אנו מודים אלסנדרו Cellerino, טיירון Genade, סחופת אן, סברינה שארפ, מיקי פאוול, סימון Keil, קים יומי, פטריק סמית, Mathar קאי, כל חברי המעבדה Valenzano במכון מקס פלאנק על הביולוגיה של הזדקנות לתרום היבטים שונים הנוכחי דגים גמבוזיים גידול בפרוטוקול לאורך השנים.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

כל המחברים מצהירים אין אינטרסים מתחרים לא-כספיים ופיננסיים.

אנו מתארים עבור המעבדה culturing של דגים גמבוזיים טורקיז, כולל אוסף העובר, דגירה, כמו גם דגים למבוגרים דיור, פרוטוקול, רבייה, האכלה. פרוטוקול שלנו במיוחד לאוכלוסייה מעבדות כי התנהלות המחקר התמקד דגים למבוגרים, בפרט ללימודי ניסיוני על הזדקנות ואת תוחלת החיים. דגים גמבוזיים טורקיז יכול יגודל על מתקן דג זברה רגיל; עם זאת, היבטים חשובים של גידול דגים גמבוזיים שונים של טיפול סטנדרטי דג זברה16. התאמות אלה כוללים מעבר מיגדרי מוקדם של דיאטה רק שרימפסים דיאטה עם תולעת דם עשירים בחלבון, וכן פירוט השלבים הדגירה העובר, המורכב שלב הדגירה נוזלי ויבש.
שלבים קריטיים בתוך הפרוטוקול כוללים משלוח העוברים בטווח טמפרטורה 8-30 ° C. במקרה של גידול, פוריות תלוי האכלה תדירות ואיכות המזון; לכן, מומלץ לפחות שני בפטריה ליום רבייה טנק לגדל עוברי תשואה (ראו סעיף 5.6.). במהלך העובר הלבנת, לא להרחיב העובר הדגירה בפתרון הלבנה. זה עלול לגרום נזק chorion ביצה, העובר מוגבר לתמותה. כאשר המקננת העוברים עם כחול מתילן, לא להאריך דגירה של עוברי מוכן לצוהר-יותר מ 2 שבועות כפי הכדאיות שלהם יקטן באופן משמעותי. הבקיעה דגים גמבוזיים טורקיז, טמפרטורה נמוכה של תמיסה חומצית רקבובי משפר הבקיעה, טבילה מלאה של העוברים בפתרון מאפשר הבקיעה מסונכרן. לא מספיק לערבב במהלך בתוצאות הדגירה שיעור גבוה של פריי לא תוכל למלא גז שלפוחית השתן ("בטן-המחוון" פנוטיפ, עיין בהערות בסעיף 5.1).
הגבלה של פרוטוקול לגידול כולל את המצע חול אשר מציבה אתגרים כדי מרכזי מערכות סינון, צריך להיות מוחלף על ידי שיטות אלטרנטיביות בעתיד. חלופות אפשריות יכולה להיות השימוש של דג זברה גידול טנקים. העובר הלבנת עלול לגרום שינויים משמעותיים פיזית-כימית ב chorion ביצה אשר עלולה לגרום chorion שינו פיסיולוגיה, הבקיעה הצלחה. חשיפה מתמדת של העוברים מתילן כחול עלול לגרום שינוי ארוך טווח בפיזיולוגיה דגים למבוגרים. גידול דגים למבוגרים במיכלים נפרדים במחקרי עוקבה הישרדות עלול להשפיע לרעה דגים התנהגות ובריאות. עם זאת, קבוצת הדיור במחקרי עוקבה הישרדות מוסיף גורמים מבלבלים משמעותית עקב הקמת הדומיננטיות החברתית וטריטוריות זכר, שמוביל הירארכיות חברתיות קפדנית. לכן, אנו שופטים כי הבידוד של דג זכר ללימודי הישרדות היא פשרה סבירה. האכלה מושבות דגים גמבוזיים מעבדה עם מזון חי ממקורות בלתי מבוקרת להוסיף סיכון עבור מציג חיצוני טפילים וקהילות חיידקים פתוגניים פוטנציאלי. בעתיד, צריכה להיות מפותחת של מזון הדגים סטרילי אד הוק.
שיפורים עתידיים פרוטוקול זה יתמקד דיאטה מבוקרת, שאינם חיים, אשר עדיין מוביל השלמת התבגרות מינית בתוך 3-4 שבועות. לסיכום, פרוטוקול שלנו מציע נגישות דגים גמבוזיים טורקיז מעבדה culturing קהילה מדעית רחבה.

בהתחשב שלהם תוכלת חיים קצרה, מהירה מחזור חיים, דגים גמבוזיים טורקיז גדלים במהירות כ אורגניזם מודל חדש מבטיח ביולוגיה1,2,3. מין זה מאופיין על ידי מחזור חיים ייחודי עבור teleost, המורכב של דיאפאוזה, התבגרות מינית מהירה של משך חיים post-reproductive שלב4,5. העבודה האחרונה תרם שחקרתי את הביולוגיה של מין זה בשבי והן את הבר6,7. דגים גמבוזיים טורקיז חיים גופי מים טריים עונתיים טופס זה במהלך העונה הגשומה, בסוואנה האפריקנית ב זימבבואה ומוזמביק. במהלך העונה היבשה, העוברים לשרוד בבוץ יבש בהיעדר מים מכוח שלב חיים עמידים ללחץ הנקרא תרדמה ואסטרטגיה.
הגנטי מפות עבור המין הזה שנוצר8,9, לאחרונה את הגנום שלהם היה ברצף, שהורכבו10,11. פותחו זנים שונים של דגים מעבדה המפגרים, ו transgenesis ו גנום עריכה דרך CRISPR/Cas9 הופכים לזמינים במין זה, דה-פקטו קידום דגים גמבוזיים טורקיז כאורגניזם מודל חוליות תחרותי מעבדה 1213,,14.
למרות שכבר פורסמה פרוטוקול המעבדה הזה מינים15, בפרוטוקול הנוכחי אנו מפתחים רשימה מקיפה של קווים מנחים מעבדה ניסויית מכוונים במיוחד מחקרים לחקור הזדקנות והישרדות. בפרוטוקול הנוכחי מאפשר לחוקרים מוכר כבר עם גידול דג זברה, medaka הופכים שבקיאים גידול דגים גמבוזיים טורקיז על ידי אימוץ מספר מינימלי של התאמות מפתח. במקביל, פרוטוקול זה מספק חוקרים ללא ניסיון קודם בגידול דגים עם כלים חיוניים לגדל מושבה דגים גמבוזיים טורקיז משגשגת.

<table><tbody><tr><td>Probe calibration buffer solution pH=7.0</td><td>Roth</td><td>A518.1</td><td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td></tr><tr><td>Probe calibration buffer solution pH=4.0</td><td>Roth</td><td>P712.1</td><td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td></tr><tr><td>Conductivity standard</td><td>VWR</td><td>83607.260</td><td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td></tr><tr><td>Easy Strips Test 6in1</td><td>JBL</td><td>2533900</td><td>Test strips for determination chlorine values of system water</td></tr><tr><td>Ammonia Test</td><td>JBL</td><td>2536500</td><td>Test to determine ammonia content of system water</td></tr><tr><td>Red Sea Salt</td><td>Red Sea</td><td></td><td>22 kg bucket</td></tr><tr><td>Sodium hydrogen carbonate</td><td>VWR</td><td>27780.360</td><td></td></tr><tr><td>Humic acid</td><td>Sigma- Aldrich</td><td>53680-50G</td><td></td></tr><tr><td>New HUFA Artemia enrichment</td><td>ZM Systems UK</td><td></td><td>75g bottle</td></tr><tr><td>Methylene blue</td><td>Roth</td><td>AE64.1</td><td></td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma- Aldrich</td><td>31642-1L</td><td>30% (w/w)</td></tr><tr><td>Coconut fiber</td><td>Dragon</td><td>ZCS010</td><td></td></tr><tr><td>Whatman paper</td><td>GE healthcare</td><td>3030-690</td><td></td></tr><tr><td>Ethanol pure</td><td>VWR</td><td>20821.467</td><td>100%</td></tr><tr><td>Silica sand</td><td>local pet shop</td><td></td><td></td></tr><tr><td>Artemia Eggs Premium Grade</td><td>Sanders</td><td></td><td></td></tr><tr><td>Bloodworm</td><td>local distributor</td><td></td><td>Poseidon Aquakultur Germany</td></tr><tr><td>dNTPs solution mix</td><td>Biolabs</td><td>N04472</td><td>10mM</td></tr><tr><td>Taq DNA polymerase</td><td>Invitrogen</td><td>18038-042</td><td>5U/uL</td></tr><tr><td>PCR 10x Buffer</td><td>Invitrogen</td><td>18038-042</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Invitrogen</td><td>18038-042</td><td>50mM</td></tr><tr><td>NaOH</td><td>Sigma- Aldrich</td><td>S8045-500g</td><td>50mM</td></tr><tr><td>Tris-HCl, pH=8.0 solution</td><td>Sigma- Aldrich</td><td>T2694-1L</td><td>1M</td></tr><tr><td>HCl 37%</td><td>Sigma- Aldrich</td><td>H1758-500mL</td><td></td></tr><tr><td>Fish tanks</td><td>Aquaneering</td><td></td><td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td></tr><tr><td>Orbital shaker</td><td>VWR</td><td>89032-100</td><td>model 5000</td></tr><tr><td>Microbiological incubator</td><td>Thermo Scientific, Heratherm</td><td>50125882</td><td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Cooling Incubator</td><td>Binder</td><td>9020-0209</td><td>model KT115; for storage embryos in the solid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Hatching incubator</td><td>Thermo Scientific, Heratherm</td><td>51028114</td><td>model OGS180; for embryos hatching, set to t=27-28&amp;deg;C</td></tr><tr><td>Stereomicroscope</td><td>Leica</td><td></td><td>model M80</td></tr><tr><td>Breeding sand/hatching boxes</td><td>Roth</td><td>1598.1</td><td>1000mL</td></tr><tr><td>Petri dish</td><td>Sarstedt</td><td>82.1473</td><td>92x16mm</td></tr><tr><td>50 mL Conical tube</td><td>Sarstedt</td><td>62.547.254</td><td></td></tr><tr><td>15 mL Conical tube</td><td>Sarstedt</td><td>62.554.002</td><td></td></tr><tr><td>Disposable Plastic Pasteur pipette</td><td>Roth</td><td>EA71.1</td><td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td></tr><tr><td>Serological pipette</td><td>Sarstedt</td><td>86.1689.001</td><td>50mL</td></tr><tr><td>Syringe</td><td>Henke Sass Wolf</td><td>4100-000V0</td><td>10mL</td></tr><tr><td>Metal strainer</td><td></td><td></td><td>fineness &amp;lt;1mm; for embryos collection</td></tr><tr><td>Tweezers</td><td>Dumont</td><td>0508-5/45-PO</td><td>type5/45; for embryos transfer</td></tr><tr><td>25 L Brine shrimp hatcher</td><td>Aquaneering</td><td>ZHBS25</td><td>main hatcher</td></tr><tr><td>500 mL Brine shrimp hatcher</td><td>JBL</td><td>6106100</td><td>model Artemio 1; backup hatcher</td></tr><tr><td>Narrow-mesh fish nets</td><td>JBL</td><td></td><td></td></tr><tr><td>Sand beaker</td><td>VWR</td><td>BURK7102-5000</td><td>5000mL</td></tr><tr><td>Brine shrimp separation beaker</td><td>VWR</td><td>BURK7102-2000</td><td>2000mL</td></tr><tr><td>Plastic zipper bag</td><td>Roth</td><td>P279.2</td><td>for dead fish storage</td></tr><tr><td>Pipetboy</td><td>Integra</td><td>155000</td><td>model Pipetboy acu2</td></tr><tr><td>Parafilm</td><td>P-Lab</td><td>P701605</td><td></td></tr><tr><td>Air tubing</td><td>www.zajac.de</td><td>AQ380</td><td>4-6 mm diameter</td></tr><tr><td>1 L Glass bottle</td><td>VWR</td><td>215-1595</td><td></td></tr><tr><td>2 L Glass bottle</td><td>VWR</td><td>215-1596</td><td></td></tr><tr><td>500 mL Squeeze bottle</td><td>Roth</td><td>K665.1</td><td>for fish feeding with brine shrimp</td></tr><tr><td>120-&amp;#956;m brine shrimp strainer</td><td>Florida Aqua Farms</td><td>BB-PC2</td><td>for brine shrimp/bloodworm collection</td></tr><tr><td>Finish filter socks</td><td>Aquaneering</td><td>MFVB025C</td><td>25-&amp;#956;m</td></tr><tr><td>Central filtration fish housing system</td><td></td><td></td><td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td></tr></tbody></table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

פיתוח שיטות גידול דגים-מודל מעבדה המשמש למטרות ניסוי הרוויחה במידה רבה הנובעת מקיומן של הפניה דגים דגם מערכות, כגון דג זברה, medaka. בשנים האחרונות, דגים המתעוררים – טורקיז דגים גמבוזיים (Nothobranchius furzeri) – אומץ על ידי מספר גדל והולך של קבוצות מחקר בתחומי הביולוגיה של הזדקנות ואקולוגיה. עם תוחלת החיים בשבי של 4-8 חודשים, מין זה חוליות shortest-lived גידלה בשבי ומאפשרת לקהילה המדעית התערבויות ניסיוני מבחן – תוך זמן קצר – זה יכול להוביל שינוי קצב ההזדקנות ואת תוחלת החיים. בהתחשב הביולוגיה ייחודי של מין זה, המאופיין דיאפאוזה, התבגרות מינית נפץ, מסומן מורפולוגיים והתנהגותיים צורתיות - ו שלהם קצר יחסית למבוגרים אורך החיים - גידול אד הוק נוהלי הם בדחוף לפי דרישה. פרוטוקול זה מדווחת קבוצת מפתח בעלי אמצעים המאפשרים דגים גמבוזיים טורקיז אופטימלית טיפול מעבדה, הפיכת הקהילה המדעית לאמץ את המין הזה כמודל חיות מעבדה רב עוצמה.

דגים גמבוזיים טורקיז גידול נאות תוצאות חציון ההישרדות הנע בין 12-18 שבועות בנימה GRZ (למשל איור 4A). וריאציות של חציון ההישרדות תלויה דיאטה, האכלה תדירות ודיור בתנאי טמפרטורה. תוצאות המסכן גידול בפניות הישרדות הצגת גברה התמותה המוקדמת, טיפות חוזרים, פתאומית של הישרדות לאורך זמן, המאופיינת במספר נקודות פיתול (איור 4B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg"> איור 1: נציג העובריים התפתחותית עם סובסטרט הדגירה בהתאמה. (א) טרי שנאספו עוברי, מודגרות תמיסת מתילן כחול בחממה ב 28 º C. (B) העוברים מוכנים להעביר בינוני מוצק, לסנן גם סיבי נייר או קוקוס. (ג) העוברים מוכן לתכנון, הצגת אופייני קשתיות הזהב. סרגל קנה מידה שווה ל 1 מ מ. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg"> איור 2: שלבי דגים גמבוזיים טורקיז לאחר הבקיעה פיתוח. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg"> איור 3: דגים נציג תג זיהוי דגים משלב 3 ואילך. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg"> איור 4: עקומת הישרדות נציג עבור 70 דגים גמבוזיים זכר בצבע טורקיז. (א) עקומת הישרדות אופייני לכל הרים-מעבדה דגים גמבוזיים בצבע טורקיז. (B) השוואה של הישרדות עקומות המתקבל הדג גידל תחת תנאי גידול אופטימליים (שחור) ואת בעלי המסכן (אדום וכחול). קו מקווקו אופקי אדום מציין 50% הישרדות, עקומת הישרדות מצטלבים-חציון תוחלת החיים (מסומן בציר ה-x). <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>מזהה</td>
			<td colspan="2">פריימר לפנים</td>
			<td colspan="2">פריימר הפוכה</td>
			<td>גודל הטווח (bp)</td>
		</tr>
<tr>
<td>* NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166 - 214</td>
		</tr>
<tr>
<td>* NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220 - 272</td>
		</tr>
<tr>
<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209 - 240</td>
		</tr>
<tr>
<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198 - 238</td>
		</tr>
<tr>
<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164 - 226</td>
		</tr>
<tr>
<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196 - 197</td>
		</tr>
<tr>
<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252 - 295</td>
		</tr>
<tr>
<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216 - 248</td>
		</tr>
<tr>
<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174 - 205</td>
		</tr>
<tr>
<td>* NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355 - 373</td>
		</tr>
<tr>
<td colspan="6">* - סקס נחישות סמנים</td>
		</tr>
</tbody></table>טבלה 1: תחל Genotyping לזיהוי מתח.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

דיור מעבדה של טורקיז דגים גמבוזיים ניתן לשנות את בית ולגדל ביעילות אלפי דגים בודדים במערכת סינון מים מרכזי, העסקת התשתית באותו המשמש להכנת דג זברה סטנדרטי. כאן אנחנו פירוט רשימת נהלים סטנדרטיים לאפשר דגים גמבוזיים יעיל תחזוקה.

פרוטוקול עבור המעבדה דיור של טורקיז דגים גמבוזיים (Nothobranchius furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

a-protocol-for-laboratory-housing-turquoise-killifish-nothobranchius

Research

JoVE Journal

Biology

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

16.7K Views.  Max Planck Institute for the Biology of Ageing. דיור מעבדה של טורקיז דגים גמבוזיים ניתן לשנות את בית ולגדל ביעילות אלפי דגים בודדים במערכת סינון מים מרכזי, העסקת התשתית באותו המשמש להכנת דג זברה סטנדרטי. כאן אנחנו פירוט רשימת נהלים סטנדרטיים לאפשר דגים גמבוזיים יעיל תחזוקה.

Video: A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

A Flow-through Exposure System for Evaluating Suspended Sediments Effects on Aquatic Life

This paper describes the Fish Larvae and Egg Exposure System (FLEES). The flow-through exposure system is used to investigate the effects of suspended sediment on various aquatic species and life stages in the laboratory by using pumps and automating delivery of sediment and water to simulate suspension of sediment. FLEES data are used to develop exposure-response curves between the effects on aquatic organisms and suspended sediment concentrations at the desired exposure duration. The effects data are used to evaluate management practices used to reduce the interactions between aquatic organisms and anthropogenic causes of suspended sediments. The FLEES is capable of generating total suspended solids (TSS) concentrations as low as 30 to as high as 800 mg/L, making this system an ideal choice for evaluating the effects of TSS resulting from many activities including simulating low ambient levels of TSS to evaluating sources of suspended sediments from dredging operations, vessel traffic, freshets, and storms.

A robust and flexible flow-through exposure system designed to maintain sediment in suspension is presented. The system is used to investigate the effects of suspended sediment on various aquatic species and life stages in the laboratory.

מערכת חשיפת זרימה דרך להערכת מושעה משקעים השפעות על חיים ימיים

This paper describes the Fish Larvae and Egg Exposure System (FLEES). The flow-through exposure system is used to investigate the effects of suspended ...

Environment

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity testing has been demonstrated. Overall, the sensitivity of the species to toxic compounds is in the range with, or higher than, that of other model species.
This work describes protocols for acute, chronic, and multigenerational bioassays of single and combined stressor effects on N. furzeri. Due to its short maturation time and life-cycle, this vertebrate model allows the study of endpoints such as maturation time and fecundity within four months. Transgenerational full life-cycle exposure trials can be performed in as little as 8 months. Since this species produces eggs that are drought-resistant and remain viable for years, the on-site culture of the species is not needed but individuals can be recruited when required. The protocols are designed to measure life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

In this work, we describe an acute, chronic and multigenerational bioassay to study the effects of single and combined stressors on the Turquoise killifish Nothobranchius furzeri. This protocol is designed to study life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

פרוטוקול עבור סימן ובדיקות כרונית Ecotoxicity של דגים גמבוזיים טורקיז Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity ...

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult forms has revealed the genetic basis of some of these differences. Less is known about how the populations differ at post-larval stages (at the onset of feeding). Such studies may provide insight into how cavefish survive through adulthood in their natural environment. Methods for comparing post-larval development in the laboratory require standardized aquaculture and feeding regimes. Here we describe how to raise fish on a diet of nutrient-rich rotifers in non-recirculating water for up to two-weeks post fertilization. We demonstrate how to collect post-larval fish from this nursery system and perform whole-mount immunostaining. Immunostaining is an attractive alternative to transgene expression analysis for investigating development and gene function in A. mexicanus. The nursery method can also be used as a standard protocol for establishing density-matched populations for growth into adults.

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

In this protocol, we demonstrate how to breed Astyanax mexicanus adults, raise the larvae, and perform whole-mount immunohistochemistry on post-larval fish to compare the phenotypes of surface and cave morphotypes.

גידול של טטרה מקסיקנית Astyanax mexicanus עבור ניתוח של Post-larval פנוטיפים ואת כולה-הר אימונוהיסטוכימיה

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult ...

Genetics

A Standardized Protocol for Preference Testing to Assess Fish Welfare

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the addition of physical objects or conspecifics in the housing environment) is often a way to give captive animals the opportunity to choose who or what they interact with and how they spend their time. A fundamental component of the aquatic environment that is often overlooked in captivity, however, is the ability for the animal to choose to engage in physical exercise. For many animals, including fish, exercise is an important aspect of their life history, and is known to have many health benefits, including positive changes in the brain and behavior. Here we present a method for assessing habitat preferences in captive animals. The protocol could easily be adapted to look at a variety of environmental factors (e.g., gravel versus sand as a substrate, plastic plants versus live plants, low flow versus high flow of water) in different aquatic species, or for use with terrestrial species. Statistical assessment of preference is carried out using Jacob&#39;s preference index, which ranks the habitats from -1 (avoidance) to +1 (most preferred). With this information, it can be determined what the animal wants from a welfare perspective, including their preferred location.

A fundamental aspect of assessing the welfare of animals in captivity is to ask whether the animals have what they want. Here, we present a protocol to determine housing preference in the zebrafish (Danio rerio) with respect to the presence/absence of environmental enrichment and access to flowing of water.

פרוטוקול מתוקננת עבור בדיקות העדפה להערכת הרווחה דגים

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the ...

Behavior

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host microbiome community diversity and alter the microbial community composition. Many diseases such as antibiotic-associated enterocolitis, inflammatory bowel disease, and metabolic disorders have been linked to a disrupted microbiota. The complex interplay between host, microbiome, and antibiotics needs a tractable model for studying host-microbiome interactions. Our freshwater vertebrate fish serves as a useful model for investigating the universal aspects of mucosal microbiome structure and function as well as analyzing consequential host effects from altering the microbial community. Methods include host challenges such as infection by a known fish pathogen, exposure to fecal or soil microbes, osmotic stress, nitrate toxicity, growth analysis, and measurement of gut motility. These techniques demonstrate a flexible and useful model system for rapid determination of host phenotypes.

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

This study involves methods to reveal effects on a model fish host following alteration of the skin and gut microbiome communities&#160;composition by an antibiotic.

בחינת פנוטיפים מארח ב<em&gt; Affinis Gambusia</em&gt; בעקבות טיפול אנטיביוטי

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host ...

Immunology and Infection

אופטימיזציה של מודלים של דגי זברה GF: ייצור, תחזוקה ומחקרים מיקרוביאליים

Generation, Maintenance, and Identification of Germ-Free Zebrafish Models from Larvae to Juvenile Stages

Zebrafish serve as valuable models for research on growth, immunity, and gut microbiota due to their genomic similarities with mammals, transparent embryos developed in a relatively clean chorion environment, and extremely rapid development of larvae compared to rodent models. Germ-free (GF) zebrafish (Danio rerio) are crucial for evaluating pollutant toxicity and establishing human-like disease models related to microbial functions. In comparison to conventionally raised (CR) models (fish in common husbandry), GF zebrafish allow for more accurate manipulation of the host microbiota, aiding in determining the causal relationship between microorganisms and hosts. Consequently, they play a critical role in advancing our understanding of these relationships. However, GF zebrafish models are typically generated and researched during the early life stages (from embryos to larvae) due to limitations in immune function and nutrient absorption. This study optimizes the generation, maintenance, and identification of early GF zebrafish models without feeding and with long-term feeding using GF food (such as Artemia sp., brine shrimp). Throughout the process, daily sampling and culture were performed and identified through multiple detections, including plates and 16S rRNA sequencing. The aseptic rate, survival, and developmental indexes of GF zebrafish were recorded to ensure the quality and quantity of the generated models. Importantly, this study provides details on bacterial isolation and infection techniques for GF fish, enabling the efficient creation of GF fish models from larvae to juvenile stages with GF food support. By applying these procedures in biomedical research, scientists can better understand the relationships between intestinal bacterial functions and host health.

מחבר זרקור: הקמת דגי זברה נטולי חיידקים למחקרי יחסי מיקרוביוטה-פונדקאי

This protocol outlines the primary steps for obtaining germ-free (GF) fish embryos and maintaining them from larvae until the juvenile stage, including sampling and detecting their sterile status. The use of GF models with infection is important for understanding the role of microbes in host health.

ייצור, תחזוקה וזיהוי של מודלים של דגי זברה נטולי חיידקים מזחלים ועד שלבים צעירים

Zebrafish serve as valuable models for research on growth, immunity, and gut microbiota due to their genomic similarities with mammals, transparent ...

Developmental Biology

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and behavioural research. As a vertebrate, zebrafish share considerable genetic sequence similarity with humans and are being used as an animal model for various human disease conditions. The advantages of zebrafish in comparison to other common vertebrate models include high fecundity, low maintenance cost, transparent embryos, and rapid development. Due to the spur of interest in zebrafish research, the need to establish and maintain a productive zebrafish housing facility is also increasing. Although literature is available for the maintenance of a zebrafish laboratory, a concise video protocol is lacking. This video illustrates the protocol for regular housing, feeding, breeding and raising of zebrafish larvae. This process will help researchers to understand the natural behaviour and optimal conditions of zebrafish husbandry and hence troubleshoot experimental issues that originate from the fish husbandry conditions. This protocol will be of immense help to researchers planning to establish a zebrafish laboratory, and also to graduate students who are intending to use zebrafish as an animal model.

Regular Care and Maintenance of a Zebrafish Danio rerio Laboratory: An Introduction

This protocol outlines regular maintenance and care to maintain optimal conditions for zebrafish husbandry. The video illustrates the protocol for system maintenance, regular housing, feeding, breeding, and raising of zebrafish larvae.

טיפול קבוע ותחזוקה של דג זברה (<em&gt; Danio rerio</em&gt;) מעבדה: מבוא

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and ...

Construction of an Affordable and Easy-to-Build Zebrafish Facility

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it virtually impossible to build and maintain typical rodent facilities for research. Zebrafish research has been demonstrated to be a valuable alternative for in vivo research in pharmacology, physiology, development and genetic studies. This article demonstrates that a functional zebrafish facility can be built in an easy and affordable manner. We demonstrate that such a facility could be built in about one working day with minimal tools and expertise. The cost of the 27 1.8 L fish tank zebrafish facility constructed in this study was approximately $1,500. We estimate that the maintenance of an initial working 150 fish colony for 3 months is $1,000. This project involved students, who were introduced to aquaculturing of zebrafish for research proposes.

A Zebrafish facility suitable for breeding and in vivo research is built in an easy and affordable manner. Maintenance is minimal. This facility is ideal for student involvement and independent research.

הקמת מתקן דג הזברה בנייה קלה למשתלם ו

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it ...

פרוטוקול עבור המעבדה דיור של טורקיז דגים גמבוזיים (Nothobranchius furzeri)

Summary

Explore More Videos

Chapters in this video

מערכת חשיפת זרימה דרך להערכת מושעה משקעים השפעות על חיים ימיים

פרוטוקול עבור סימן ובדיקות כרונית Ecotoxicity של דגים גמבוזיים טורקיז Nothobranchius furzeri

גידול של טטרה מקסיקנית Astyanax mexicanus עבור ניתוח של Post-larval פנוטיפים ואת כולה-הר אימונוהיסטוכימיה

פרוטוקול מתוקננת עבור בדיקות העדפה להערכת הרווחה דגים

בחינת פנוטיפים מארח ב

ייצור, תחזוקה וזיהוי של מודלים של דגי זברה נטולי חיידקים מזחלים ועד שלבים צעירים

ייצור, תחזוקה וזיהוי של מודלים של דגי זברה נטולי חיידקים מזחלים ועד שלבים צעירים

ייצור, תחזוקה וזיהוי של מודלים של דגי זברה נטולי חיידקים מזחלים ועד שלבים צעירים

טיפול קבוע ותחזוקה של דג זברה (

הקמת מתקן דג הזברה בנייה קלה למשתלם ו