימיזציה אד הוק של המדרגות הבקיעה של ה-SOP עשוי להידרש לפני ליישומים אחרים. בזמן הבקיעה ההצלחה של האוכלוסייה מגנה ד לתחייה מן האגם טבעת (30.5% על פני הארכיון משקע) עולה בקנה אחד עם תוצאות קודמות49, הבקיעה הצלחה משתנה עם מצב ההשתמרות המשקע, המין 50,51, המקור הגיאוגרפי של משקעים48. מחקרים עתידיים על המנגנונים המווסתים כניסה וההתקדמות דרך השלבים של תרדמה ואסטרטגיה נדרש לזהות גירויים הבקיעה האופטימלי לצרכיו מינים שונים.
לבסוף, רקע הידע של מערכת המחקר, בפרט, נוכחותם של המינים של הריבית לאורך זמן, מומלץ. זו יכולה להיות מושגת באמצעות רשומות היסטוריות. אם רשומות היסטוריות אינן זמינות, דגימה, הקרנת משטח שכבות המשקע אגם לפני דגימה הליבה, מומלץ, למרות שזה מספק מידע רק על ההיסטוריה האחרונה.

מחקרים ארוכי טווח הם קריטיים להבנת תהליכים אקולוגי ואבולוציוני בטבע, בהערכת להגיב וכיצד נמשכות במהלך שינוי סביבתי1מינים. זה בגלל תהליכי eco-אבולוציונית לקרות על פני דורות, שינויים בסביבת מתקיימים לאורך זמן טווחי זמנים. יתר על כן, מחקרים ארוכי טווח לספק מפתח בנתונים אמפיריים, לשפר את הדיוק של דוגמנות חזוי לתחזית אבולוציונית תגובות של מערכות אקולוגיות טבעיות שינויים סביבתיים2. הדיוק של מודלים אלה היא קריטית כדי ליישם אסטרטגיות ניהול ושימור לשמירה על המגוון הביולוגי שירותי המערכת האקולוגית.
לא כולל כמה מקרים יוצאי דופן (למשל, גלפאגוס דארווין פרושים3 ואצות4), מחקרים ארוכי טווח מוגבלים בעיקר מינים עם זמן דור קצר, אותם ניתן להפיץ ב מעבדה5,6 , 7 , 8. לפיכך, התהליכים דינמיקה אבולוציונית לגורם המרכזי עליו מושתתת נשארים חמקמקים. בגלל קשיים לוגיסטיים הקשורים עם גישה לדוגמיות הטמפורלי, בנתונים אמפיריים נלמדים בתדירות גבוהה יותר ב מרחבית יותר בהקשר הטמפורלי, תהליכי eco-אבולוציונית טמפורלית להסיק או המודל של נתונים מרחביים. גישה זו מכונה 'מרחב-עבור-time' החלפת9, לפיה שטח מאומצת כתחליף בחקר דינמיקה אבולוציונית טמפורלית. המגבלה העיקרית ההחלפה 'מרחב-עבור-time' היא כי המחירים של הסתגלות המרחבי בקני מידה שונים נבדלים וריאציה טמפורלית מאותה אוכלוסייה; לפיכך, מסקנות בהתבסס על החלפה של זמן עם שטח הם משוחד10.
חלופה רב עוצמה המאפשר לימוד דינמיקה אבולוציונית של מערכות אקולוגיות טבעיות לאורך זמן הוא הניתוח של שינויים אקולוגיים ולא גנטי במין בהפקת שלבים רדום11. אלה שלבים רדום לארכיון ביולוגי טופס מרובדת שניתן באופן מדויק מיום ולצבור paleolimnologically מאופיין12,13. חשוב, השלבים האלה רדומים יכולים להיות החיינו ומשמשת בניסויים במעבדה, איפה את תגובתם אבולוציונית השינוי הסביבתי ניתן למדוד ישירות. אוכלוסיות ההיסטורי יכול להיות התחרו נגד צאצאיהם מפותחת המודרנית ללמוד כושר שינויים והפונקציה של גנים מתפתח בשלב עם שינוי סביבתי14,15,16.
שלבים רדום כוללים זרעים, ציסטות, נבגים, ביצה בנקים. למרות המחקרים הראשונים על החיו ביצים רדום שתחילתה בסוף שנות השמונים17ו קומץ של מחקרים החלת טכניקה זו בתחילת שנות ה-9018,19, בתחום אקולוגיה התחייה היה באופן רשמי הוקמה על ידי העיתון החלוצי של Kerfoot ועמיתים 199920. פרקטיקה זו הוחל בעיקר בתחום paleolimnological שחזורים של מים מתוקים מינים17,21,22. עם זאת, שוחד אינה זמינה עדיין. כאן, מספק תיאור צעד אחר צעד של פרוטוקול תחיית המתים שהוחל ביצים רדום של המין זואופלנקטון דפניה magna , מן הדוגמאות של שנלכד להקמת תרבויות המשובטים הוולדות. הצעדים של ה-SOP המתעכבים ברצון מינים אחרים של דפניה, כמו גם פעולות שעשויות לדרוש נוספים מיטוב, הם דנו.
דפניה הם מים מתוקים zooplankters נוכח ברוב המכריע של בתי גידול lotic23 . דפניה מינים הם גם parthenogens אל-זוויגית או מחזורי גידול. מאגנה ד הוא parthenogen מחזורית מתרבה clonally תחת תנאים סביבתיים נוחים24. כאשר התנאים הסביבתיים להתדרדר, ייצור זכר מתרחשת ומוביל רקומבינציה מינית את היווצרות של הביצים זה להיכנס למצב של תרדמה מוגן מן הסביבה על-ידי תיק כיטין שנקרא ephippium. שיעור של הביצים רדום בוקעות תנאים סביבתיים נוחים חוזרים. עם זאת, חלק גדול של הבנק הביצה הרדומה מעולם לא יש סיכוי לבקוע, ובכך לבנות את ארכיון ביולוגי לאורך זמן. שלבים רדום שישאר קבור ב המשקע של אגמים, בריכות, יכול להיות לתחייה לחקר דינמיקה אבולוציונית לאורך פרקי זמן ארוכים. כיוון ביצים רדום של magna ד הם התוצאה של רקומבינציה מינית, הן ייצוג טוב של המגוון הגנטי הטבעי של מינים25. יתר על כן, הם יכולים להישמר דרך רבייה המשובטים במעבדה. מאפיינים אלו מספקים את היתרון הייחודי של אורגניזמים דגם isogenic, תוך שמירה על המגוון הגנטי טבעי.
שני מחקרים מפתח מוצגים כדי להדגים את היתרונות של ישירות השוואת היסטוריים ומודרניים צאצאי האוכלוסייה באותו מגנה ד חווה לחץ סביבתי הבחירה לאורך זמן. מאגנה ד דגימות שהוקמו לתחייה מן האגם טבעת (דנמרק), רדוד (עומק 5m; פני 22 ha) בריכה מעורבת שחווה גידול ממוצע טמפרטורה, גלי חום שמתרחשת לאורך זמן. אוכלוסיות מגנה ד (sub) היו לתחייה לאורך זו הדרגה הזמנית המתפרסות על-פני 60 שנה (1960-2005) ולמד לחקור תגובה אבולוציונית טמפרטורה להתחממות. במחקר הראשון בניסוי גן משותף, שינויים בכושר-מקושרים על החיים תכונות נמדדו בתגובה לעלייה בטמפרטורה של C ° +6, בקו אחד עם הנבואה של הפאנל הבין-ממשלתי לשינוי האקלים 100 השנים הקרובות 26. במחקר השני, ניסוי mesocosm שימש כדי למדוד את יכולותיהם תחרותי של שלושת האוכלוסיות (sub) תחת התחממות כדור הארץ. ניסויים אלה בשילוב מראים כי בנוכחות של התחממות כדור הארץ כמו הלחץ היחיד, כל תכונות היסטוריית החיים של אוכלוסיות להציג רמה גבוהה של פלסטיות יכולות תחרותי שווה. ממצאים אלה מראים כי ההתחממות כמו מצוקה מטיל עלויות משמעותי כושר, לפחות בקרב האוכלוסייה למד כאן.

<table><tbody><tr><td>sampling bags</td><td>Fisher Scientific</td><td>11542783</td><td>Sampling bag revolve round wires closure system and safety tabs sterile polyethylene with writing area clear 89&amp;micro;m thickness 140mm x 229mm, 720mL Fisherbrand</td></tr><tr><td>piston corer</td><td>ENSIS ltd</td><td>na</td><td>Long, heavy tube plunged into the sea, lake, pond floor to extract samples of mud sediment. Piston corers have a viariable diameter and are generally in PVC</td></tr><tr><td>precision scale</td><td>Veritas-M124A</td><td>TLP-50</td><td>Analytical Balance</td></tr><tr><td>geological sieve</td><td>UKGE limited</td><td>SV7521</td><td>200 mm diameter geological sieve - 1 mm mesh</td></tr><tr><td>geological sieve</td><td>UKGE limited</td><td>SV7525</td><td>200 mm diameter geological sieve - 0.125 mm mesh</td></tr><tr><td>white sampling tray</td><td>nhbs</td><td>http://www.nhbs.com/title/view/159614?ad_id=1509</td><td>Standard mulipurpose lab trays</td></tr><tr><td>pasteur pipette</td><td>Globe Scientific inc.</td><td>138020B</td><td>Transfer Pipet, 1.7mL, General Purpose, 87mm, Bulb Draw - 0.9mL</td></tr><tr><td>stereo microscope</td><td>nikon</td><td>smz800</td><td>Microscope with magnification range 1x -8x linked to a camera control unit</td></tr><tr><td>petri dish</td><td>EduLab</td><td>153-533</td><td>Sterile 90mm diameter plastic petri dish</td></tr><tr><td>glass jars</td><td>compak</td><td>Round Jam Jars 4oz</td><td>100 mL jars</td></tr><tr><td>glass jars</td><td>compak</td><td>Atum Jars/ Bonta Jar 10oz</td><td>200 mL jars</td></tr><tr><td>glass jars</td><td>bottlecompanysouth</td><td>500ml Food Jam Jar With Twist Off Lid</td><td>500 mL jars</td></tr><tr><td>statistical software R</td><td>https://cran.r-project.org/</td><td>na</td><td>Free online GNU&amp;nbsp; language and environment for statistical computing and graphics</td></tr><tr><td>microdissection forceps</td><td>Fisher Scientific</td><td>41122405</td><td>Fine point stainless steel forceps for microdissections</td></tr><tr><td>image software</td><td>https://imagej.nih.gov/ij/index.html</td><td>na</td><td>Open source ImageJ image processing toolkit written in Java</td></tr><tr><td>mesocosm</td><td>amazon</td><td>na</td><td>Nobby Fauna-Box III, 41 x 23 x 29 cm, 20.0 Liter</td></tr><tr><td>mirocentrifuge tubes</td><td>Sigma_Aldrick - Merck</td><td>Z606340</td><td>premium microcentrifuge tubes 1.5 mL</td></tr><tr><td>AGENCOURT DNAdvance</td><td>Beckman Coulter</td><td>A48705</td><td>DNA extraction kit</td></tr><tr><td>size standard</td><td>Thermo Fisher Scientific</td><td>4322682</td><td>LIZ500 - Size standard compatible with ABI sequencers</td></tr><tr><td>ABI3032 sequencer</td><td>ABI</td><td>na</td><td>Sequencer used to perform fragment analysis or sanger sequencing</td></tr></tbody></table>

resurrection of dormant daphnia magna: protocol and applications

מחקרים ארוכי טווח מאפשרות זיהוי תהליכי eco-אבולוציוניים המתרחשים לאורך פרקי זמן ארוכים. בנוסף, הם מספקים מפתח בנתונים אמפיריים הנתנות ב דוגמנות חזוי לתחזית אבולוציונית תגובות של מערכות אקולוגיות טבעיות לשינויים סביבתיים בעתיד. עם זאת, לא כולל כמה מקרים חריגים, מחקרים ארוכי טווח ואספקות נדירים בגלל קשיים לוגיסטיים הקשורים עם גישה לדוגמיות טמפורלית. דינמיקה טמפורלית נלמדים לעתים קרובות במעבדה או בניסויים מבוקרים mesocosm עם מחקרים יוצאי דופן לשחזר את האבולוציה של אוכלוסיות הטבעי בטבע.
. הנה, סטנדרטי (SOP) מסופק להחיות או להחיות רדום דפניה magna, זן keystone זואופלנקטון נרחבת של המערכת האקולוגית הימית, לקדם באופן דרמטי את אוסף נתוני האורך המדינה-of-the-art מערכות טבעיות. בתחום אקולוגיה תחיית המתים הוגדרה בשנת 1999 על-ידי Kerfoot ועמיתים לעבודה, אף-על-פי הראשון ניסיונות הבקיעה diapausing זואופלנקטון ביצים תאריך חזרה בסוף שנות השמונים. מאז העיתון הזרע של Kerfoot, המתודולוגיה של לאוהדיו זואופלנקטון מינים לעתים קרובות יותר ויותר הוחל, למרות הופץ בין מעבדות רק באמצעות העברה ישירה הידע. כאן, הנוהל המתואר המספק פרוטוקול שלב אחר שלב על העשייה לאוהדיו רדום דפניה מגנה ביצים.
שני מחקרים מרכזיים ניתנים ב אשר תגובת כושר לתחייה דפניה מגנה לאוכלוסיות ההתחממות נמדד, ניצול היכולת ללמוד לאוכלוסייה היסטוריים ומודרניים באותן ההגדרות. לבסוף, נדון היישום של טכנולוגיות רצף ' הדור הבא ' בשלבים לתחייה או עדיין רדום. טכנולוגיות אלה מספקים כוח חסר תקדים בניתוח של תהליכים ומנגנונים של האבולוציה, אם חלה על אוכלוסיות שעברו שינויים בלחץ הבחירה לאורך זמן.

בנתונים אמפיריים לטווח ארוך הם קריטיים להבנת דינמיקה אבולוציונית, ההתמדה של אוכלוסיות טבעי. נתונים כאלה הם בדרך כלל מאתגרת כדי לקבל בגלל קשיים לוגיסטיים הקשורים עם גישה הדרישה בביצוע לטווח ארוך כדי איסוף נתונים ודוגמאות טמפורלית. שני מפתח מחקרים שהוצגו כאן, הוכחה אמפירית של התגובה הטמפרטורה של zooplankter המרכזית של מערכות אקולוגיות מים מתוקים מסופק על פי אבולוציונית. זה מופעלת על ידי השימוש בשכבות הביצה הרדומה הבנקים לספק הזדמנות ללמוד את התגובה של אוכלוסיות היסטורי וצאצאיהם מודרניים כדי עקה בהגדרות ניסיוני משותף.
ניסוי גן משותף הניסוי גן משותף הראה כי כל התכונות ההיסטוריה הגיבו טמפרטורה (איור 6 ו איור 7). ניתוח הנתונים ANOVA גילה כי כל האוכלוסיות (sub) להגיב לטמפרטורת דרך פלסטיות (טבלה 2), למעט התמותה, אשר אינו מגיב. ראיות של שינויים אבולוציוניים (הבדלים בין האוכלוסיות (sub)) נצפתה רק ב גידול האוכלוסיה (טבלה 2), אשר גדל באופן משמעותי בשניים מתוך השלושה אוכלוסיות (sub) ב 24 ° C (איור 6).
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56637/56637fig6.jpg"> איור 6: ניסוי גן משותף. התגובה נורמות החיים תכונות (פוריות, בגודל בגיל בגרות), גידול האוכלוסיה (r) מוצגים עבור כל האוכלוסייה (sub) מתחת לטמפרטורה התחממות (24 ° C) לעומת גן משותף של הטמפרטורה הנוכחית המשטר (18 ° C). גידול האוכלוסיה "r" מחושבת באמצעות משוואת אוילר (1). מרווחי הביטחון מוצגים. אוכלוסיות (sub) הם לפי צבעים: כחול (i): 1960-1970; (ii) ירוק: 1970-1985; (iii) אדום: > 1999. <a href="//cloudflare.jove.com/files/ftp_upload/56637/56637fig6large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/56637/56637fig7.jpg"> איור 7: תמותה. שיעורי התמותה לכל האוכלוסייה (sub) (1960-1970; 1970-1985; > 1999) מוצגים תחת התחממות כדור הארץ (24 ° C) לעומת משטרים מודרניים טמפרטורה (18 ° C). <a href="//cloudflare.jove.com/files/ftp_upload/56637/56637fig7large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
ניסוי Mesocosm לאחר ארבעה שבועות של בחירה, המיוצג על-ידי ההתחממות ב 24 ° C, התדירות של שלושת האוכלוסיות (sub) לא השתנה באופן משמעותי (χ2 = 0.55, P = 0.76) לעומת inoculum הראשוני (איור 8). בין 30 אחרים מחוסן בניסוי mesocosm, הרוב זוהה לאחר ארבעה שבועות של בחירה (איור 9). באופן ספציפי, 70% חוסנו אחרים היו התאושש, תואם עם ציפייה Poissonian מחלים נציג אחד לפחות של כל גנוטיפ במדגם של 32 אנשים.
<img alt="Figure 8" class="xfigimg" src="/files/ftp_upload/56637/56637fig8.jpg"> איור 8: תחרות הניסוי - האוכלוסייה תדר- חציון ממוצע האוכלוסייה ואת רביעונים (25th ו 75th), מוצג עבור שלוש אוכלוסיות (sub) של magna ד לאחר ארבעה שבועות של הבחירה בניסויים תחרות mesocosm (24 ° C), לעומת תדר השווה הראשונית (ב ההתחלה). אוכלוסיות (sub) הם לפי כפי שמוצג באיור 6צבעים. <a href="//cloudflare.jove.com/files/ftp_upload/56637/56637fig8large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 9" class="xfigimg" src="/files/ftp_upload/56637/56637fig9.jpg"> איור 9: תחרות הניסוי - גנוטיפ תדר- גנוטיפ תדרים – חציון בממוצע רביעונים (25th ו 75th), מוצגים לאחר ארבעה שבועות של חשיפה התחממות כדור הארץ (24 ° C) לעומת תדירות שווה הראשונית של אחרים (קו מנוקד). שמות בציר ה-x הם מזהה אחרים חוסנו, לקבץ לפי האוכלוסייה (sub) (כחול, 1960-1970; ירוק, 1970-1985; רד, > 1999). <a href="//cloudflare.jove.com/files/ftp_upload/56637/56637fig9large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>לוקוס</td>
			<td>,</td>
			<td>גודל הטווח (bp)</td>
			<td colspan="2">תחל (5' - 3')</td>
			<td>תווית צבע</td>
			<td>מוטיב חוזר</td>
			<td>Tm</td>
		</tr>
<tr>
<td rowspan="2">B008</td>
			<td rowspan="2">HQ234154</td>
			<td rowspan="2">150-170</td>
			<td colspan="2">F: TGGGATCACAACGTTACACAA</td>
			<td rowspan="2">ויק</td>
			<td rowspan="2">(TC) 9
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: GCTGCTCGAGTCCTGAAATC</td>
		</tr>
<tr>
<td rowspan="2">B030</td>
			<td rowspan="2">HQ234160</td>
			<td rowspan="2">154 – 172</td>
			<td colspan="2">F: CCAGCACACAAAGACGAA</td>
			<td rowspan="2">חיית המחמד</td>
			<td rowspan="2">(ג'י אי) 11
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: ACCATTTCTCTCCCCCAACT</td>
		</tr>
<tr>
<td rowspan="2">B045</td>
			<td rowspan="2">HQ234168</td>
			<td rowspan="2">118 – 126</td>
			<td colspan="2">F: GCTCATCATCCCTCTGCTTC</td>
			<td rowspan="2">נד</td>
			<td rowspan="2">(TG) 8
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: ATAGTTTCAGCAACGCGTCA</td>
		</tr>
<tr>
<td rowspan="2">B050</td>
			<td rowspan="2">HQ234170</td>
			<td rowspan="2">234 – 248</td>
			<td colspan="2">F: TTTCAAAAATCGCTCCCATC</td>
			<td rowspan="2">6FAM</td>
			<td rowspan="2">(גה) 6
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: TATGGCGTGGAATGTTTCAG</td>
		</tr>
<tr>
<td rowspan="2">B064</td>
			<td rowspan="2">HQ234172</td>
			<td rowspan="2">135 – 151</td>
			<td colspan="2">F: CTCCTTAGCAACCGAATCCA</td>
			<td rowspan="2">6FAM</td>
			<td rowspan="2">(TC) 8
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: CAAACGCGTTCGATTAAAGA</td>
		</tr>
<tr>
<td rowspan="2">B074</td>
			<td rowspan="2">HQ234174</td>
			<td rowspan="2">196-204</td>
			<td colspan="2">F: TCTTTCAGCGCACAATGAAT</td>
			<td rowspan="2">נד</td>
			<td rowspan="2">(GT) 9
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: TGTGTTCCTTGTCAACTGTCG</td>
		</tr>
<tr>
<td rowspan="2">B096</td>
			<td rowspan="2">HQ234181</td>
			<td rowspan="2">234 – 240</td>
			<td colspan="2">F: GGATCTGGCAGGAAGTGGTA</td>
			<td rowspan="2">ויק</td>
			<td rowspan="2">(AC) 15
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: TTGAACCACGTCGAGGATTT</td>
		</tr>
<tr>
<td rowspan="2">B107</td>
			<td rowspan="2">HQ234184</td>
			<td rowspan="2">250 – 274</td>
			<td colspan="2">F: GGGGTGAAGCATCAAAGAAA</td>
			<td rowspan="2">חיית המחמד</td>
			<td rowspan="2">(CT) 8
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: TGTGACCAGGATAAGAGAAGAGG</td>
		</tr>
</tbody></table>טבלה 1: בתי קולנוע Microsatellite. NCBI ההצטרפות מספר (AN), המידע מולטיפלקס, הרצפים פריימר PCR, הטווח גודל ה-PCR, מוטיב חוזר, לצבוע פעם תווית של פריימר לפנים, והטמפרטורה מחזק (Tm) מוצגים.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td colspan="2">שיעור הצמיחה פופ (r)</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">האבולוציה (Pop)</td>
			<td>2</td>
			<td>30.309</td>
			<td>< 0.001</td>
		</tr>
<tr>
<td colspan="2">פלסטיות (Temp)</td>
			<td>1</td>
			<td>531.546</td>
			<td>< 0.001</td>
		</tr>
<tr>
<td colspan="2">Evol. פלסטיות (פופ x Temp)</td>
			<td>2</td>
			<td>65.137</td>
			<td>< 0.001</td>
		</tr>
<tr>
<td colspan="2">התמותה</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">האבולוציה (Pop)</td>
			<td>2</td>
			<td>2.234</td>
			<td>0.1162</td>
		</tr>
<tr>
<td colspan="2">פלסטיות (Temp)</td>
			<td>1</td>
			<td>2.679</td>
			<td>0.1071</td>
		</tr>
<tr>
<td colspan="2">Evol. פלסטיות (פופ x Temp)</td>
			<td>2</td>
			<td>1.8657</td>
			<td>0.164</td>
		</tr>
<tr>
<td colspan="2">פוריות</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">האבולוציה (Pop)</td>
			<td>2</td>
			<td>1.8852</td>
			<td>0.1633</td>
		</tr>
<tr>
<td colspan="2">פלסטיות (Temp)</td>
			<td>1</td>
			<td>6.8934</td>
			<td>0.0117</td>
		</tr>
<tr>
<td colspan="2">Evol. פלסטיות (פופ x Temp)</td>
			<td>2</td>
			<td>1.6511</td>
			<td>0.203</td>
		</tr>
<tr>
<td colspan="2">גודל בעת הפירעון</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">האבולוציה (Pop)</td>
			<td>2</td>
			<td>0.211</td>
			<td>0.8106</td>
		</tr>
<tr>
<td colspan="2">פלסטיות (Temp)</td>
			<td>1</td>
			<td>11.1361</td>
			<td>0.0017</td>
		</tr>
<tr>
<td colspan="2">Evol. פלסטיות (פופ x Temp)</td>
			<td>2</td>
			<td>0.6586</td>
			<td>0.5225</td>
		</tr>
<tr>
<td colspan="2">גיל בעת הפירעון</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">האבולוציה (Pop)</td>
			<td>2</td>
			<td>0.7811</td>
			<td>0.4637</td>
		</tr>
<tr>
<td colspan="2">פלסטיות (Temp)</td>
			<td>1</td>
			<td>8.0764</td>
			<td>0.0066</td>
		</tr>
<tr>
<td colspan="2">Evol. פלסטיות (פופ x Temp)</td>
			<td>2</td>
			<td>0.088</td>
			<td>0.9159</td>
		</tr>
</tbody></table>בטבלה 2: השונות (ANOVA). ניתוח השונות בדיקה אם שינויים תכונות היסטוריית החיים וכן גידול האוכלוסיה של אוכלוסיות לתחייה (sub) חשופים להתחממות מוסברים על ידי הסתגלות אבולוציונית (אוכלוסיות), פלסטיות (טיפול טמפרטורה), שלהם המונח אינטראקציה (האבולוציה של פלסטיות). משמעותי p-ערכים (p< 0.05) מוצגות בגופן מודגש.
1 וידאו משלימים: דגימה של משקעים ליבות. השימוש corer ביג בן מוצג. ביג בן הוא צינור הליבה של-1.5 מ' אורך עם קוטר צינור פנימי של 14 ס מ. זה מורכב בוכנה על חבל וראש corer, שאליו מחוברים מוטות לנסוע ברכבת התחתית לתוך המשקע. לוכד ליבה משמש לתמיכה הצינור הליבה פרוס כלי קטן. הבוכנה נדחף למטה לתוך המשקע על ידי לחץ הכבידה. מסגרת משמש כדי לתמוך את הצינור הליבה במהלך תהליך ההבלטה מתבצעות בעזרת שקע בקבוק ששונה דוחף את הבוכנה כלפי מעלה. כל שכבה משקעים על משטח המתכת השטוחים ונשתמש הועבר דגימה שקוף שקיות לאחסון לטווח ארוך [אפל וקר (4 ° C) תנאים]. <a href="http://cloudflare.jove.com/files/ftp_upload/56637/Supplementary_video1_Sampling.mp4">אנא לחץ כאן כדי להוריד את הקובץ.</a>
2 וידאו משלימים: משקעים ניפוי. הציוד הדרוש עבור ניפוי משקעים הוא סולם precision, מגשים דגימה לבן, הנפות גיאולוגי. בין כל שכבה משקעים, לפחות 5 g נשמרים עבור תיארוך רדיומטרי. שארית המשקע משמש כדי לבודד ephippia. המשקע הוא sieved דרך שתי הנפות גיאולוגי, אחד עם 1 מ מ, שנייה עם 125 µm שרוחב, נערמו אחד על גבי השני. בינונית ויוצקים על מסננת רשת 1 מ מ להפריד חימר גדולים חסרי חוליות, חלקיקי החומר. בינוני שפכו על המסננת השנייה עם 125 µm רשת מפריד ד magna ephippia וחומר חלקיקי קטן. Aliquots של משקעים מועברים למגש דגימה לבן. Ephippia מגנה ד הם הבחינו לפי העין במגש רקע לבן. Ephippia של כל שכבה נאספים פטרי נפרדים. <a href="http://cloudflare.jove.com/files/ftp_upload/56637/Supplementary_video2_Sieving_sediment.mp4">אנא לחץ כאן כדי להוריד את הקובץ.</a>
וידאו משלים 3: Decapsulation. תחת stereomicroscope, ephippia magna ד נפתחות עם מלקחיים microdissection על ידי הפעלת לחץ על עמוד השדרה של המקרה כיטין. קרום ביצה הפנימי יוסר בעדינות ולא נח הביצים בעדינות הועבר עם פיפטה פסטר צלחת פטרי המכילות 10 מ"ל של מדיום. <a href="http://cloudflare.jove.com/files/ftp_upload/56637/Supplementary_video3_Decapsulation.mp4">אנא לחץ כאן כדי להוריד את הקובץ.</a>
וידאו משלימים 4: הבקיעה. לאחר חשיפה ארוכה photoperiod ו 20 ° C, חידוש התפתחות העובר בין 48 שעות מספר שבועות. עם השלמת הפיתוח, העוברים להשתחרר ממעטפת הביצית, לשחות בחופשיות בטווח הבינוני. <a href="http://cloudflare.jove.com/files/ftp_upload/56637/Supplementary_video4_Hatching.mp4">אנא לחץ כאן כדי להוריד את הקובץ.</a>

Watch this Scientific Journal Video about Resurrection of Dormant Daphnia magna: Protocol and Applications at JoVE.com

Resurrection of Dormant Daphnia magna: Protocol and Applications

מחקרים ארוכי טווח חיוניים להבנת תהליך האבולוציה ולא על מנגנוני הסתגלות. באופן כללי, מחקרים אלה דורשות התחייבויות מעבר חיים החוקרים. . הנה, שיטה חזקה מתואר באופן דרמטי ההתקדמות איסוף נתונים המדינה-of-the-art להפיק נתוני האורך בתוך מערכות טבעיות.

תחיית המתים של רדום דפניה מגנה: פרוטוקול ויישומים

Long-term studies enable the identification of eco-evolutionary processes that occur over extended time periods. In addition, they provide key empirical ...

resurrection-of-dormant-daphnia-magna-protocol-and-applications

Research

JoVE Journal

Environment

Resurrection of Dormant Daphnia magna: Protocol and Applications

18.2K Views.  University of Birmingham. מחקרים ארוכי טווח חיוניים להבנת תהליך האבולוציה ולא על מנגנוני הסתגלות. באופן כללי, מחקרים אלה דורשות התחייבויות מעבר חיים החוקרים. . הנה, שיטה חזקה מתואר באופן דרמטי ההתקדמות איסוף נתונים המדינה-of-the-art להפיק נתוני האורך בתוך מערכות טבעיות.

Video: Resurrection of Dormant Daphnia magna: Protocol and Applications

A Simple Approach to Manipulate Dissolved Oxygen for Animal Behavior Observations

The ability to manipulate dissolved oxygen (DO) in a laboratory setting has significant application to investigate a number of ecological and organismal behavior questions. The protocol described here provides a simple, reproducible, and controlled method to manipulate DO to study behavioral response in aquatic organisms resulting from hypoxic and anoxic conditions. While performing degasification of water with nitrogen is commonly used in laboratory settings, no explicit method for ecological (aquatic) application exists in the literature, and this protocol is the first to describe a protocol to degasify water to observe organismal response. This technique and protocol were developed for direct application for aquatic macroinvertebrates; however, small fish, amphibians, and other aquatic vertebrates could be easily substituted. It allows for easy manipulation of DO levels ranging from 2 mg/L to 11 mg/L with stability for up to a 5 min animal-observation period. Beyond a 5 min observation period water temperatures began to rise, and at 10 min DO levels became too unstable to maintain. The protocol is scalable to the study organism, reproducible, and reliable, allowing for rapid implementation into introductory teaching labs and high-level research applications. The expected results of this technique should relate dissolved oxygen changes to behavioral responses of organisms.

This article describes a simple and reproducible protocol to manipulate dissolved oxygen conditions in a laboratory setting for animal behavior studies. This protocol may be used in both teaching and research laboratory settings to evaluate organismal response of macroinvertebrates, fishes, or amphibians to changes in dissolved oxygen concentration.

גישה פשוטה מניפולציות חמצן מומס לתצפיות התנהגות בעלי החיים

The ability to manipulate dissolved oxygen (DO) in a laboratory setting has significant application to investigate a number of ecological and organismal ...

Basic Methods for the Study of Reproductive Ecology of Fish in Aquaria

Captive-rearing observations are valuable for revealing aspects of fish behavior and ecology when continuous field investigations are impossible. Here, a series of basic techniques are described to enable observations of the reproductive behavior of a wild-caught gobiid fish, as a model, kept in an aquarium. The method focuses on three steps: collection, transport, and observations of reproductive ecology of a substrate spawner. Essential aspects of live fish collection and transport are (1) preventing injury to the fish, and (2) careful acclimation to the aquarium. Preventing harm through injuries such as scratches or a sudden change of water pressure is imperative when collecting live fish, as any physical damage is likely to negatively affect the survival and later behavior of the fish. Careful acclimation to aquaria decreases the incidence death and mitigates the shock of transport. Observations during captive rearing include (1) the identification of individual fish and (2) monitoring spawned eggs without negative effects to the fish or eggs, thereby enabling detailed investigation of the study species' reproductive ecology. The subcutaneous injection of a visible implant elastomer (VIE) tag is a precise method for the subsequent identification of individual fish, and it can be used with a wide size range of fish, with minimal influence on their survival and behavior. If the study species is a substrate spawner that deposits adhesive eggs, an artificial nest site constructed from polyvinyl chloride (PVC) pipe with the addition of a removable waterproof sheet will facilitate counting and monitoring the eggs, lessening the investigator's influence on the nest-holding and egg-guarding behavior of the fish. Although this basic method entails techniques that are seldom mentioned in detail in research articles, they are fundamental for undertaking experiments that require the captive rearing of a wild fish.

A series of basic methods to enable the study of the reproductive ecology of fish kept in aquaria are described. These are useful protocols for collecting fish using SCUBA, transporting live fish, and observing the reproductive behavior of wild-caught fish kept in aquaria.

שיטות בסיסיות לחקר אקולוגיה פוריות של דגים באקווריום

Captive-rearing observations are valuable for revealing aspects of fish behavior and ecology when continuous field investigations are impossible. Here, a ...

Behavior

Swimming Induced Paralysis to Assess Dopamine Signaling in Caenorhabditis elegans

The swimming assay described in this protocol is a valid tool to identify proteins regulating the dopaminergic synapses. Similar to mammals, dopamine (DA) controls several functions in C. elegans including learning and motor activity. Conditions that stimulate DA release (e.g., amphetamine (AMPH) treatments) or that prevent DA clearance (e.g., animals lacking the DA transporter (dat-1) which are incapable of reaccumulating DA into the neurons) generate an excess of extracellular DA ultimately resulting in inhibited locomotion. This behavior is particularly evident when animals swim in water. In fact, while wild-type animals continue to swim for an extended period, dat-1 null mutants and wild-type treated with AMPH or inhibitors of the DA transporter sink to the bottom of the well and do not move. This behavior is termed "Swimming Induced Paralysis" (SWIP). Although the SWIP assay is well established, a detailed description of the method is lacking. Here, we describe a step-by-step guide to perform SWIP. To perform the assay, late larval stage-4 animals are placed in a glass spot plate containing control sucrose solution with or without AMPH. Animals are scored for their swimming behavior either manually by visualization under a stereoscope or automatically by recording with a camera mounted on the stereoscope. Videos are then analyzed using a tracking software, which yields a visual representation of thrashing frequency and paralysis in the form of heat maps. Both the manual and automated systems guarantee an easily quantifiable readout of the animals' swimming ability and thus facilitate screening for animals bearing mutations within the dopaminergic system or for auxiliary genes. In addition, SWIP can be used to elucidate the mechanism of action of drugs of abuse such as AMPH.

Swimming Induced Paralysis to Assess Dopamine Signaling in Caenorhabditis elegans

Swimming induced paralysis (SWIP) is a well-established behavioral assay used to study the underlying mechanisms of dopamine signaling in Caenorhabditis elegans (C. elegans). However, a detailed method to perform the assay is lacking. Here, we describe a step-by-step protocol for SWIP.

שחייה המושרה שיתוק כדי להעריך דופמין איתות ב Caenorhabditis elegans

The swimming assay described in this protocol is a valid tool to identify proteins regulating the dopaminergic synapses. Similar to mammals, dopamine (DA) ...

שימור בהקפאה של PGCs לשימור ארוך טווח של זני דרוזופילה

Primordial Germ Cell Cryopreservation and Revival of Drosophila Strains

Drosophila strains must be maintained by the frequent transfer of adult flies to new vials. This carries a danger of mutational deterioration and phenotypic changes. Development of an alternative method for long-term preservation without such changes is therefore imperative. Despite previous successful attempts, cryopreservation of Drosophila embryos is still not of practical use because of low reproducibility. Here, we describe a protocol for primordial germ cell (PGC) cryopreservation and strain revival via transplantation of cryopreserved PGCs into agametic Drosophila melanogaster (D. melanogaster) host embryos. PGCs are highly permeable to cryoprotective agents (CPAs), and developmental and morphological variation among strains is less problematic than in embryo cryopreservation. In this method, PGCs are collected from approximately 30 donor embryos, loaded into a needle after CPA treatment, and then cryopreserved in liquid nitrogen. To produce donor-derived gametes, the cryopreserved PGCs in a needle are thawed and then deposited into approximately 15&#160;agametic host embryos. A frequency of at least 15% fertile flies was achieved with this protocol, and the number of progeny per fertile couple was always more than enough to revive the original strain (the average progeny number being 77.2 &#177; 7.1), indicating the ability of cryopreserved PGCs to become germline stem cells. The average number of fertile flies per needle was 1.1 &#177; 0.2, and 9 out of 26 needles produced two or more fertile progeny. It was found that 11 needles are enough to produce 6 or more progeny, in which at least one female and one male are likely included. The agametic host makes it possible to revive the strain quickly by simply crossing newly emerged female and male flies. In addition, PGCs have the potential to be used in genetic engineering applications, such as genome editing.

מחבר זרקור: PGC Cryopreservation – גישה חלופית לשימור ארוך טווח של זני דרוזופילה 

A long-term preservation method for Drosophila strains as an alternative to the frequent transfer of adult flies to fresh food vials is highly desirable. This protocol describes the cryopreservation of Drosophila primordial germ cells and strain revival via their transplantation to agametic host embryos.

שימור בהקפאה של תאי נבט קדמוניים והחייאת זני דרוזופילה

Drosophila strains must be maintained by the frequent transfer of adult flies to new vials. This carries a danger of mutational deterioration and ...

Genetics

Large-Scale Gravitaxis Assay of Caenorhabditis Dauer Larvae

Gravity sensation is an important and relatively understudied process. Sensing gravity enables animals to navigate their surroundings and facilitates movement. Additionally, gravity sensation, which occurs in the mammalian inner ear, is closely related to hearing - thus, understanding this process has implications for auditory and vestibular research. Gravitaxis assays exist for some model organisms, including Drosophila. Single worms have previously been assayed for their orientation preference as they settle in solution. However, a reliable and robust assay for Caenorhabditis gravitaxis has not been described. The present protocol outlines a procedure for performing gravitaxis assays that can be used to test hundreds of Caenorhabditis dauers at a time. This large-scale, long-distance assay allows for detailed data collection, revealing phenotypes that may be missed on a standard plate-based assay. Dauer movement along the vertical axis is compared with horizontal controls to ensure that directional bias is due to gravity. Gravitactic preference can then be compared between strains or experimental conditions. This method can determine molecular, cellular, and environmental requirements for gravitaxis in worms.

Large-Scale Gravitaxis Assay of Caenorhabditis Dauer Larvae

The present protocol outlines methods for conducting a large-scale gravitaxis assay with Caenorhabditis dauer larvae. This protocol allows for better detection of gravitaxis behavior compared with a plate-based assay.

בדיקת גרביטקסיס בקנה מידה גדול של זחלי Caenorhabditis Dauer

Gravity sensation is an important and relatively understudied process. Sensing gravity enables animals to navigate their surroundings and facilitates ...

Lethality Bioassay Using Artemia salina L.

Natural products have been used since ancient times to produce medicines. Nowadays, there are plenty of chemotherapeutic drugs obtained from natural sources and used against a plethora of diseases. Unfortunately, most of these compounds often display systemic toxicity and adverse effects. In order to better evaluate the tolerability of selected potentially bioactive samples, brine shrimp (Artemia salina) is generally used as a model in lethality studies. The A. salina test is based on the ability of the studied bioactive compounds to kill the microcrustaceans in their larval stage (nauplii). This method represents a convenient starting point for cytotoxicity studies, as well as for the general toxicity screening of synthetic, semisynthetic, and natural products. It can be considered a simple, quick, and low-cost assay, compared to many other assays (in vitro cells or yeast strains, zebrafish, rodents) generally suitable for the aforementioned purposes; moreover, it can be easily performed even without any specific training. Overall, A. salina assay represents a useful tool for the preliminary toxicity evaluation of selected compounds and the bio-guided fractionation of natural product extracts.

Lethality Bioassay Using Artemia salina L.

This work aims to evaluate and review the Artemia salina lethality bioassay procedure, also identified as brine shrimp lethality assay. This simple and cheap method gives information about the general toxicity (considered as a preliminary toxicity evaluation) of samples, namely, natural products.

קטלניות ביואסאי באמצעות ארטמיה סלינה L.

Natural products have been used since ancient times to produce medicines. Nowadays, there are plenty of chemotherapeutic drugs obtained from natural ...

Chemistry

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal lines have enabled biological processes to be studied in the context of a living, and in some instances even behaving, organism. In this protocol we will describe how to anesthetize intact Drosophila larvae, using the volatile anesthetic desflurane, to follow the development and plasticity of synaptic populations at sub-cellular resolution1-3. While other useful methods to anesthetize Drosophila melanogaster larvae have been previously described4,5,6,7,8, the protocol presented herein demonstrates significant improvements due to the following combined key features: (1) A very high degree of anesthetization; even the heart beat is arrested allowing for lateral resolution of up to 150 nm1, (2) a high survival rate of &gt; 90% per anesthetization cycle, permitting the recording of more than five time-points over a period of hours to days2 and (3) a high sensitivity enabling us in 2 instances to study the dynamics of proteins expressed at physiological levels. In detail, we were able to visualize the postsynaptic glutamate receptor subunit GluR-IIA expressed via the endogenous promoter1 in stable transgenic lines and the exon trap line FasII-GFP1. (4) In contrast to other methods4,7 the larvae can be imaged not only alive, but also intact (i.e. non-dissected) allowing observation to occur over a number of days1. The accompanying video details the function of individual parts of the in vivo imaging chamber2,3, the correct mounting of the larvae, the anesthetization procedure, how to re-identify specific positions within a larva and the safe removal of the larvae from the imaging chamber.

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

This protocol describes a reliable method for anesthetization and imaging of intact Drosophila melanogaster larvae. We have utilized the volatile anesthetic desflurane to allow for repetitive imaging at sub-cellular resolution and re-identification of structures for up to a few days1.

בתחום ההדמיה vivo של הזחלים תסיסנית אינטקט ברזולוציה משנה הסלולר

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal ...

Biology

Neural Stem Cell Reactivation in Cultured Drosophila Brain Explants

Neural stem cells (NSCs) have the ability to proliferate, differentiate, undergo apoptosis, and even enter and exit quiescence. Many of these processes are controlled by the complex interplay between NSC intrinsic genetic programs with NSC extrinsic factors, local and systemic. In the genetic model organism, Drosophila melanogaster, NSCs, known as neuroblasts (NBs), switch from quiescence to proliferation during the embryonic to larval transition. During this time, larvae emerge from their eggshells and begin crawling, seeking out dietary nutrients. In response to animal feeding, the fat body, an endocrine organ with lipid storage capacity, produces a signal, which is released systemically into the circulating hemolymph. In response to the fat body-derived signal (FBDS), Drosophila insulin-like peptides (Dilps) are produced and released from brain neurosecretory neurons and glia, leading to downstream activation of PI3-kinase growth signaling in NBs and their glial and tracheal niche. Although this is the current model for how NBs switch from quiescence to proliferation, the nature of the FBDS extrinsic cue remains elusive. To better understand how NB extrinsic systemic cues regulate exit from quiescence, a method was developed to culture early larval brains in vitro before animal feeding. With this method, exogenous factors can be supplied to the culture media and NB exit from quiescence assayed. We found that exogenous insulin is sufficient to reactivate NBs from quiescence in whole-brain explants. Because this method is well-suited for large-scale screens, we aim to identify additional extrinsic cues that regulate NB quiescence versus proliferation decisions. Because the genes and pathways that regulate NSC proliferation decisions are evolutionarily conserved, results from this assay could provide insight into improving regenerative therapies in the clinic.

Neural Stem Cell Reactivation in Cultured Drosophila Brain Explants

A method to reactivate quiescent neural stem cells in cultured Drosophila brain explants has been established. Using this method, the role of systemic signals can be uncoupled from tissue-intrinsic signals in the regulation of neural stem cell quiescence, entry and exit.

הפעלה מחדש של תאי גזע עצביים במוח דרוזופילה מתורבת

Neural stem cells (NSCs) have the ability to proliferate, differentiate, undergo apoptosis, and even enter and exit quiescence. Many of these processes ...

תחיית המתים של רדום דפניה מגנה: פרוטוקול ויישומים

Summary

Explore More Videos

Chapters in this video

גישה פשוטה מניפולציות חמצן מומס לתצפיות התנהגות בעלי החיים

שיטות בסיסיות לחקר אקולוגיה פוריות של דגים באקווריום

שחייה המושרה שיתוק כדי להעריך דופמין איתות ב Caenorhabditis elegans

שימור בהקפאה של תאי נבט קדמוניים והחייאת זני דרוזופילה

שימור בהקפאה של תאי נבט קדמוניים והחייאת זני דרוזופילה

שימור בהקפאה של תאי נבט קדמוניים והחייאת זני דרוזופילה

בדיקת גרביטקסיס בקנה מידה גדול של זחלי Caenorhabditis Dauer

קטלניות ביואסאי באמצעות ארטמיה סלינה L.

בתחום ההדמיה vivo של הזחלים תסיסנית אינטקט ברזולוציה משנה הסלולר

הפעלה מחדש של תאי גזע עצביים במוח דרוזופילה מתורבת