이 작품은 NERC 하이라이트 그랜트 (NE/N016777/1)에 의해 지원 되었다. Ensis 주식 회사, 환경 과학 서비스, 환경 변화 연구 센터, 대학 대학 런던 샘플링 하 고 퇴적 코어를 일자.

다음과 같은 SOP 제공 벼룩 마그나 부활 하는 데 사용 하는 프로토콜에 대 한 단계별 설명 휴면 계란, 샘플링, 침전 물, 그리고 클론 문화 ( 의 설립에서 ephippia의 격리에 대 한 자세한 설명을 포함 하 여 그림 1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56637/56637fig1.jpg"> 그림 1:의 부활에 대 한 단계별 가이드 벼룩 마그나. 자연 담 수 서식 지 (A)에서 퇴적 피스톤 corer (B)로 샘플링 된다. 퇴적 코어 (C)에서 증분 계층 1 또는 0.5 cm (D)의 슬라이스 이다. 토사의 각 레이어는 어둡고 차가운 조건 (4 ° C)에서 샘플 지퍼 잠금 가방 (E)에 저장 됩니다. 토사의 각 계층은 무게와 sieved 지질 체 (1 밀리미터 및 125 µ m 메쉬 크기, F)을 사용 하 여. 흰색 배경 트레이 벼룩 마그나 ephippia (G)를 분리 하는 데 사용 됩니다. Decapsulated 휴면 계란 (H)는 접시에 전송 하 고 부 화를 유도 하기 위해 빛과 온도 자극에 노출. 파묻혀는 항아리 (나) isoclonal 라인 구축 별도로 전송 됩니다. <a href="//cloudflare.jove.com/files/ftp_upload/56637/56637fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
1입니다. 퇴적 코어의 샘플링
<ol><li>호수 또는 연못 피스톤 corer를 사용 하 여 샘플 앙금. 이 프로토콜 사용 빅 벤27, 밧줄에 있는 막대는 침전 물에 튜브를 연결 corer 머리 피스톤 이루어져 코어 튜브 길이 약 1.5 m의 내부 튜브 직경의 14 cm. 빅 벤. 핵심 포 수 전체 코어 튜브의 지원 에이즈 침전 물. 퇴적 물을 돌출 하는 프레임 워크 직 립 및 고정, 코어 튜브를 유지 하 고 수정된 병 잭 압출 과정 (보충 비디오 1) 피스톤을 위쪽으로 밀어 하는 데 사용 됩니다.<ol>
<li>미만 1m 깊이 얕은 연못, 수동으로 퇴적 물을 밀어 직경의 더 이상 6 cm의 플 렉 시 글라스 중력 corer 사용 하 여.</li>
		<li>깊은 호수 (> 6 m 깊이의), 리빙스턴 피스톤 corers28 또는 단일 드라이브 그리피스 침전 물 corers를 사용 하 여 고정된 철 주 보트의 에이즈. 리빙 스톤-타입 드라이브 로드 피스톤 corer 통합된 호수 앙금의 부드러운 연속 1 미터 드라이브 수집에 깊은 약 30 m까지 물에 사용할 수 있습니다. 리빙 스톤 드라이브 막대에 표준 폴 리 카보 네이트 튜브를 연결 하는 간단 하지만 강력한 코어 머리 단일 드라이브 그리피스 corer에 의하여 이루어져 있다. corers 봉와 토사에 밀려는 고 피스톤 토사 (그림 2)의 복구에 필요한 흡입을 제공 한다.</li>
		<li>지속적인 검색, 그대로 코어 vibracoring를 사용 합니다. 이러한 corers 물 깊이의 다양 한 작업과 앙금 lithology에 따라 서로 다른 길이의 코어 샘플을 검색할 수 있습니다. 연결 된 배럴 또는 코어 튜브를 통해 아래로 vibracore 머리에서 전송 되는 낮은 진폭 진동 liquefies 앙금, 액상된 퇴적 물에 침투 하는 vibracore 단위에 연결 된 코어 배럴을 사용. 어떤 vibracorers는 소형, 경량, 및 휴대용, 다른 대형 선박에서 배포할 수 있는 큰 무거운 단위. Corers의 앙금의 lithology에 따라 달라 집니다.</li>
	</ol>
</li>
	<li>1 cm 이하의 편평한 금속 표면 (보조 비디오 1)를 사용 하 여 증분 층에서 코어를 가로로 슬라이스. 여기에 사용 되는 것 같은 침전 물 corers는 압출, 퇴적 층의 감소에 액체 정역학 압력을 줄이기 위해 설계 되었습니다. 다른 corers를 사용 하면 레이어 중 오염 제한에 블레이드의 쿠키 커터 종류 각 퇴적 층의 외부 껍질을 제거할 수 있습니다.</li>
	<li>별도 샘플링 가방 (보충 비디오 1), 각 퇴적 층을 수집 하 고 어둡고 추운 (4 ° C) 조건 저장.</li>
	<li>방사성 연대 측정에 대 한 모든 레이어에서 토사의 5 g의 최소를 수집 합니다. 방사능 연대 측정 데이트 분석 결과 대 한 자세한 설명을 위해 만든된 프로토콜입니다, 기존 게시12,13를 참조 하십시오.</li>
</ol><img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56637/56637fig2.jpg"> 그림 2: 절차를 유선 피스톤의 만화. 피스톤 corer, 내부 슬라이딩 도장 (피스톤) 약한 진공을 생성 하는 빈 관 피스톤 퇴적 물 인터페이스 건드리면, 무게는 침전 물에 코어 배럴을 민 다 고 진공 토사를 입력 하 여 퇴적 층을 방해 하지 않고 튜브 위로 이동 되 고 응어리를 빼내는. <a href="//cloudflare.jove.com/files/ftp_upload/56637/56637fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
2. 앙금 층의 체질
<ol><li>전체 규모를 사용 하 여 나중에 참조할 각 퇴적 층 무게. 면적 및 무게를 사용 하 여 호수에서 종 밀도 계산 하.</li>
	<li>다른 각각의 위에 쌓여의 지질 체 2 개를 사용 하 여 각 퇴적 층 체질. 첫 번째 체 1mm의 메쉬 크기는 그리고 찰 흙, 대형 무척 추 동물 및 미 립 자 물질, 예: 씨앗, 식물 및 곤충는 토사의 나머지에서 분리. 두 번째 체 125 µ m의 메쉬 있으며 디 만화 ephippia 및 작은 미 립 토사 (보충 비디오 2)의 나머지에서 분리.</li>
	<li>
흰색 배경 용지함에 125 µ m 메쉬 체에 수집 된 침전 물 분수의 작은 aliquots를 전송 합니다. 토사의 종류에 따라 각 번에 앙금의 작은 또는 큰 aliquots는 전송 수 있습니다.
	<ol>
<li>작은 볼륨을 추가 (최대 200 mL) 샘플링 흰색 트레이 다시 옮겨진된 퇴적 물 분수를 일시 중단 하 고 눈 ephippia (그림 3)의 안보를 촉진 하는 매체의. Dechlorinated 수돗물, 시추공 물, 콤보29또는 아담 매체 (Aachener Daphnien)30매체는 앙금을 resuspend 하는 데 사용 될 수 있습니다. 여기서 부터는, 용어 '매체' 중 하나 또는 모든 나열 된 솔루션을 참조 하도록 사용 됩니다.</li>
	</ol>
</li>
</ol><img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56637/56637fig3.jpg"> 그림 3: 벼룩 마그나 ephippium입니다. Decapsulation 직후 휴면 벼룩 마그나 계란. Ephippium (A), (B), 내부 계란 막과 휴면 계란 (C). 표시 됩니다. 눈금 막대 = 500 µ m.
3입니다. decapsulation Ephippia 및 해칭
<ol><li>일회용 파스퇴르 피 펫 또는 서 집게를 사용 하 여, 전송 개별 ephippia 접시에 담긴 매체의 10 mL 있습니다. 앙금의 층 당 적어도 페 트리 접시를 사용 합니다.</li>
	<li>스테레오 현미경, decapsulate 각 ephippia를 사용 하 여 서 겸 오픈 여 틴 케이스 (보조 비디오 3). 계란, 중단 하지에 주의 기울이고 휴식 계란 내부 막 섬세 하 게, 제거 하 고 중간 파스퇴르 피 펫을 사용 하 여 가득 페 트리 접시에 그들을 전송. 그러나 Decapsulation D. 마그나; 부 화 성공, 그것은 필요 하지 않을 수 있습니다 늘리거나 다른 벼룩 종은 더 작은 ephippia를 생산에 대 한 도전 될 수 있습니다.</li>
	<li>제어 온도 장치 (인큐베이터) 또는 방 전체 스펙트럼 긴 하루 photoperiod 빛 (16:8 빛: 어둠)과 고온 (20 ± 1 ° C) 부 화를 유도 하는 것을 decapsulated 계란을 노출 합니다. 해칭 48 h와 (최대 4; 몇 주 사이 발생 보조 비디오 4)입니다. Decapsulation의 부재, 직접 자극 (긴 하루 photoperiod 빛 (16:8 빛: 어둠)과 높은 온도 (20 ± 1 ° C)) 부 화를 ephippia를 노출 합니다.</li>
</ol>4. 벼룩 마그나 의 Isoclonal 라인 구축
<ol><li>3.3 일회용 파스퇴르 피 펫을 사용 하 여 매체의 200 mL 가득 항아리를 별도의 단계에서 개별 디 마그나 를 전송 하 여 단일 파묻혀에서 isoclonal 라인을 설정 합니다. 각 개인은 성적인 재결합의 결과 되 고 유전으로 명료 하다.</li>
	<li>재고 조건 10 ± 1 ° C, 16:8 빛: 다크 정권, 구성 된에서 무기한 isoclonal 라인 매주 0.2 mg C/L 클로렐라 vulgaris 또는 (예를 들어, Scenedesmus obliquus) 다른 녹색 조류의 먹이 유지 합니다. 매체 3 매주 갱신. 재고 조건 온도, 먹이 정권, 및 종으로 변경할 수 있습니다.</li>
</ol>5. 주요 연구
참고: 두 개의 주요 연구의 설명 어떤 부활된 D.magna (하위)에서 호수 반지 (덴마크)의 퇴적암 아카이브에서 인구 온난화 진화 응답을 평가 하 되 제공 됩니다. 3 (하위) 인구는 다음 기간에서 부활 되었다: 1960-1970 년, 1970-1985 년, 및 > 1999. D. 마그나 퇴적암 아카이브 11 사이 58% (그림 4) 원거리에서 성공을 부 화. 각 timeperiod에서 얻은 파묻혀에서 여기에 설명 된 두 가지 주요 연구에 대 한 임의의 하위 집합 선택 되었다. 이러한 연구는 온도 기울기에 따라 서로 다른 기간에서 부활 (하위) 인구 차이 니스 연결 생활사 특성 (5.1)에 보였다 그리고 그들은 다른 경쟁 능력 (5.2) 했다를 평가 하기 위해 설계 되었습니다. 후 온난화에 노출.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56637/56637fig4.jpg"> 그림 4: 호수 반지에서 샘플링 하는 퇴적암 보관에 성공을 부. 주요 연구에 사용 되는 호수 반지의 퇴적암 아카이브 따라 성공적인 파묻혀의 비율. <a href="//cloudflare.jove.com/files/ftp_upload/56637/56637fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<ol><li>
일반적인 정원 실험
	<ol>
<li>일반적인 정원 조건 주식 문화에서 (서브) 인구 당 10 파묻혀 전송: 16 ° C; 긴 photoperiod (16:8 빛: 다크 정권); 0.8 mg C/L 클로렐라 심상의 함께 매일 피드 및 갱신 매체 마다 둘째 날. 적어도 2 세대 (ca. 45 일)에 대 한 일반적인 정원 조건에 파묻혀 유지 합니다. 일반적인 정원 조건 모성 효과에서 간섭을 줄일 고 파묻혀 사이에서 복제를 동기화 할.</li>
		<li>브루 드 챔버로 두 번째 무리의 방출, 전송 성인 여성 2 세대에서 500ml 단지 그들은 청소년의 두 번째 무리를 풀어 놓을 때까지 중간으로 가득.</li>
		<li>24-48 h, 100 mL 단지 매체를 채워지고, 다음 실험 조건에 노출 2 세대의 두 번째 종족에서 태어난의 개별 청소년 무작위로 전송: 18 ° C (현재 온도 호수에서)와 (온난화, 온도 24 ° C 전망 26 IPCC 의해 곧 100 년), 16:8 빛: 다크 정권, 그리고 피드 매일 0.8 mg C/L Chlorellavulgaris의.</li>
		<li>각 실험 동물에 머리와 꼬리 척추 (그림 5)의 사이의 거리도 크기는 stereomicroscope와 만기에 측정 합니다. 각 동물 사진 및 그 후 적당 한 이미지 소프트웨어를 사용 하 여 그것의 크기를 분석.</li>
		<li>성숙에 나이 측정: 하루에 계란 쪽 상공에 처음으로 관찰 된다.</li>
		<li>사망률을 측정: 실험 기간 동안 멸종 개인의 수.</li>
		<li>통치를 측정: 첫 번째 및 두 번째 클론 재생에 출시 하는 자손의 총 수.</li>
		<li>Euler의 방정식 (1)를 사용 하 여 추정 인구 증가율을 측정: <img alt="Equation" src="/files/ftp_upload/56637/56637eq1.jpg">(1) Lx 는 나이 x에서 생존의 비율, bx 세 x, 살아남은 개인 당 생산 신생아의 수 r 이며 자연 증가의 본질적인 비율입니다.</li>
		<li>상용 소프트웨어를 사용 하 여 통계 분석을 수행 합니다. 여기에서, R31 를 사용 하 여 ggplot2 패키지를 사용 하 여 각 생활 역사 특색에 대 한 반응 규범 (환경에서 단일 유전자의 phenotypic 표정)를. 생존 분석 (R 패키지 rms; https://cran.r-project.org/web/packages/rms/rms.pdf)를 통해 인구 당 사망률을 계산 합니다. 마지막으로, R31 특성에 온도 영향 진화 (인구 가운데 차이)에 의해 설명 될 수 있는지를 평가 하는 분산 분석 (ANOVA, 표 2)를 수행 소성 (치료에 응답), 또는의 진화 소성 (인구 치료 x).</li>
	</ol>
</li>
	<li>
경쟁 실험
	<ol>
<li>일반적인 정원 조건 주식 문화에서 인구 당 10 파묻혀 전송: 20 ° C, 긴 photoperiod (16:8 빛: 다크 정권), 매일 0.8 mg C/L 클로렐라 vulgaris 의 피드 및 갱신 매체 마다 둘째 날. 모성 효과에서 간섭을 줄이기 위해 적어도 2 세대 (ca. 45 일)에 대 한 일반적인 정원 상태를 유지 합니다.</li>
		<li>무작위로 할당 5 청소년 24 ~ 48 h의 각 hatchling의 두 번째 세대의 두 번째 종족에서 실험 mesocosms (중간 가득 20 L 플라스틱 aquaria), 10 동물/l.의 조밀도에 triplicates에서</li>
		<li>24 ° c, 16:8 L:D 정권, mesocosms를 노출 하 고 매일 0.8 mg C/L Chlorellavulgaris 제어 온도 챔버 또는 최소 4 주에 대 한 보육의 먹이 (> 3 클론 세대).</li>
		<li>컬링 각 mesocosm 매주 벼룩 자연 환경에서 발생할 수 있습니다 인구 동적 시뮬레이션을 매체의 10%를 새로 고침 합니다. 학살 하는 매체와 각 수족관 (이 경우 1.2 L)에서 동물의 알려진된 볼륨을 제거 하 여 하 고 신선한 매체와 학살된 볼륨을 대체 하 여 부과. 실험 동물 성숙 (10 일)에 도달 후 학살 정권을 시작 합니다.</li>
		<li>4 주에의 끝에, 초기 inoculum 비교 genotypic 조성의 변화를 평가 하기 위해 각 mesocosm에서 32 동물 샘플.<ol>
<li>Microcentrifuge 튜브에서 개별 벼룩 을 놓고 파스퇴르 피 펫의 도움으로 과잉 액체를 제거 합니다.</li>
			<li>플래시 동결 개별 튜브 액체 질소와-80 ° c.에 게</li>
			<li>사용 가능한 프로토콜을 사용 하 고 제조업체의 지침에 따라 단일 개인 게놈 DNA를 추출 합니다.</li>
			<li>유전자 마커 hatchling 당 독특한 multilocus 유전자 형을 제공 하기에 충분 한 수를 사용 하 여 추출 된 DNA를 증폭. 여기, 한 멀티플렉스 (M01, 표 1)에 배열 하는 8 나옵니다 설립된 프로토콜32,33다음 사용 되었다.</li>
			<li>유전자 증폭 조각 분석기에 조각.</li>
			<li>적당 한 크기의 표준을 사용 하 여 상업적 또는 자유롭게 사용할 수 있는 소프트웨어와 조각 분석을 수행 합니다.</li>
			<li>설명된33, 그리고 초기 inoculum 비교 실험의 끝에 각 유전자 형의 빈도 계산 microsatellite loci의 세트로 유전형 32 개인에 의해 실험의 끝에 genotypic 구성 평가.</li>
		</ol>
</li>
	</ol>
</li>
</ol><img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56637/56637fig5.jpg"> 그림 5: 성인 여성 벼룩 마그나. 성인 여성 벼룩 마그나 parthenogenetic 가만히 상공에서 된. 머리와 꼬리 척추의 기지 사이의 거리는 동물의 크기를 측정 하는 데 사용 됩니다. 빨간 줄 크기 측정을 나타냅니다. 눈금 막대 = 500 µ m.

<ol><li>Lindenmayer, D. B., et al. <a target="_blank" href="http://onlinelibrary.wiley.com/doi/10.1111/j.1442-9993.2011.02351.x/abstract">Value of long-term ecological studies.</a> Austral Ecol. 37 (7), 745-757 (2012).</li>
<li>Orsini, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+evolutionary+time+machine%3A+using+dormant+propagules+to+forecast+how+populations+can+adapt+to+changing+environments%5BTitle%5D)+AND+%22TREE%22%5BJournal%5D)">The evolutionary time machine: using dormant propagules to forecast how populations can adapt to changing environments.</a> TREE. 28, 274-282 (2013).</li>
<li>Grant, P. R., Grant, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Unpredictable+evolution+in+a+30-+year+study+of+Darwin%27s+finches%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Unpredictable evolution in a 30- year study of Darwin's finches.</a> Science. 296, 707-711 (2002).</li>
<li>Lohbeck, K. T., Riebesell, U., Reusch, T. B. H. <a target="_blank" href="http://www.nature.com/ngeo/journal/v5/n5/full/ngeo1441.html">Adaptive evolution of a key phytoplankton species to ocean acidification.</a> Nature Biosci. 5, 346-351 (2012).</li>
<li>Barrick, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+evolution+and+adaptation+in+a+long-term+experiment+with+Escherichia+coli%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Genome evolution and adaptation in a long-term experiment with Escherichia coli.</a> Nature. 461 (7268), 1243-1247 (2009).</li>
<li>Barrick, J. E., Lenki, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+dynamics+during+experimental+evolution%5BTitle%5D)+AND+%22Nat+Rev+Genet%22%5BJournal%5D)">Genome dynamics during experimental evolution.</a> Nat Rev Genet. 14, 827-839 (2013).</li>
<li>Blount, Z. D., Barrick, J. E., Davidson, C. J., Lenski, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genomic+analysis+of+a+key+innovation+in+an+experimental+Escherichia+coli+population%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Genomic analysis of a key innovation in an experimental Escherichia coli population.</a> Nature. 489 (7417), 513-518 (2012).</li>
<li>Kawecki, T. J., et al. <a target="_blank" href="http://www.cell.com/trends/ecology-evolution/fulltext/S0169-5347(12)00142-5">Experimental evolution.</a> TREE. 27, 547-560 (2012).</li>
<li>Fukami, T., Wardle, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Long-term+ecological+dynamics%3A+reciprocal+insights+from+natural+and+anthropogenic+gradients%5BTitle%5D)+AND+%22P+Roy+Soc+B-Biol+Sci%22%5BJournal%5D)">Long-term ecological dynamics: reciprocal insights from natural and anthropogenic gradients.</a> P Roy Soc B-Biol Sci. 272, 2105-2115 (2005).</li>
<li>Merila, J., Hendry, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Climate+change%2C+adaptation%2C+and+phenotypic+plasticity%3A+the+problem+and+the+evidence%5BTitle%5D)+AND+%22Evol+Appl%22%5BJournal%5D)">Climate change, adaptation, and phenotypic plasticity: the problem and the evidence.</a> Evol Appl. 7 (1), 1-14 (2014).</li>
<li>Evans, M. E., Dennehy, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Germ+banking%3A+bet-hedging+and+variable+release+from+egg+and+seed+dormancy%5BTitle%5D)+AND+%22Q+Rev+Biol%22%5BJournal%5D)">Germ banking: bet-hedging and variable release from egg and seed dormancy.</a> Q Rev Biol. 80 (4), 431-451 (2005).</li>
<li>Appleby, P. G. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aAppleby%2C+PG+%22Chronostratigraphic+techniques+in+recent+sediments%22">Chronostratigraphic techniques in recent sediments</a>. 1, Kluwer Academic Publisher. (2001).</li>
<li>Appleby, P. G., et al. <a target="_blank" href="https://link.springer.com/article/10.1007/BF00026640">PB-210 dating by low background gamma-counting.</a> Hydrobiologia. 143, 21-27 (1986).</li>
<li>Bidle, K. D., Lee, S. H., Marchant, D. R., Falkowski, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fossil+genes+and+microbes+in+the+oldest+ice+on+Earth%5BTitle%5D)+AND+%22PNAS%22%5BJournal%5D)">Fossil genes and microbes in the oldest ice on Earth.</a> PNAS. 104, 13455-13460 (2007).</li>
<li>Geerts, A. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+evolution+of+thermal+tolerance+in+the+water+flea+Daphnia%5BTitle%5D)+AND+%22Nat+Clim+Change%22%5BJournal%5D)">Rapid evolution of thermal tolerance in the water flea Daphnia.</a> Nat Clim Change. 5, 665-668 (2015).</li>
<li>Jansen, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Thermal+tolerance+in+the+keystone+species+Daphnia+magna-a+candidate+gene+and+an+outlier+analysis+approach%5BTitle%5D)+AND+%22Mol+Ecol%22%5BJournal%5D)">Thermal tolerance in the keystone species Daphnia magna-a candidate gene and an outlier analysis approach.</a> Mol Ecol. 26 (8), 2291-2305 (2017).</li>
<li>Hairston, N. G. Jr, De Stasio, B. T. Jr <a target="_blank" href="https://www.nature.com/nature/journal/v336/n6196/abs/336239a0.html">Rate of evolution slowed by a dormant propagule pool.</a> Nature. 336, 239-242 (1988).</li>
<li>Hairston, N. G. Jr, et al. <a target="_blank" href="http://www.nature.com/nature/journal/v401/n6752/abs/401446a0.html">Lake ecosystems: Rapid evolution revealed by dormant eggs.</a> Nature. 401, 446(1999).</li>
<li>Weider, L. J., Lampert, W., Wessel, M., Colbourne, J. K., Limburg, P. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1688727/">Long-term genetic shifts in a microcrustacean egg bank associated with anthropogenic changes in the Lake Constance ecosystem.</a> Proc. R. Soc. Lond. B. 264, 1613-1618 (1997).</li>
<li>Kerfoot, W. C., Robbins, J. A., Weider, L. J. <a target="_blank" href="http://onlinelibrary.wiley.com/doi/10.4319/lo.1999.44.5.1232/full">A new approach to historical reconstruction: Combining descriptive and experimental paleolimnology.</a> Limnol Oceanogr. 44 (5), 1232-1247 (1999).</li>
<li>Cousyn, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid%2C+local+adaptation+of+zooplankton+behavior+to+changes+in+predation+pressure+in+the+absence+of+neutral+genetic+changes%5BTitle%5D)+AND+%22PNAS%22%5BJournal%5D)">Rapid, local adaptation of zooplankton behavior to changes in predation pressure in the absence of neutral genetic changes.</a> PNAS. 98, 6256-6260 (2001).</li>
<li>Decaestecker, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Host-parasite+Red+Queen+dynamics+archived+in+pond+sediment%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Host-parasite Red Queen dynamics archived in pond sediment.</a> Nature. 450, 870-874 (2007).</li>
<li>Miner, B. E., De Meester, L., Pfrender, M. E., Lampert, W., Hairston, N. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Linking+genes+to+communities+and+ecosystems%3A+Daphnia+as+an+ecogenomic+model%5BTitle%5D)+AND+%22P+Roy+Soc+B-Biol+Sci%22%5BJournal%5D)">Linking genes to communities and ecosystems: Daphnia as an ecogenomic model.</a> P Roy Soc B-Biol Sci. 279 (1735), 1873-1882 (2012).</li>
<li>Ebert, D. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aEbert%2C+D+%22Ecology%2C+epidemiology%2C+and+evolution+of+parasitism+in+Daphnia%22">Ecology, epidemiology, and evolution of parasitism in Daphnia</a>. , National Library of Medicine (US), National Center for Biotechnology. (2005).</li>
<li>Orsini, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Temporal+genetic+stability+in+natural+populations+of+the+waterflea+Daphnia+magna+in+response+to+strong+selection+pressure%5BTitle%5D)+AND+%22Mol+Ecol%22%5BJournal%5D)">Temporal genetic stability in natural populations of the waterflea Daphnia magna in response to strong selection pressure.</a> Mol Ecol. 25, 6024-6038 (2016).</li>
<li>IPCC. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22Summary+for+policymakers%22">Summary for policymakers</a>. , Cambridge, United Kingdom and New York, NY, USA. 1-32 (2014).</li>
<li>Patmore, I. R., et al. <a target="_blank" href="https://link.springer.com/article/10.1007/s10933-013-9756-0">Big Ben: a new wide-bore piston corer for multi-proxy palaeolimnology.</a> J Paleolimnol. 51 (1), 79-86 (2014).</li>
<li>Wright, H. E. Jr <a target="_blank" href="http://jsedres.geoscienceworld.org/content/37/3/975">A square-rod piston sampler for lake sediments.</a> J Sedimentary Petrology. 37, 975-976 (1967).</li>
<li>Kilham, S. S., Kreeger, D. A., Lynn, S. G., Goulden, C. E., Herrera, L. <a target="_blank" href="https://link.springer.com/article/10.1023/A:1003231628456">COMBO: a defined freshwater culture medium for algae and zooplankton.</a> Hydrobiologia. 377, 147-159 (1998).</li>
<li>Klüttgen, B., Kuntz, N. orbert, Ratte, H. T. <a target="_blank" href="http://www.sciencedirect.com/science/article/pii/0045653596000811">Combined effects of 3,4-dichloroaniune and food concentration on life-table data of two related cladocerans, Daphnia magna and Ceriodaphnia quadrangula.</a> Chemosphere. 32, 2015-2028 (1996).</li>
<li><a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22R%3A+A+language+and+environment+for+statistical+computing%22">R: A language and environment for statistical computing</a>. , Vienna, Austria. (2017).</li>
<li>Jansen, B., Geldof, S., De Meester, L., Orsini, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Isolation+and+characterization+of+microsatellite+markers+in+the+waterflea+Daphnia+magna%5BTitle%5D)+AND+%22Mol+Ecol+Res%22%5BJournal%5D)">Isolation and characterization of microsatellite markers in the waterflea Daphnia magna.</a> Mol Ecol Res. 11, 418-421 (2011).</li>
<li>Orsini, L., Spanier, K. I., De Meester, L. <a target="_blank" href="https://www.researchgate.net/profile/Luisa_Orsini/publication/221759092_Genomic_signature_of_natural_and_anthropogenic_stress_in_wild_populations_of_the_waterflea_Daphnia_magna_Validation_in_space_time_and_experimental_evolution/links/0fcfd50bca54f4110b000000.pdf">Genomic signature of natural and anthropogenic stress in wild populations of the waterflea Daphnia magna: validation in space, time and experimental evolution.</a> Mol Ecol. 21, 2160-2175 (2012).</li>
<li>Verberk, W. C. E. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Does+oxygen+limit+thermal+tolerance+in+arthropods%3F+A+critical+review+of+current+evidence%5BTitle%5D)+AND+%22Comp+Biochem+Physiol+A+Mol+Integr+Physiol%22%5BJournal%5D)">Does oxygen limit thermal tolerance in arthropods? A critical review of current evidence.</a> Comp Biochem Physiol A Mol Integr Physiol. 192, 64-78 (2016).</li>
<li>Frisch, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+millennial-scale+chronicle+of+evolutionary+responses+to+cultural+eutrophication+in+Daphnia%5BTitle%5D)+AND+%22Ecol+Lett%22%5BJournal%5D)">A millennial-scale chronicle of evolutionary responses to cultural eutrophication in Daphnia.</a> Ecol Lett. 17 (3), 360-368 (2014).</li>
<li>Yashina, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Regeneration+of+whole+fertile+plants+from+30%2C000-y-old+fruit+tissue+buried+in+Siberian+permafrost%5BTitle%5D)+AND+%22PNAS%22%5BJournal%5D)">Regeneration of whole fertile plants from 30,000-y-old fruit tissue buried in Siberian permafrost.</a> PNAS. 109, 4008-4013 (2012).</li>
<li>Southam, A. D., Weber, R. J. M., Engel, J., Jones, M. R., Viant, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+complete+workflow+for+high-resolution+spectral-stitching+nanoelectrospray+direct-infusion+mass-spectrometry-based+metabolomics+and+lipidomics%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">A complete workflow for high-resolution spectral-stitching nanoelectrospray direct-infusion mass-spectrometry-based metabolomics and lipidomics.</a> Nat Protoc. 12 (2), 310-328 (2017).</li>
<li>Rhodes, J., Beale, M. A., Fisher, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Illuminating+Choices+for+Library+Prep%3A+A+Comparison+of+Library+Preparation+Methods+for+Whole+Genome+Sequencing+of+Cryptococcus+neoformans+Using+Illumina+HiSeq%5BTitle%5D)+AND+%22Plos+One%22%5BJournal%5D)">Illuminating Choices for Library Prep: A Comparison of Library Preparation Methods for Whole Genome Sequencing of Cryptococcus neoformans Using Illumina HiSeq.</a> Plos One. 9 (11), (2014).</li>
<li>Baym, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inexpensive+Multiplexed+Library+Preparation+for+Megabase-Sized+Genomes%5BTitle%5D)+AND+%22Plos+One%22%5BJournal%5D)">Inexpensive Multiplexed Library Preparation for Megabase-Sized Genomes.</a> Plos One. 10 (5), 6(2015).</li>
<li>Bourcy, C. F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Quantitative+Comparison+of+Single-Cell+Whole+Genome+Amplification+Methods%5BTitle%5D)+AND+%22Plos+One%22%5BJournal%5D)">A Quantitative Comparison of Single-Cell Whole Genome Amplification Methods.</a> Plos One. 9 (8), (2014).</li>
<li>Hasmats, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Assessment+of+whole+genome+amplification+for+sequence+capture+and+massively+parallel+sequencing%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Assessment of whole genome amplification for sequence capture and massively parallel sequencing.</a> PLoS One. 9 (1), e84785(2014).</li>
<li>Becks, L., Ellner, S. P., Jones, L. E., Hairston, N. G. Jr <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+functional+genomics+of+an+eco-evolutionary+feedback+loop%3A+linking+gene+expression%2C+trait+evolution%2C+and+community+dynamics%5BTitle%5D)+AND+%22Ecol+Lett%22%5BJournal%5D)">The functional genomics of an eco-evolutionary feedback loop: linking gene expression, trait evolution, and community dynamics.</a> Ecol Lett. 15 (5), 492-501 (2012).</li>
<li>Ellner, S. P., Geber, M. A., Hairston, N. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Does+rapid+evolution+matter%3F+Measuring+the+rate+of+contemporary+evolution+and+its+impacts+on+ecological+dynamics%5BTitle%5D)+AND+%22Ecol+Lett%22%5BJournal%5D)">Does rapid evolution matter? Measuring the rate of contemporary evolution and its impacts on ecological dynamics.</a> Ecol Lett. 14 (6), 603-614 (2011).</li>
<li>Yoshida, T., Jones, L. E., Ellner, S. P., Fussmann, G. F., Hairston, N. G. Jr <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+evolution+drives+ecological+dynamics+in+a+predator-prey+system%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Rapid evolution drives ecological dynamics in a predator-prey system.</a> Nature. 424 (6946), 303-306 (2003).</li>
<li>Urban, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+evolutionary+ecology+of+metacommunities%5BTitle%5D)+AND+%22TREE%22%5BJournal%5D)">The evolutionary ecology of metacommunities.</a> TREE. 23, 311-317 (2008).</li>
<li>Dokulil, M. T. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aDokulil%2C+MT+%22Eutrophication%3A+Causes%2C+Consequences+and+Control%22">Eutrophication: Causes, Consequences and Control</a>. , Springer. Netherlands. 81-88 (2014).</li>
<li>Urban, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Improving+the+forecast+for+biodiversity+under+climate+change%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Improving the forecast for biodiversity under climate change.</a> Science. 353 (6304), (2016).</li>
<li>Schwartz, S. S., Hebert, P. D. N. <a target="_blank" href="http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2427.1987.tb01057.x/abstract">Methods for the activation of the resting eggs of Daphnia.</a> Freshwater Biol. 17, 373-379 (1987).</li>
<li>Vanderkerhove, J., et al. <a target="_blank" href="http://hera.ugr.es/doi/15773231.pdf">Hatching of cladoceran resting eggs: temperature and photoperiod.</a> Freshwater Biol. 50, 96-104 (2005).</li>
<li>Caceres, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Temporal+variation%2C+dormancy%2C+and+coexistence%3A+a+field+test+of+the+storage+effect%5BTitle%5D)+AND+%22PNAS%22%5BJournal%5D)">Temporal variation, dormancy, and coexistence: a field test of the storage effect.</a> PNAS. 94 (17), 9171-9175 (1997).</li>
<li>Caceres, C. E. <a target="_blank" href="http://onlinelibrary.wiley.com/doi/10.1890/0012-9658(1998)079[1699:IVITAP]2.0.CO;2/abstract">Interspecific variation in the abundance, production, and emergence of Daphnia diapausing eggs.</a> Ecology. 79 (5), 1699-1710 (1998).</li>
</ol>

저자 공개할 게 없다

물의 높은 열 전도도, 인해 민물 생태계는 글로벌 얼굴 지구 생태계 보다 생물 다양성 손실의 더 높은 위험에 온난화34. 그것은, 따라서, 이러한 생태계에서 키스톤 종의 응답을 이해 하 고 열 스트레스를 살아남기 위해 대처 메커니즘을 식별 하는 중요 한. 종 및 지역 사회 수준에서 이러한 메커니즘의 이해 종 지구 온난화에 의해 영향을 어떻게 하 고 어떻게 개별 종에 효과 다른 영양 수준에 폭포를 예측할 수 있습니다. 궁극적으로, 지구 온난화에 대 한 응답의 메커니즘을 이해 하면 멸종을 완화 하기 위해 수정 전략 식별 수 있습니다.
여기에 제시 된 사례 연구 보기 D. 마그나 의 온도 증가 응답은 퍼지 생활 역사 특색에 소성 하 여 중재 하 고 혼자 온도 증가에 응답 분명 피트 니스 비용을 부과 하지 않습니다 이상에 인구 공부 여기. 생활 역사 특색에서 높은 소성 온난화 존재 (하위) 인구의 경쟁 능력에 중요 한 비 차이 의해 지원 됩니다. 그러나, 여러 인구에 장기 경쟁 실험 이러한 연구 결과 일반화 하는 데 필요한 수 있습니다.
부활의 휴면 단계 적응의 메커니즘 및 시간10종 진화의 궤적을 연구 하는 전례 없는 리소스를 제공 합니다. 동물성 플 랭크 톤 종 빠른 생성 시간 (약 2 주), 그리고 경쟁 자체 하위 항목에 대 한 headtohead 또는 ' 재생 ' 다양 한 지난 주에서 시작 진화 조상 수 있는 휴면 단계의 생존에서 혜택. 부활 생태는 기본적으로 특정 진화 결과 몇 가지 사전 행사에 파견 여부의 조사를 수 있습니다. 진화의 유전 요소 식별 미생물을 '조상 라인'은 동결 하 고 회복을 사용 하 여 그들의 진화 하위6비교 분석에 대 한 실험실 실험에서 현재 가능 하다. 그러나, 실험실 유기 체와 협력의 주요 한계 중 하나는 ' 조상 ' 상태가 이미 이동된 기준선입니다. 휴면 단계 연구 표본의 시간 predating 스트레스 이벤트 (예:, 깨끗 한 환경 조건)와 다양 한 과거 상태를 그대로 환경 조건에서 진화 궤적을 측정 하는 샘플링이 있습니다. 까지 현대 시간. 최근 몇 년 동안, 부활 또는 여전히 휴면 동물성 플 랭크 톤 단계에서 DNA 다형성 연구는 현재의 인구14 의 유전 메이크업에 기여한 과거 인구 통계 및 적응 과정에 중요 한 통찰력을 제공 하고있다 , 16 , 25 , 33 , 35 , 36. 높은 처리량 시퀀싱 기술의 높은 접근성으로 게놈 및 transcriptome 부활 또는 여전히 휴면 단계는 시퀀싱 할 수 있습니다 그리고 유전 변화의 수에 인구를 진화에 축적 시간 측정.
여기에 제시 된 SOP 부활에 멀티-omics의 분야의 중요 한 응용 프로그램 사용 하 여 두 가지 수준에서 합니다. 멀티-omics 기술 환경 선택 압력에 대 한 적응 응답에 관련 된 분자 요소의 철저 한 분석을 허용 하는 부활된 표본에 적용할 수 있습니다. 또한, omics 기술 하지만 여전히 휴면 단계 decapsulated에 적용할 수 있습니다. 지금까지, 단계 휴식을 높은 처리량 시퀀싱 기술의 응용 프로그램 입력된 물자의 다량의 요구에 의해 제한 되었습니다 했다. 이러한 제한은 해제37되 고 있습니다. 입력된 자료 및 nanofluidics에서 진행에 대 한 요구 사항을 낮추는 전체 게놈 시퀀싱 (WGS)는 지금 가능한 작은 1 ng 또는 소재38시작의 몇 페이지. 전체 게놈 증폭 (WGA) 및 전체 transcriptome 증폭 (WTA) 기술, DNA와 RNA 아주 적은 양의 조직에서 농축을 사용 사용 metagenomics39,40 , 의료 혁명을 했다합니다 41연구. Decapsulated 휴면 계란에 적용 하는 이러한 기술을 사용 휴면 단계의 생존 능력 및 연장된 기간 (예를 들어, 세기)의 조사와 관련 된 한계를 초과 있습니다.
휴식 단계 생산 무척 추 동물 지역 사회의 부활 공동체 역사 자연 풍경에 알려진된 변경 또는 환경 변화 앙금 orsoils2의 분석에서 유추의 맞춤 수 있습니다. 사회 변화 환경 변화에 대 한 응답에서의 분석 에코 진화 피드백42 인구 지43, 영양 상호44에 실질적인 결과 계량 하는 기능 제공 , 커뮤니티 어셈블리45및 생태계 기능 및 서비스46에 변화. 마지막으로, 환경 변화에 대 한 생물학 응답에 대 한 정확한 예측은 생물 다양성47의 보호 안내 답해야 합니다. 그들은 계정 인구의 통계적 연구, 분산, 진화, 종 상호 작용 등 중요 한 생물 학적 메커니즘을 고려 하지 않습니다 현재 예측 모델이 점에서 정확 하지 않습니다. 이러한 프로세스 시간이 지남에 따라 어떻게 이해 하 고이 정보를 사용 하 여 예측 모델링에 사전으로 종 예측 하 우리의 능력을 향상 됩니다 및 환경 얼굴에 커뮤니티 지 속성 변경2.
여기에 제시 된 SOP의 적용 문제 없이 아니다. 휴면 단계 부활의 기본 제한 샘플링에 대 한 전문 장비입니다. 또한, 앙금 클론 문화의 설립에 체질에서 전체 과정에 상당한 실습 시간이 필요 합니다.
여기에 제시 된 SOP 단계 중 일부는 쉽게 다른 벼룩 종에 게 양도할 수 있습니다. 이들은: 샘플링, 클론 라인과 실험 디자인의 설립. 그러나, 다른 단계는 SOP의 추가 연구 종에 맞는 최적화를 해야 합니다. Decapsulation 종종 해칭 성공을 개선 하 디 마그나 표본에 적용 됩니다. 그러나,이 방법은 작은 견본을 위해 적합 하지 않을 수 있습니다. 종48 및49conspecific 견본 중 자극 부 화 또한 달라질 수 있습니다. 따라서, SOP의 부 화 단계의 특별 최적화 응용 프로그램을 다른 갑각류 전에 필요할 수 있습니다. 이전 결과49라인 디 마그나 인구 호수 반지 (퇴적암 아카이브 걸쳐 30.5%)에서 부활의 부 화 성공을 실행 하는 동안 침전 물, 종 의 보존 상태 따라 부 화 성공 50,51, 그리고 앙금48의 지리적 기원. 항목 및 diapause의 단계를 통해 진행 하는 메커니즘에 대 한 미래의 연구는 다른 종에 맞게 최적의 해칭 자극을 식별 해야 합니다.
마지막으로, 연구 시스템의 지식 배경, 특히 시간이 지남에, 관심의 종의 존재는 것이 좋습니다. 이 역사적 기록을 통해 달성 될 수 있다. 기록 레코드를 사용할 수 없는 경우, 샘플링 및 코어 샘플링 이전 호수 앙금의 표면 층의 상영이 좋습니다, 그것은 가장 최근의 역사에만 정보를 제공할 수 있지만.

장기 학문은 자연에서 및 종에 대응 하 고 환경 변화1동안 유지 하는 어떻게 평가 생태 및 진화 과정을 이해 하는 중요 한. 에코-진화 프로세스 세대에 걸쳐 발생 하 고 오랜 시간 범위 동안 발생 하는 환경 변화 때문입니다. 또한, 장기 연구 환경 변화2자연 생태계의 진화 응답을 예측 하는 예측 모델링의 정확도 개선 하는 주요 경험적 데이터를 제공 합니다. 이러한 모델의 정확도 생물 다양성 및 생태계 서비스를 유지 하기 위해 관리 및 보호 전략을 구현 하는 중요 한 이다.
몇 가지 예외적인 경우 (예를 들어, 갈라파고스 다윈 핀치3 와 조류4) 제외 장기 연구는 종 실험실5,6 에 전파 될 수 있는 짧은 생성 시간으로 제한 , 7 , 8. 따라서 진화 역학을 underpinning 프로세스 애매 남아 있다. 일시적인 샘플 액세스와 관련 된 물류의 어려움 때문에 경험적 데이터에는 공간 보다는 시간적 맥락에서 더 자주 공부 그리고 일시적인 에코 진화 프로세스 유추 또는 공간 데이터에서 모델링. 이 방법은 ' 공간에 대 한 타임 ' 대체9, 공간 임시 진화 역학을 공부 하는 대리로 서 채택 된다 그것에 의하여로 알려져 있다. ' 공간-시간에 대 한 ' 대체의 주요 한계는 다른 공간 스케일에서 적응의 동일한 인구;에 일시적인 변이에서 다 따라서, 시간 공간으로의 교체에 따라 추론 편견된10있습니다.
자연 생태계의 진화 역학을 공부 하 고 시간이 지남에 있도록 강력한 대안 생산 휴면 단계11종에서 생태 및 유전적 변화의 분석 이다. 이러한 휴면 단계 정확 하 게 날짜가 기입 될 수 있는 형태 층 화 생물 학적 아카이브를 축적 하 고 paleolimnologically 특징12,13. 중요 한 것은, 이러한 휴면 단계 회복 하 고 환경 변화에 응답 그들의 진화를 직접 측정 될 수 있다 어디 실험실 실험에서 사용 될 수 있습니다. 역사적인 인구 피트 니스 변화와 환경 변화14,,1516단계에서 진화 하는 유전자의 기능 연구에 그들의 현대 진화 하위 항목에 대 한 경쟁 될 수 있습니다.
휴면 단계는 씨앗, cysts, 포자를 포함 하 고 은행에 그. 부활 생태학의 분야를 정식으로 왔다 비록 늦은 1980 년대17, 그리고 연구의 소수에 다시 회복 휴면 계란 날짜에 첫 번째 연구 초기 1990 년대18,19에이 기술을 적용, 199920에 Kerfoot와 동료의 정액 종이 의해 설립. 이 방법은 주로 민물 종17,,2122의 paleolimnological 개조에 적용 되었습니다. 그러나,는 SOP 불가능 아직 합니다. 여기, 동물성 플 랭크 톤 종 벼룩 마그나 의 휴면 계란에 적용 부활 프로토콜에 대 한 단계별 설명 파묻혀에서 클론 문화의 설립에 앙금의 샘플링에서 제공 됩니다. 쉽게 물 벼룩의 다른 종에 게 양도할 수는 SOP의 단계 뿐만 아니라 추가적인 최적화 필요할 수 있는 단계는 설명 합니다.
벼룩 은 민물 zooplankters lotic 서식23 의 대부분에 존재입니다. 벼룩 종은 중 의무 성적 또는 순환 parthenogens 이다입니다. D. 마그나 유리한 환경 조건24아래 clonally 재현 순환 parthenogen 이다. 언제 환경 조건 저하, 남성 생산과 성적인 재결합 ephippium 라는 틴 케이스에 의해 환경에서 보호 하는 휴면 상태를 입력 수정 된 달걀의 형성에 이르게. 이러한 휴면 계란의 비율 유리한 환경 조건 돌아올 때 부 화 한다. 그러나, 휴면 계란 은행의 큰 비율이 절대 기회를 해치 고 시간이 지남에 따라서 생물 학적 아카이브를 구축 있다. 휴면 단계 호수와 연못의 퇴적 물에 묻혀 유지 하 고 확장 된 기간 동안 진화 역학의 연구에 대 한 부활 될 수 있습니다. D. 마그나 의 휴면 계란 성적인 재결합의 결과 이기 때문에, 그들은 종25의 자연적인 유전적 다양성의 좋은 표현. 또한, 그들은 실험실에서 클론 복제를 통해 유지할 수 있습니다. 이러한 특성 자연 유전적 다양성을 유지 하면서 isogenic 모델 생물의 독특한 장점을 제공 합니다.
두 주요 연구 환경 선택 압력을 경험 하는 시간이 지남에 직접 비교 디 마그나 의 동일한 인구의 역사 및 현대 자손의 이점을 보여 주기 위해 제공 됩니다. D. 마그나 표본 호수 반지 (덴마크), 얕은에서 부활 했다 (5 m 깊이, 표면 22 하) 혼합된 연못 시간별 평균 온도 열 발생의 증가 경험 했다. D. 마그나 (하위) 인구 60 년 (1960-2005 년)이 임시 그라데이션 따라 부활 되었고 온도 온난 진화 응답 조사를 공부. 일반적인 정원 실험에서 첫 번째 연구에서는 피트 니스 연결 생활사 특성에서 변화 곧 100 년에 대 한 기후 변화에 대 한 정부간 패널의 예측에 따라 + 6 ° C의 온도 있는 증가에 대 한 응답에서 측정 26. 두 번째 연구에서 mesocosm 실험 3의 경쟁 능력을 측정 하기 위해 사용 되었다 온난화 아래 (sub) 인구. 이러한 실험 결합 보여줍니다 유일한 스트레스도 온난화의 존재, 모든 생활 역사 특색 및 인구 소성의 높은 수준을 보여 동등한 경쟁 능력을가지고. 이러한 결과 온난화로 단일 스트레스 부과 하지 않습니다 중요 한 건강 비용, 적어도 인구에서 공부 했다고 여기 좋습니다.

<table><tbody><tr><td>sampling bags</td><td>Fisher Scientific</td><td>11542783</td><td>Sampling bag revolve round wires closure system and safety tabs sterile polyethylene with writing area clear 89&amp;micro;m thickness 140mm x 229mm, 720mL Fisherbrand</td></tr><tr><td>piston corer</td><td>ENSIS ltd</td><td>na</td><td>Long, heavy tube plunged into the sea, lake, pond floor to extract samples of mud sediment. Piston corers have a viariable diameter and are generally in PVC</td></tr><tr><td>precision scale</td><td>Veritas-M124A</td><td>TLP-50</td><td>Analytical Balance</td></tr><tr><td>geological sieve</td><td>UKGE limited</td><td>SV7521</td><td>200 mm diameter geological sieve - 1 mm mesh</td></tr><tr><td>geological sieve</td><td>UKGE limited</td><td>SV7525</td><td>200 mm diameter geological sieve - 0.125 mm mesh</td></tr><tr><td>white sampling tray</td><td>nhbs</td><td>http://www.nhbs.com/title/view/159614?ad_id=1509</td><td>Standard mulipurpose lab trays</td></tr><tr><td>pasteur pipette</td><td>Globe Scientific inc.</td><td>138020B</td><td>Transfer Pipet, 1.7mL, General Purpose, 87mm, Bulb Draw - 0.9mL</td></tr><tr><td>stereo microscope</td><td>nikon</td><td>smz800</td><td>Microscope with magnification range 1x -8x linked to a camera control unit</td></tr><tr><td>petri dish</td><td>EduLab</td><td>153-533</td><td>Sterile 90mm diameter plastic petri dish</td></tr><tr><td>glass jars</td><td>compak</td><td>Round Jam Jars 4oz</td><td>100 mL jars</td></tr><tr><td>glass jars</td><td>compak</td><td>Atum Jars/ Bonta Jar 10oz</td><td>200 mL jars</td></tr><tr><td>glass jars</td><td>bottlecompanysouth</td><td>500ml Food Jam Jar With Twist Off Lid</td><td>500 mL jars</td></tr><tr><td>statistical software R</td><td>https://cran.r-project.org/</td><td>na</td><td>Free online GNU&amp;nbsp; language and environment for statistical computing and graphics</td></tr><tr><td>microdissection forceps</td><td>Fisher Scientific</td><td>41122405</td><td>Fine point stainless steel forceps for microdissections</td></tr><tr><td>image software</td><td>https://imagej.nih.gov/ij/index.html</td><td>na</td><td>Open source ImageJ image processing toolkit written in Java</td></tr><tr><td>mesocosm</td><td>amazon</td><td>na</td><td>Nobby Fauna-Box III, 41 x 23 x 29 cm, 20.0 Liter</td></tr><tr><td>mirocentrifuge tubes</td><td>Sigma_Aldrick - Merck</td><td>Z606340</td><td>premium microcentrifuge tubes 1.5 mL</td></tr><tr><td>AGENCOURT DNAdvance</td><td>Beckman Coulter</td><td>A48705</td><td>DNA extraction kit</td></tr><tr><td>size standard</td><td>Thermo Fisher Scientific</td><td>4322682</td><td>LIZ500 - Size standard compatible with ABI sequencers</td></tr><tr><td>ABI3032 sequencer</td><td>ABI</td><td>na</td><td>Sequencer used to perform fragment analysis or sanger sequencing</td></tr></tbody></table>

resurrection of dormant daphnia magna: protocol and applications

장기 연구 연장된 기간 동안 발생 하는 에코 진화 프로세스의 식별 가능 또한, 그들은 미래의 환경 변화에 자연 생태계의 진화 응답 예측을 예측 모델링에 사용할 수 있는 키 경험적 데이터를 제공 합니다. 그러나, 몇 가지 예외적인 경우를 제외 하 고 장기 연구는 부족 한 시간 샘플 액세스와 관련 된 물류 어려움 때문에. 일시적인 역동성은 자주 공부 제어 mesocosm 실험 또는 실험실에서 야생의 자연 인구의 진화를 재구성 하는 뛰어난 연구.
여기, 표준 운영 절차 (SOP) 부활 또는 휴면 벼룩 마그나, 수생 생태계에 광범위 하 게 동물성 플 랭크 톤 키스톤 종-의 상태--예술 경도 데이터 수집을 극적으로 부활에 제공 됩니다. 자연 시스템입니다. 부활 생태 분야 diapausing 동물성 플 랭크 톤 계란 날짜 1980 년대 후반에 다시 부 화에 첫 번째 시도도 불구 Kerfoot와 동료에 의해 1999 년에 정의 되었다. Kerfoot의 정액 종이, 이후 동물성 플 랭크 톤 종 부활의 방법론은 점점 더 자주 적용 되었다, 비록 직접 지식 이전을 통해 실험실 중 전파. 여기, SOP 휴면 벼룩 마그나 부활의 연습에는 단계별 프로토콜 제공 하 설명 계란.
두 가지 주요 연구 같은 설정에서 역사적이 고 현대적인 인구를 공부 하는 능력에 대문자의 피트 니스 응답 벼룩 마그나 인구에 있는 부활에 측정은 온난, 제공 됩니다. 마지막으로, 부활 또는 여전히 휴면 단계를 다음 세대 시퀀싱 기술의 응용 프로그램을 설명 합니다. 이러한 기술은 프로세스와 진화 시간이 지남에 선택 압력에 변화를 경험 했다 인구에 적용 하는 경우의 메커니즘을 해 부에 전례 없는 힘을 제공 합니다.

장기 경험적 데이터는 진화 역학의 이해와 자연 인구의 지 속성을 중요 합니다. 이러한 데이터는 일반적으로 일시적인 샘플 및 데이터 수집에 장기 투입의 요구와 관련 된 물류 어려움 때문에 얻기 위해 도전. 여기에 제시 된 두 가지 주요 연구에서 담 수 생태계에서 중앙 zooplankter의 온도에 대 한 응답의 경험적 증거는 진화 시간에 제공 됩니다. 이것은 일반적인 실험 설정에서 환경 스트레스에 대 한 역사적인 인구 및 그들의 현대 자손의 응답을 공부 하는 기회를 제공 하는 계층화 된 휴면 난 자 은행을 사용 하 여 활성화 됩니다.
일반적인 정원 실험 일반적인 정원 실험 모든 생활사 특성 온도에 응답을 보여주었다 (그림 6 및 그림 7). ANOVA 분석 모든 (하위) 인구 사망률, 응답 하지 않는 제외한 소성 (표 2)를 통해 온도에 응답을 공개 했다. 증거 진화 변화 (차이 (하위) 인구 가운데)의 인구 증가율 (표 2), 3의 2에서 크게 증가 관찰 되었다 24 ° C (그림 6)에서 (하위) 인구.
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56637/56637fig6.jpg"> 그림 6: 일반적인 정원 실험. 생활 역사 특색 (통치, 크기, 및 성숙에 나이)와 인구 증가율 (r)에 대 한 반응 규범 온난화 (24 ° C)에 일반적인 정원와 현재 온도 정권 (18 ° C) 온도에서 각 (하위) 인구에 대 한 표시 됩니다. 인구 증가율 'r' 오일러 방정식 (1)를 사용 하 여 계산 됩니다. 신뢰 간격으로 표시 됩니다. (하위) 색상 코드는: (i) 블루: 1960-1970 년; (2) 녹색: 1970-1985 년; (iii) 레드: > 1999. <a href="//cloudflare.jove.com/files/ftp_upload/56637/56637fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/56637/56637fig7.jpg"> 그림 7: 사망률. (하위) 인구 당 사망률 (1960-1970 년, 1970-1985 년; > 1999) 현대 온도 정권 (18 ° C)에 비해 지구 온난화 (24 ° C)에서 표시 됩니다. <a href="//cloudflare.jove.com/files/ftp_upload/56637/56637fig7large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
Mesocosm 실험 4 주 후 선택, 24 ° C, 3의 주파수에서 온난 하 여 표현 (하위) 인구는 크게 변화 하지 않았다 (χ2 = 0.55, P = 0.76) 초기 inoculum (그림 8)에 비해. 30 genotypes mesocosm 실험에 주사, 중 대다수는 선택 (그림 9)의 4 주 후에 확인 되었다. 특히, 접종된 genotypes의 70%는 복구 된, Poissonian 32 개인의 견본에서 각 유전자의 적어도 1 명의 대표자를 회복의 기대와 호환 했다.
<img alt="Figure 8" class="xfigimg" src="/files/ftp_upload/56637/56637fig8.jpg"> 그림 8: 경쟁 실험-인구 주파수. 인구 평균 중간 및 quartiles (25일 , 75일), 3에 대 한 표시 됩니다 (하위) 인구의 D. 마그나 mesocosm 경쟁 실험 (24 ° C), (초기 동등한 주파수에 비해 선택의 4 주 후 시작)입니다. (하위) 인구는 그림 6에서처럼 색상. <a href="//cloudflare.jove.com/files/ftp_upload/56637/56637fig8large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 9" class="xfigimg" src="/files/ftp_upload/56637/56637fig9.jpg"> 그림 9: 경쟁 실험-유전자 형 주파수. 유전자 형 주파수-평균된 중간과 quartiles (25일 , 75회) 지구 온난화 (24 ° C) genotypes (점선)의 초기 동등한 주파수 비교에 노출의 4 주 후 표시 됩니다. X 축에 (하위) 인구 당 그룹화 접종된 genotypes ID (빨강, 녹색, 1970-1985 년; 블루, 1960-1970 년 > 1999). <a href="//cloudflare.jove.com/files/ftp_upload/56637/56637fig9large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>로커 스</td>
			<td>는</td>
			<td>크기 범위 (bp)</td>
			<td colspan="2">프라이 머 (5'-3')</td>
			<td>염료 레이블</td>
			<td>모티브를 반복</td>
			<td>Tm</td>
		</tr>
<tr>
<td rowspan="2">B008</td>
			<td rowspan="2">HQ234154</td>
			<td rowspan="2">150-170</td>
			<td colspan="2">F: TGGGATCACAACGTTACACAA</td>
			<td rowspan="2">빅</td>
			<td rowspan="2">(TC) 9
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: GCTGCTCGAGTCCTGAAATC</td>
		</tr>
<tr>
<td rowspan="2">B030</td>
			<td rowspan="2">HQ234160</td>
			<td rowspan="2">154-172</td>
			<td colspan="2">F: CCAGCACACAAAGACGAA</td>
			<td rowspan="2">애완 동물</td>
			<td rowspan="2">(GA) 11
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: ACCATTTCTCTCCCCCAACT</td>
		</tr>
<tr>
<td rowspan="2">B045</td>
			<td rowspan="2">HQ234168</td>
			<td rowspan="2">118-126</td>
			<td colspan="2">F: GCTCATCATCCCTCTGCTTC</td>
			<td rowspan="2">NED</td>
			<td rowspan="2">(안내) 8
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: ATAGTTTCAGCAACGCGTCA</td>
		</tr>
<tr>
<td rowspan="2">B050</td>
			<td rowspan="2">HQ234170</td>
			<td rowspan="2">234-248</td>
			<td colspan="2">F: TTTCAAAAATCGCTCCCATC</td>
			<td rowspan="2">6FAM</td>
			<td rowspan="2">(GAA) 6
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: TATGGCGTGGAATGTTTCAG</td>
		</tr>
<tr>
<td rowspan="2">B064</td>
			<td rowspan="2">HQ234172</td>
			<td rowspan="2">135-151</td>
			<td colspan="2">F: CTCCTTAGCAACCGAATCCA</td>
			<td rowspan="2">6FAM</td>
			<td rowspan="2">(TC) 8
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: CAAACGCGTTCGATTAAAGA</td>
		</tr>
<tr>
<td rowspan="2">B074</td>
			<td rowspan="2">HQ234174</td>
			<td rowspan="2">196-204</td>
			<td colspan="2">F: TCTTTCAGCGCACAATGAAT</td>
			<td rowspan="2">NED</td>
			<td rowspan="2">(GT) 9
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: TGTGTTCCTTGTCAACTGTCG</td>
		</tr>
<tr>
<td rowspan="2">B096</td>
			<td rowspan="2">HQ234181</td>
			<td rowspan="2">234-240</td>
			<td colspan="2">F: GGATCTGGCAGGAAGTGGTA</td>
			<td rowspan="2">빅</td>
			<td rowspan="2">(AC) 15
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: TTGAACCACGTCGAGGATTT</td>
		</tr>
<tr>
<td rowspan="2">B107</td>
			<td rowspan="2">HQ234184</td>
			<td rowspan="2">250-274</td>
			<td colspan="2">F: GGGGTGAAGCATCAAAGAAA</td>
			<td rowspan="2">애완 동물</td>
			<td rowspan="2">(CT) 8
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: TGTGACCAGGATAAGAGAAGAGG</td>
		</tr>
</tbody></table>표 1: Microsatellite 멀티플렉스. NCBI 승인 번호 (AN), 다중 정보, PCR 뇌관 시퀀스, PCR 크기 범위, 반복 주제, 라벨 앞으로 뇌관 및 어 닐 링 온도 (Tm) 표시 하는 데 사용 하는 염료.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td colspan="2">팝 성장 율 (r)</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">진화 (팝)</td>
			<td>2</td>
			<td>30.309</td>
			<td>< 0.001</td>
		</tr>
<tr>
<td colspan="2">소성 (온도)</td>
			<td>1</td>
			<td>531.546</td>
			<td>< 0.001</td>
		</tr>
<tr>
<td colspan="2">Evol입니다. 소성 (팝 x 온도)</td>
			<td>2</td>
			<td>65.137</td>
			<td>< 0.001</td>
		</tr>
<tr>
<td colspan="2">사망률</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">진화 (팝)</td>
			<td>2</td>
			<td>2.234</td>
			<td>0.1162</td>
		</tr>
<tr>
<td colspan="2">소성 (온도)</td>
			<td>1</td>
			<td>2.679</td>
			<td>0.1071</td>
		</tr>
<tr>
<td colspan="2">Evol입니다. 소성 (팝 x 온도)</td>
			<td>2</td>
			<td>1.8657</td>
			<td>0.164</td>
		</tr>
<tr>
<td colspan="2">통치</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">진화 (팝)</td>
			<td>2</td>
			<td>1.8852</td>
			<td>0.1633</td>
		</tr>
<tr>
<td colspan="2">소성 (온도)</td>
			<td>1</td>
			<td>6.8934</td>
			<td>0.0117</td>
		</tr>
<tr>
<td colspan="2">Evol입니다. 소성 (팝 x 온도)</td>
			<td>2</td>
			<td>1.6511</td>
			<td>0.203</td>
		</tr>
<tr>
<td colspan="2">만기에 크기</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">진화 (팝)</td>
			<td>2</td>
			<td>0.211</td>
			<td>0.8106</td>
		</tr>
<tr>
<td colspan="2">소성 (온도)</td>
			<td>1</td>
			<td>11.1361</td>
			<td>0.0017</td>
		</tr>
<tr>
<td colspan="2">Evol입니다. 소성 (팝 x 온도)</td>
			<td>2</td>
			<td>0.6586</td>
			<td>0.5225</td>
		</tr>
<tr>
<td colspan="2">성숙에 나이</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">진화 (팝)</td>
			<td>2</td>
			<td>0.7811</td>
			<td>0.4637</td>
		</tr>
<tr>
<td colspan="2">소성 (온도)</td>
			<td>1</td>
			<td>8.0764</td>
			<td>0.0066</td>
		</tr>
<tr>
<td colspan="2">Evol입니다. 소성 (팝 x 온도)</td>
			<td>2</td>
			<td>0.088</td>
			<td>0.9159</td>
		</tr>
</tbody></table>표 2: 분산 분석 (ANOVA). 생활 역사 특색 및 온난화에 노출 부활된 (하위) 인구의 인구 증가율 변화 적응 진화 (인구), 소성 (열 처리)에 의해 설명 여부 테스트 분산 분석 및 그들의 상호 작용 기간 (소성의 진화)입니다. 중요 한 p-값 (p< 0.05) 굵게 표시 됩니다.
보충 비디오 1: 퇴적 코어의 샘플링. 빅 벤 corer 사용 하 여 표시 됩니다. 빅 벤은 14 cm의 내부 튜브 직경 길이 약 1.5 m의 코어 튜브. 밧줄에 있는 막대는 침전 물에 튜브를 연결 corer 머리 피스톤 그것에 의하여 이루어져 있다. 핵심 포 수는 작은 그릇에서 배포 된 코어 튜브를 지 원하는 데 사용 됩니다. 피스톤 중력 압력은 앙금으로 푸시됩니다. 프레임 워크 수정된 병 잭 위쪽으로 피스톤을 못 살게 굴지를 사용 하 여 실시 압출 과정에서 코어 튜브를 지 원하는 데 사용 됩니다. 각 퇴적 층 평면 금속 표면에 수집 및 장기 저장에 대 한 투명 한 샘플링 가방 전송 [어둡고 차가운 (4 ° C) 조건]. <a href="http://cloudflare.jove.com/files/ftp_upload/56637/Supplementary_video1_Sampling.mp4">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>
보충 비디오 2: 앙금 체질. 앙금을 체질에 필요한 장비는 정밀 규모, 흰색 샘플링 쟁반 및 지질 체. 각 퇴적 층에서 적어도 5 g는 방사성 연대 측정에 대 한 유지 됩니다. 나머지는 앙금의 ephippia를 분리 하는 데 사용 됩니다. 퇴적 물은 통해 두 지질 체, 1 m m와 다른 각각의 위에 쌓여 125 µ m 메쉬 크기와 두 번째 sieved입니다. 매체는 찰 흙, 대형 무척 추 동물, 및 미 립 자 물질을 1 mm 메쉬 체에 부 어. 125 µ m 메쉬 두 번째 체에 부 어 보통 디 마그나 ephippia 및 작은 미 립 자 물질을 분리 합니다. 토사의 aliquots 다음 흰색 샘플링 용지함에 전송 됩니다. D. 마그나 ephippia 흰색 배경 트레이에 눈으로 발견 됩니다. 각 계층에서 Ephippia는 별도 접시에 수집 됩니다. <a href="http://cloudflare.jove.com/files/ftp_upload/56637/Supplementary_video2_Sieving_sediment.mp4">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>
보충 비디오 3: Decapsulation. 아래는 stereomicroscope 디 마그나 ephippia 틴 케이스의 척추에 압력을 적용 하 여 서 집게와 함께 열립니다. 내부 계란 막 섬세 하 게 제거 되 고 매체의 10 mL를 포함 하는 배양 접시에 파스퇴르 피 펫 전송 부드럽게 달걀을 휴식. <a href="http://cloudflare.jove.com/files/ftp_upload/56637/Supplementary_video3_Decapsulation.mp4">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>
보충 비디오 4: 화. 20 ° C와 긴 photoperiod 노출, 배아 개발 48 h와 몇 주 사이 다시 시작합니다. 개발 완료 되 면 배아 계란 껍질에서 무료로 휴식 그리고 매체에서 자유롭게 수영. <a href="http://cloudflare.jove.com/files/ftp_upload/56637/Supplementary_video4_Hatching.mp4">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Resurrection of Dormant Daphnia magna: Protocol and Applications at JoVE.com

Resurrection of Dormant Daphnia magna: Protocol and Applications

장기 연구는 진화의 과정 및 적응의 메커니즘을 이해 하는 데 필수적입니다. 일반적으로, 이러한 연구는 연구자의 생활 시간 넘어 약속 필요합니다. 여기, 강력한 방법은 극적으로 자연 시스템에 경도 데이터를 생성 하기 위해 최신의 데이터 수집을 진행 하는 설명 합니다.

부활의 휴면 벼룩 마그나: 프로토콜 및 응용 프로그램

Long-term studies enable the identification of eco-evolutionary processes that occur over extended time periods. In addition, they provide key empirical ...

resurrection-of-dormant-daphnia-magna-protocol-and-applications

Research

JoVE Journal

Environment

Resurrection of Dormant Daphnia magna: Protocol and Applications

18.3K 조회수.  University of Birmingham. 장기 연구는 진화의 과정 및 적응의 메커니즘을 이해 하는 데 필수적입니다. 일반적으로, 이러한 연구는 연구자의 생활 시간 넘어 약속 필요합니다. 여기, 강력한 방법은 극적으로 자연 시스템에 경도 데이터를 생성 하기 위해 최신의 데이터 수집을 진행 하는 설명 합니다.

비디오: Resurrection of Dormant Daphnia magna: Protocol and Applications

A Simple Approach to Manipulate Dissolved Oxygen for Animal Behavior Observations

The ability to manipulate dissolved oxygen (DO) in a laboratory setting has significant application to investigate a number of ecological and organismal behavior questions. The protocol described here provides a simple, reproducible, and controlled method to manipulate DO to study behavioral response in aquatic organisms resulting from hypoxic and anoxic conditions. While performing degasification of water with nitrogen is commonly used in laboratory settings, no explicit method for ecological (aquatic) application exists in the literature, and this protocol is the first to describe a protocol to degasify water to observe organismal response. This technique and protocol were developed for direct application for aquatic macroinvertebrates; however, small fish, amphibians, and other aquatic vertebrates could be easily substituted. It allows for easy manipulation of DO levels ranging from 2 mg/L to 11 mg/L with stability for up to a 5 min animal-observation period. Beyond a 5 min observation period water temperatures began to rise, and at 10 min DO levels became too unstable to maintain. The protocol is scalable to the study organism, reproducible, and reliable, allowing for rapid implementation into introductory teaching labs and high-level research applications. The expected results of this technique should relate dissolved oxygen changes to behavioral responses of organisms.

This article describes a simple and reproducible protocol to manipulate dissolved oxygen conditions in a laboratory setting for animal behavior studies. This protocol may be used in both teaching and research laboratory settings to evaluate organismal response of macroinvertebrates, fishes, or amphibians to changes in dissolved oxygen concentration.

간단한 접근 방식은 동물 행동 관찰을위한 용존 산소를 조작하는

The ability to manipulate dissolved oxygen (DO) in a laboratory setting has significant application to investigate a number of ecological and organismal ...

연구

환경과학

Basic Methods for the Study of Reproductive Ecology of Fish in Aquaria

Captive-rearing observations are valuable for revealing aspects of fish behavior and ecology when continuous field investigations are impossible. Here, a series of basic techniques are described to enable observations of the reproductive behavior of a wild-caught gobiid fish, as a model, kept in an aquarium. The method focuses on three steps: collection, transport, and observations of reproductive ecology of a substrate spawner. Essential aspects of live fish collection and transport are (1) preventing injury to the fish, and (2) careful acclimation to the aquarium. Preventing harm through injuries such as scratches or a sudden change of water pressure is imperative when collecting live fish, as any physical damage is likely to negatively affect the survival and later behavior of the fish. Careful acclimation to aquaria decreases the incidence death and mitigates the shock of transport. Observations during captive rearing include (1) the identification of individual fish and (2) monitoring spawned eggs without negative effects to the fish or eggs, thereby enabling detailed investigation of the study species' reproductive ecology. The subcutaneous injection of a visible implant elastomer (VIE) tag is a precise method for the subsequent identification of individual fish, and it can be used with a wide size range of fish, with minimal influence on their survival and behavior. If the study species is a substrate spawner that deposits adhesive eggs, an artificial nest site constructed from polyvinyl chloride (PVC) pipe with the addition of a removable waterproof sheet will facilitate counting and monitoring the eggs, lessening the investigator's influence on the nest-holding and egg-guarding behavior of the fish. Although this basic method entails techniques that are seldom mentioned in detail in research articles, they are fundamental for undertaking experiments that require the captive rearing of a wild fish.

A series of basic methods to enable the study of the reproductive ecology of fish kept in aquaria are described. These are useful protocols for collecting fish using SCUBA, transporting live fish, and observing the reproductive behavior of wild-caught fish kept in aquaria.

Aquaria에서 물고기의 생식 생태학 연구를위한 기본 방법

Captive-rearing observations are valuable for revealing aspects of fish behavior and ecology when continuous field investigations are impossible. Here, a ...

행동분석학

Swimming Induced Paralysis to Assess Dopamine Signaling in Caenorhabditis elegans

The swimming assay described in this protocol is a valid tool to identify proteins regulating the dopaminergic synapses. Similar to mammals, dopamine (DA) controls several functions in C. elegans including learning and motor activity. Conditions that stimulate DA release (e.g., amphetamine (AMPH) treatments) or that prevent DA clearance (e.g., animals lacking the DA transporter (dat-1) which are incapable of reaccumulating DA into the neurons) generate an excess of extracellular DA ultimately resulting in inhibited locomotion. This behavior is particularly evident when animals swim in water. In fact, while wild-type animals continue to swim for an extended period, dat-1 null mutants and wild-type treated with AMPH or inhibitors of the DA transporter sink to the bottom of the well and do not move. This behavior is termed "Swimming Induced Paralysis" (SWIP). Although the SWIP assay is well established, a detailed description of the method is lacking. Here, we describe a step-by-step guide to perform SWIP. To perform the assay, late larval stage-4 animals are placed in a glass spot plate containing control sucrose solution with or without AMPH. Animals are scored for their swimming behavior either manually by visualization under a stereoscope or automatically by recording with a camera mounted on the stereoscope. Videos are then analyzed using a tracking software, which yields a visual representation of thrashing frequency and paralysis in the form of heat maps. Both the manual and automated systems guarantee an easily quantifiable readout of the animals' swimming ability and thus facilitate screening for animals bearing mutations within the dopaminergic system or for auxiliary genes. In addition, SWIP can be used to elucidate the mechanism of action of drugs of abuse such as AMPH.

Swimming Induced Paralysis to Assess Dopamine Signaling in Caenorhabditis elegans

Swimming induced paralysis (SWIP) is a well-established behavioral assay used to study the underlying mechanisms of dopamine signaling in Caenorhabditis elegans (C. elegans). However, a detailed method to perform the assay is lacking. Here, we describe a step-by-step protocol for SWIP.

꼬마 선 충 에서 도파민 신호 평가에 수영 유도 마비

The swimming assay described in this protocol is a valid tool to identify proteins regulating the dopaminergic synapses. Similar to mammals, dopamine (DA) ...

초파리 균주의 장기 보존을 위한 PGC의 동결 보존

Primordial Germ Cell Cryopreservation and Revival of Drosophila Strains

Drosophila strains must be maintained by the frequent transfer of adult flies to new vials. This carries a danger of mutational deterioration and phenotypic changes. Development of an alternative method for long-term preservation without such changes is therefore imperative. Despite previous successful attempts, cryopreservation of Drosophila embryos is still not of practical use because of low reproducibility. Here, we describe a protocol for primordial germ cell (PGC) cryopreservation and strain revival via transplantation of cryopreserved PGCs into agametic Drosophila melanogaster (D. melanogaster) host embryos. PGCs are highly permeable to cryoprotective agents (CPAs), and developmental and morphological variation among strains is less problematic than in embryo cryopreservation. In this method, PGCs are collected from approximately 30 donor embryos, loaded into a needle after CPA treatment, and then cryopreserved in liquid nitrogen. To produce donor-derived gametes, the cryopreserved PGCs in a needle are thawed and then deposited into approximately 15&#160;agametic host embryos. A frequency of at least 15% fertile flies was achieved with this protocol, and the number of progeny per fertile couple was always more than enough to revive the original strain (the average progeny number being 77.2 &#177; 7.1), indicating the ability of cryopreserved PGCs to become germline stem cells. The average number of fertile flies per needle was 1.1 &#177; 0.2, and 9 out of 26 needles produced two or more fertile progeny. It was found that 11 needles are enough to produce 6 or more progeny, in which at least one female and one male are likely included. The agametic host makes it possible to revive the strain quickly by simply crossing newly emerged female and male flies. In addition, PGCs have the potential to be used in genetic engineering applications, such as genome editing.

저자 스포트라이트: PGC 냉동 보존 – 초파리 균주의 장기 보존을 위한 대안적 접근 방식 

A long-term preservation method for Drosophila strains as an alternative to the frequent transfer of adult flies to fresh food vials is highly desirable. This protocol describes the cryopreservation of Drosophila primordial germ cells and strain revival via their transplantation to agametic host embryos.

Primordial Germ Cell Cryopreservation and Revival of Drosophila Strains(초파리 균주의 원시 생식세포 냉동 보존 및 부활)

Drosophila strains must be maintained by the frequent transfer of adult flies to new vials. This carries a danger of mutational deterioration and ...

유전학

Large-Scale Gravitaxis Assay of Caenorhabditis Dauer Larvae

Gravity sensation is an important and relatively understudied process. Sensing gravity enables animals to navigate their surroundings and facilitates movement. Additionally, gravity sensation, which occurs in the mammalian inner ear, is closely related to hearing - thus, understanding this process has implications for auditory and vestibular research. Gravitaxis assays exist for some model organisms, including Drosophila. Single worms have previously been assayed for their orientation preference as they settle in solution. However, a reliable and robust assay for Caenorhabditis gravitaxis has not been described. The present protocol outlines a procedure for performing gravitaxis assays that can be used to test hundreds of Caenorhabditis dauers at a time. This large-scale, long-distance assay allows for detailed data collection, revealing phenotypes that may be missed on a standard plate-based assay. Dauer movement along the vertical axis is compared with horizontal controls to ensure that directional bias is due to gravity. Gravitactic preference can then be compared between strains or experimental conditions. This method can determine molecular, cellular, and environmental requirements for gravitaxis in worms.

Large-Scale Gravitaxis Assay of Caenorhabditis Dauer Larvae

The present protocol outlines methods for conducting a large-scale gravitaxis assay with Caenorhabditis dauer larvae. This protocol allows for better detection of gravitaxis behavior compared with a plate-based assay.

Caenorhabditis dauer 유충의 대규모 중력 분석

Gravity sensation is an important and relatively understudied process. Sensing gravity enables animals to navigate their surroundings and facilitates ...

Lethality Bioassay Using Artemia salina L.

Natural products have been used since ancient times to produce medicines. Nowadays, there are plenty of chemotherapeutic drugs obtained from natural sources and used against a plethora of diseases. Unfortunately, most of these compounds often display systemic toxicity and adverse effects. In order to better evaluate the tolerability of selected potentially bioactive samples, brine shrimp (Artemia salina) is generally used as a model in lethality studies. The A. salina test is based on the ability of the studied bioactive compounds to kill the microcrustaceans in their larval stage (nauplii). This method represents a convenient starting point for cytotoxicity studies, as well as for the general toxicity screening of synthetic, semisynthetic, and natural products. It can be considered a simple, quick, and low-cost assay, compared to many other assays (in vitro cells or yeast strains, zebrafish, rodents) generally suitable for the aforementioned purposes; moreover, it can be easily performed even without any specific training. Overall, A. salina assay represents a useful tool for the preliminary toxicity evaluation of selected compounds and the bio-guided fractionation of natural product extracts.

Lethality Bioassay Using Artemia salina L.

This work aims to evaluate and review the Artemia salina lethality bioassay procedure, also identified as brine shrimp lethality assay. This simple and cheap method gives information about the general toxicity (considered as a preliminary toxicity evaluation) of samples, namely, natural products.

아르테미아 살리나 L을 사용한 치사율 생물학적 분석법

Natural products have been used since ancient times to produce medicines. Nowadays, there are plenty of chemotherapeutic drugs obtained from natural ...

화학

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal lines have enabled biological processes to be studied in the context of a living, and in some instances even behaving, organism. In this protocol we will describe how to anesthetize intact Drosophila larvae, using the volatile anesthetic desflurane, to follow the development and plasticity of synaptic populations at sub-cellular resolution1-3. While other useful methods to anesthetize Drosophila melanogaster larvae have been previously described4,5,6,7,8, the protocol presented herein demonstrates significant improvements due to the following combined key features: (1) A very high degree of anesthetization; even the heart beat is arrested allowing for lateral resolution of up to 150 nm1, (2) a high survival rate of &gt; 90% per anesthetization cycle, permitting the recording of more than five time-points over a period of hours to days2 and (3) a high sensitivity enabling us in 2 instances to study the dynamics of proteins expressed at physiological levels. In detail, we were able to visualize the postsynaptic glutamate receptor subunit GluR-IIA expressed via the endogenous promoter1 in stable transgenic lines and the exon trap line FasII-GFP1. (4) In contrast to other methods4,7 the larvae can be imaged not only alive, but also intact (i.e. non-dissected) allowing observation to occur over a number of days1. The accompanying video details the function of individual parts of the in vivo imaging chamber2,3, the correct mounting of the larvae, the anesthetization procedure, how to re-identify specific positions within a larva and the safe removal of the larvae from the imaging chamber.

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

This protocol describes a reliable method for anesthetization and imaging of intact Drosophila melanogaster larvae. We have utilized the volatile anesthetic desflurane to allow for repetitive imaging at sub-cellular resolution and re-identification of structures for up to a few days1.

서브 세포 해상도 손상 Drosophila의 애벌레의 생체내 이미징에서

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal ...

생물학

Neural Stem Cell Reactivation in Cultured Drosophila Brain Explants

Neural stem cells (NSCs) have the ability to proliferate, differentiate, undergo apoptosis, and even enter and exit quiescence. Many of these processes are controlled by the complex interplay between NSC intrinsic genetic programs with NSC extrinsic factors, local and systemic. In the genetic model organism, Drosophila melanogaster, NSCs, known as neuroblasts (NBs), switch from quiescence to proliferation during the embryonic to larval transition. During this time, larvae emerge from their eggshells and begin crawling, seeking out dietary nutrients. In response to animal feeding, the fat body, an endocrine organ with lipid storage capacity, produces a signal, which is released systemically into the circulating hemolymph. In response to the fat body-derived signal (FBDS), Drosophila insulin-like peptides (Dilps) are produced and released from brain neurosecretory neurons and glia, leading to downstream activation of PI3-kinase growth signaling in NBs and their glial and tracheal niche. Although this is the current model for how NBs switch from quiescence to proliferation, the nature of the FBDS extrinsic cue remains elusive. To better understand how NB extrinsic systemic cues regulate exit from quiescence, a method was developed to culture early larval brains in vitro before animal feeding. With this method, exogenous factors can be supplied to the culture media and NB exit from quiescence assayed. We found that exogenous insulin is sufficient to reactivate NBs from quiescence in whole-brain explants. Because this method is well-suited for large-scale screens, we aim to identify additional extrinsic cues that regulate NB quiescence versus proliferation decisions. Because the genes and pathways that regulate NSC proliferation decisions are evolutionarily conserved, results from this assay could provide insight into improving regenerative therapies in the clinic.

Neural Stem Cell Reactivation in Cultured Drosophila Brain Explants

A method to reactivate quiescent neural stem cells in cultured Drosophila brain explants has been established. Using this method, the role of systemic signals can be uncoupled from tissue-intrinsic signals in the regulation of neural stem cell quiescence, entry and exit.

배양된 초파리 뇌 외래 식물에서 신경 줄기 세포 재활성화

Neural stem cells (NSCs) have the ability to proliferate, differentiate, undergo apoptosis, and even enter and exit quiescence. Many of these processes ...

부활의 휴면 벼룩 마그나: 프로토콜 및 응용 프로그램

요약

더 많은 비디오 탐색

간단한 접근 방식은 동물 행동 관찰을위한 용존 산소를 조작하는

Aquaria에서 물고기의 생식 생태학 연구를위한 기본 방법

꼬마 선 충 에서 도파민 신호 평가에 수영 유도 마비

Primordial Germ Cell Cryopreservation and Revival of Drosophila Strains(초파리 균주의 원시 생식세포 냉동 보존 및 부활)

Primordial Germ Cell Cryopreservation and Revival of Drosophila Strains(초파리 균주의 원시 생식세포 냉동 보존 및 부활)

Primordial Germ Cell Cryopreservation and Revival of Drosophila Strains(초파리 균주의 원시 생식세포 냉동 보존 및 부활)

Caenorhabditis dauer 유충의 대규모 중력 분석

아르테미아 살리나 L을 사용한 치사율 생물학적 분석법

서브 세포 해상도 손상 Drosophila의 애벌레의 생체내 이미징에서

배양된 초파리 뇌 외래 식물에서 신경 줄기 세포 재활성화