Wir danken Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar und allen Mitgliedern des Valenzano Labor am Max-Planck-Institut für Biologie des Alterns für Ihren Beitrag zu verschiedenen Aspekten des derzeitigen Killifische Tierhaltung Protokolls im Laufe der Jahre.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

Die Autoren erklären keine finanzielle und nicht finanzielle Interessenkonflikte.

Wir beschreiben ein Protokoll für das Labor züchten von Türkis Killifische, einschließlich Embryo Sammlung sowie Inkubation und ausgewachsenen Fischen Gehäuse, Zucht und Fütterung. Unser Protokoll richtet sich speziell an Labore, die forschen konzentrierten sich auf Erwachsene Fische, insbesondere für experimentelle Studien über das Altern und Lebensdauer. Türkis Killifische kann auf standard Zebrafisch-Anlage angehoben werden; wichtige Aspekte der Tierhaltung Killifische unterscheiden sich jedoch von standard Zebrafisch Pflege16. Diese Anpassungen umfassen frühen Übergang von Artemia nur Diät zu einer Ernährung mit Protein-reiche Blut Wurm als auch spezifische Schritte im Embryo Inkubation, bestehend aus einer flüssigen und trockenen Inkubation Bühne ergänzt.
Wichtige Schritte im Rahmen des Protokolls beinhalten Versand Embryonen im 8-30 ° C Temperaturbereich. Fruchtbarkeit hängt bei Zucht, Fütterung, Frequenz und Qualität des Essens; Wir empfehlen daher, mindestens zwei Fütterungen pro Tag pro Zucht Tank um Embryonen Ertrag (siehe Abschnitt 5.6) zu erhöhen. Während der Embryo zu bleichen, verlängern Sie Embryo Inkubation im Bleichbad nicht. Dies kann Schäden am Ei Chorion und erhöhte Embryo Sterblichkeit führen. Wenn Embryonen mit Methylenblau Inkubation, nicht verlängern Sie, Inkubation von bereit-zu-Luke Embryonen länger als 2 Wochen, da ihre Überlebensfähigkeit drastisch verringert wird. Für Schraffur Türkis Killifische, niedriger Temperatur von Huminsäure saure Lösung verbessert die Schraffur und vollständiges Eintauchen des Embryos in der Lösung ermöglicht synchronisierten Schlupf. Nicht ausreichende Belüftung während der Inkubation resultiert hohe Raten von Fry nicht in der Lage, die Gas-Blase zu füllen ("Bauch-Schieber" Phänotyp, siehe Hinweise in Abschnitt 5.1).
Einschränkung des Protokolls für die Zucht umfasst den Einsatz von Sand Substrat welche Herausforderungen auf zentrale Filteranlagen und sollte in Zukunft durch alternative Methoden ersetzt werden. Mögliche Alternativen könnte die Verwendung von Zebrafisch Zucht Panzer. Embryo bleichen könnte wichtige physikalisch-chemische Veränderungen in der Ei-Chorion, die veränderten Chorion Physiologie und Schraffur Erfolg führen könnte. Ständiger Exposition von Embryonen zu Methylenblau kann langfristige Veränderungen der Erwachsenen Fische Physiologie induzieren. Erhöhung der Erwachsenen Fische in einzelnen Tanks für Überleben Kohortenstudien könnten Fisch Verhalten und Gesundheit beeinträchtigen. Gruppenhaltung für Überleben Kohortenstudien fügt jedoch erhebliche Störfaktoren durch die Etablierung der sozialen Dominanz und männlicher Gebiete führt zu strengen sozialen Hierarchien. Daher beurteilen wir, dass Isolation von männlichen Fischen für Überleben Studien ein vernünftiger Kompromiss ist. Fütterung Labor Killifische Kolonien mit Lebendfutter aus UN-kontrollierten Quellen fügen Sie ein Risiko für externe Verunreinigungen von Parasiten und potenziell pathogenen mikrobieller Gemeinschaften. In Zukunft sollte eine ad-hoc-sterile Fischfutter entwickelt werden.
Zukünftige Verbesserungen dieses Protokolls konzentriert sich auf eine kontrollierte, nicht-live Diät führt nach wie vor Abschluss der Geschlechtsreife innerhalb von 3-4 Wochen. Zusammenfassend bietet unser Protokoll Zugänglichkeit zum türkisblauen Killifische Labor Kultivierung einer breiten Fachöffentlichkeit.

Aufgrund ihrer kurzen Lebensdauer und schnelle Lebenszyklus, sind türkis Killifische als vielversprechende neue Modellorganismus in der Biologie1,2,3rasant. Diese Art zeichnet sich durch einen einzigartigen Lebenszyklus für eine teleost, bestehend aus embryonalen Diapause, schnelle sexuelle Reifung und eine verlängerte post-reproductive Lebensdauer Stufe4,5. Den letzten Arbeit hat dazu beigetragen, Aufklärung die Biologie dieser Arten in Gefangenschaft und im wilden6,7. Türkis Killifische Leben in saisonalen frischen Gewässer dieser Form während der Regenzeit in der afrikanischen Savanne in Simbabwe und Mosambik. Während der Trockenzeit überleben Embryonen im trockenen Schlamm in Abwesenheit von Wasser durch eine Stress-resistente Lebensstadium Diapause genannt.
Genetische Karten für diese Spezies wurden generierten8,9, und vor kurzem wurde ihr Genom sequenziert und montierten10,11. Mehreren Inzucht laborbelastungen Fisch entwickelt worden und Transgenese und Genom Bearbeitung via CRISPR/Cas9 sind verfügbar in dieser Spezies, de-facto- Förderung Türkis Killifische als wettbewerbsfähige Labor vertebrate Modellorganismus geworden 12,13,14.
Obwohl ein Laborprotokoll für diese Arten15bereits veröffentlicht worden, in diesem Protokoll entwickeln wir eine umfassende Liste von experimentellen Labor-Richtlinien, die speziell auf Studien, die untersuchen, Alterung und überleben. Dieses Protokoll ermöglicht Forschern bereits vertraut mit Zebrafisch und Medaka Tierhaltung in Türkis Killifische Zucht bewandert werden durch die Annahme einer Mindestanzahl von wesentliche Anpassungen. Zur gleichen Zeit bietet dieses Protokoll Forschern ohne Vorkenntnisse in Fisch Zucht mit wichtigen Tools um eine blühende Kolonie Türkis Killifische zu erhöhen.

<table>
	<tbody>
		<tr>
			<td>Probe calibration buffer solution pH=7.0</td>
			<td>Roth</td>
			<td>A518.1</td>
			<td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Probe calibration buffer solution pH=4.0</td>
			<td>Roth</td>
			<td>P712.1</td>
			<td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Conductivity standard</td>
			<td>VWR</td>
			<td>83607.260</td>
			<td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td>
		</tr>
		<tr>
			<td>Easy Strips Test 6in1</td>
			<td>JBL</td>
			<td>2533900</td>
			<td>Test strips for determination chlorine values of system water</td>
		</tr>
		<tr>
			<td>Ammonia Test</td>
			<td>JBL</td>
			<td>2536500</td>
			<td>Test to determine ammonia content of system water</td>
		</tr>
		<tr>
			<td>Red Sea Salt</td>
			<td>Red Sea</td>
			<td></td>
			<td>22 kg bucket</td>
		</tr>
		<tr>
			<td>Sodium hydrogen carbonate</td>
			<td>VWR</td>
			<td>27780.360</td>
			<td></td>
		</tr>
		<tr>
			<td>Humic acid</td>
			<td>Sigma- Aldrich</td>
			<td>53680-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>New HUFA Artemia enrichment</td>
			<td>ZM Systems UK</td>
			<td></td>
			<td>75g bottle</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Roth</td>
			<td>AE64.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrogen peroxide solution</td>
			<td>Sigma- Aldrich</td>
			<td>31642-1L</td>
			<td>30% (w/w)</td>
		</tr>
		<tr>
			<td>Cononut fiber</td>
			<td>Dragon</td>
			<td>ZCS010</td>
			<td></td>
		</tr>
		<tr>
			<td>Whatman paper</td>
			<td>GE healthcare</td>
			<td>3030-690</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol pure</td>
			<td>VWR</td>
			<td>20821.467</td>
			<td>100%</td>
		</tr>
		<tr>
			<td>Silica sand</td>
			<td>local pet shop</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Artemia Eggs Premium Grade</td>
			<td>Sanders</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bloodworm</td>
			<td>local distributor</td>
			<td></td>
			<td>Poseidon Aquakultur Germany</td>
		</tr>
		<tr>
			<td>dNTPs solution mix</td>
			<td>Biolabs</td>
			<td>N04472</td>
			<td>10mM</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>5U/uL</td>
		</tr>
		<tr>
			<td>PCR 10x Buffer</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>NaOH</td>
			<td>Sigma- Aldrich</td>
			<td>S8045-500g</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>Tris-HCl, pH=8.0 solution</td>
			<td>Sigma- Aldrich</td>
			<td>T2694-1L</td>
			<td>1M</td>
		</tr>
		<tr>
			<td>HCl 37%</td>
			<td>Sigma- Aldrich</td>
			<td>H1758-500mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Aquatic housing system</td>
			<td>Aquaneering</td>
			<td></td>
			<td>Central filtration equipped aquatic system</td>
		</tr>
		<tr>
			<td>Fish tanks</td>
			<td>Aquaneering</td>
			<td></td>
			<td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td>
		</tr>
		<tr>
			<td>Orbital shaker</td>
			<td>VWR</td>
			<td>89032-100</td>
			<td>model 5000</td>
		</tr>
		<tr>
			<td>Microbiological incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>50125882</td>
			<td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Cooling Incubator</td>
			<td>Binder</td>
			<td>9020-0209</td>
			<td>model KT115; for storage embryos in the solid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Hatching incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>51028114</td>
			<td>model OGS180; for embryos hatching, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Stereomicroscope</td>
			<td>Leica</td>
			<td></td>
			<td>model M80</td>
		</tr>
		<tr>
			<td>Breeding sand/hatching boxes</td>
			<td>Roth</td>
			<td>1598.1</td>
			<td>1000mL</td>
		</tr>
		<tr>
			<td>Petri dish</td>
			<td>Sarstedt</td>
			<td>82.1473</td>
			<td>92x16mm</td>
		</tr>
		<tr>
			<td>50mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.547.254</td>
			<td></td>
		</tr>
		<tr>
			<td>15mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.554.002</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Plastic Pasteur pipette</td>
			<td>Roth</td>
			<td>EA71.1</td>
			<td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td>
		</tr>
		<tr>
			<td>Serological pipette</td>
			<td>Sarstedt</td>
			<td>86.1689.001</td>
			<td>50mL</td>
		</tr>
		<tr>
			<td>Syringe</td>
			<td>Henke Sass Wolf</td>
			<td>4100-000V0</td>
			<td>10mL</td>
		</tr>
		<tr>
			<td>Metal strainer</td>
			<td></td>
			<td></td>
			<td>fineness &#60;1mm; for embryos collection</td>
		</tr>
		<tr>
			<td>Tweezers</td>
			<td>Dumont</td>
			<td>0508-5/45-PO</td>
			<td>type5/45; for embryos transfer</td>
		</tr>
		<tr>
			<td>25L Brine shrimps hatcher</td>
			<td>Aquaneering</td>
			<td>ZHBS25</td>
			<td>main hatcher</td>
		</tr>
		<tr>
			<td>500mL Brine shrimps hatcher</td>
			<td>JBL</td>
			<td>6106100</td>
			<td>model Artemio 1; backuo hatcher</td>
		</tr>
		<tr>
			<td>Narrow-mesh fish nets</td>
			<td>JBL</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Sand beaker</td>
			<td>VWR</td>
			<td>BURK7102-5000</td>
			<td>5000mL</td>
		</tr>
		<tr>
			<td>Brine shrimps separation beaker</td>
			<td>VWR</td>
			<td>BURK7102-2000</td>
			<td>2000mL</td>
		</tr>
		<tr>
			<td>Plastic zipper bag</td>
			<td>Roth</td>
			<td>P279.2</td>
			<td>for dead fish storage</td>
		</tr>
		<tr>
			<td>Pipetboy</td>
			<td>Integra</td>
			<td>155000</td>
			<td>model Pipetboy acu2</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>P-Lab</td>
			<td>P701605</td>
			<td></td>
		</tr>
		<tr>
			<td>Air tubing</td>
			<td>www.zajac.de</td>
			<td>AQ380</td>
			<td>4-6 mm diameter</td>
		</tr>
		<tr>
			<td>1L Glass bottle</td>
			<td>VWR</td>
			<td>215-1595</td>
			<td></td>
		</tr>
		<tr>
			<td>2L Glass bottle</td>
			<td>VWR</td>
			<td>215-1596</td>
			<td></td>
		</tr>
		<tr>
			<td>500mL Squeeze bottle</td>
			<td>Roth</td>
			<td>K665.1</td>
			<td>for fish feeding with brine shrimps</td>
		</tr>
		<tr>
			<td>120 micron brine shrimps strainer</td>
			<td>Florida Aqua Farms</td>
			<td>BB-PC2</td>
			<td>for brine shrimps/bloodworm collection</td>
		</tr>
		<tr>
			<td>Finish filter socks</td>
			<td>Aquaneering</td>
			<td>MFVB025C</td>
			<td>25 micron</td>
		</tr>
		<tr>
			<td>Central filtration fish housing system</td>
			<td></td>
			<td></td>
			<td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td>
		</tr>
	</tbody>
</table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

Die Entwicklung von Tierhaltungspraktiken in Labor-Modell Fisch für experimentelle Zwecke hat profitiert von der Gründung des Referenz-Fisch Modellsysteme wie Zebrafisch und Medaka. In den letzten Jahren hat eine wachsende Zahl von Forschungsgruppen in den Bereichen der Biologie des Alterns und Ökologie einer aufstrebenden Fisch – die türkisfarbenen Killifische (Nothobranchius Furzeri) – angenommen. Mit einer Gefangenschaft Lebensdauer von 4 bis 8 Monate diese Art ist die kurzlebigsten Wirbeltier in Gefangenschaft angehoben und ermöglicht die wissenschaftliche Gemeinschaft Test – in kurzer Zeit – experimentelle Interventionen, die zu Veränderungen des Alterns Rate und Lebenserwartung führen können. Angesichts die einzigartigen Biologie dieser Art, gekennzeichnet durch embryonale Diapause markiert explosive sexuelle Reifung, morphologische und Verhaltensstörungen Geschlechtsdimorphismus- und ihrer relativ kurzen Erwachsenen Lebensdauer - ad-hoc- Tierhaltung sind Praktiken in dringenden Nachfrage. Dieses Protokoll berichtet eine Reihe von wichtigen Tierhaltung Maßnahmen, mit denen optimale Türkis Killifische Labor Pflege, Aktivierung der wissenschaftlichen Gemeinschaft, diese Spezies als ein leistungsfähiges Labor Tiermodell anzunehmen.

Türkis Killifische richtige Haltung führt mediane Überlebenszeit zwischen 12-18 Wochen in der GRZ Belastung (z. B. Abbildung 4A). Variationen der mediane Überlebenszeit abhängig von Ernährung, Fütterung Frequenz und Temperatur Wohnbedingungen. Schlechte Haltung führt zu überleben Kurven präsentiert erhöht frühe Sterblichkeit und repetitive, plötzlichen Tropfen des Überlebens im Laufe der Zeit zeichnet sich durch mehrere Wendepunkte (Abbildung 4 b).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg"> Abbildung 1: Repräsentative embryonalen Entwicklungsstufen mit entsprechenden Inkubation Substrat. (A) frisch gesammelten Embryonen, inkubiert in Methylenblau-Lösung im Inkubator bei 28 ° C. (B) Embryonen bereit, auf festem Medium übertragen werden entweder Papier oder Kokos Faser filtern. (C) Embryonen bereit, die schraffiert werden, typische golden IRIS anzeigen. Der Maßstab ist gleich bis 1 mm. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg"> Abbildung 2: Phasen des türkisfarbenen Killifische nach dem Schlüpfen Entwicklung. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg"> Abbildung 3: Repräsentative Fisch ID-Tag für Fische aus Stufe 3 ab. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg"> Abbildung 4: Repräsentative überleben Kurve für 70 männlichen Türkis Killifische. (A) typische überleben Kurve für Labor-raiste Türkis Killifische. (B) Vergleich der überleben Kurven gewonnenen Fische unter optimalen Haltungsbedingungen (schwarz) angehoben und schlechte Tierhaltung (rot und blau). Die gestrichelte rote horizontale Linie gibt 50 % überleben, sich überschneidenden überleben Kurve an mittlere Lebensdauer (auf der x-Achse angegeben). <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>ID</td>
			<td colspan="2">Forward primer</td>
			<td colspan="2">Rückwärts-primer</td>
			<td>Größenbereich (bp)</td>
		</tr>
<tr>
<td>* NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166 - 214</td>
		</tr>
<tr>
<td>* NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220 - 272</td>
		</tr>
<tr>
<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209 - 240</td>
		</tr>
<tr>
<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198 - 238</td>
		</tr>
<tr>
<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164 - 226</td>
		</tr>
<tr>
<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196 - 197</td>
		</tr>
<tr>
<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252 - 295</td>
		</tr>
<tr>
<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216 - 248</td>
		</tr>
<tr>
<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174 - 205</td>
		</tr>
<tr>
<td>* NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355 - 373</td>
		</tr>
<tr>
<td colspan="6">* - sex Bestimmung Marker</td>
		</tr>
</tbody></table>Tabelle 1: Genotypisierung Zündkapseln für Stamm-Identifikation.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Labor-Gehäuse von Türkis, die Killifische unterzubringen und effizient erhöhen Tausende von einzelnen Fische in eine zentralisierte Wasserfilter-System, mit der gleichen Infrastruktur für standard Zebrafisch genutzt skaliert werden kann. Hier zeigen wir eine Liste von standardisierten Verfahren, die effiziente Killifische Wartung ermöglichen.

Ein Protokoll für Labor Housing von Türkis Killifische (Nothobranchius Furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

a-protocol-for-laboratory-housing-turquoise-killifish-nothobranchius

Research

JoVE Journal

Biology

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

16.7K Aufrufe.  Max Planck Institute for the Biology of Ageing. Labor-Gehäuse von Türkis, die Killifische unterzubringen und effizient erhöhen Tausende von einzelnen Fische in eine zentralisierte Wasserfilter-System, mit der gleichen Infrastruktur für standard Zebrafisch genutzt skaliert werden kann. Hier zeigen wir eine Liste von standardisierten Verfahren, die effiziente Killifische Wartung ermöglichen.

Serie: A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Protocol for Mosquito Rearing (A. gambiae)

This protocol describes mosquito rearing in the insectary. The insectary rooms are maintained at 28&deg;C and ~80% humidity, with a 12 hr. day/night cycle. For this procedure, you'll need mosquito cages, 10% sterile sucrose solution, paper towels, beaker, whatman filter paper, glass feeders, human blood and serum, water bath, parafilm, distilled water, clean plastic trays, mosquito food (described below), mosquito net to cover the trays, vacuum, and a collection chamber to collect adults.

Protocol for Mosquito Rearing A. gambiae

This video illustrates the general techniques used to rear Anopheles gambiae in the laboratory. The methods for caring for laboratory mosquitoes are demonstrated through all stages of the organism's life cycle from larvae to pupae to blood-feeding adults.

Protokoll für Mosquito Aufzucht (A. gambiae)

This protocol describes mosquito rearing in the insectary. The insectary rooms are maintained at 28&deg;C and ~80% humidity, with a 12 hr. day/night ...

Forschung

Biologie

Neutrophil Isolation Protocol

Neutrophil polymorphonuclear granulocytes (PMN) are the most abundant leukocytes in humans and among the first cells to arrive on the site of inflammatory immune response. Due to their key role in inflammation, neutrophil functions such as locomotion, cytokine production, phagocytosis, and tumor cell combat are extensively studied. To characterize the specific functions of neutrophils, a clean, fast, and reliable method of separating them from other blood cells is desirable for in vitro studies, especially since neutrophils are short-lived and should be used within 2-4 hours of collection. Here, we demonstrate a standard density gradient separation method to isolate human neutrophils from whole blood using commercially available separation media that is a mixture of sodium metrizoate and Dextran 500. The procedure consists of layering whole blood over the density gradient medium, centrifugation, separation of neutrophil layer, and lysis of residual erythrocytes. Cells are then washed, counted, and resuspended in buffer to desired concentration. When performed correctly, this method has been shown to yield samples of >95% neutrophils with >95% viability.

Neutrophils are among the first cells to arrive on the site of inflammatory immune response, and their functions and mechanisms have been studied extensively in vitro. We demonstrate a standard density gradient separation method to isolate human neutrophils from whole blood using commercially available separation media.

Neutrophile Isolation Protocol

Neutrophil polymorphonuclear granulocytes (PMN) are the most abundant leukocytes in humans and among the first cells to arrive on the site of inflammatory ...

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia (SCG)

The superior cervical ganglia (SCG) in rats are small, glossy, almond-shaped structures that contain sympathetic neurons.  These neurons provide sympathetic innervations for the head and neck regions and they constitute a well-characterized and relatively homogeneous population (4).  Sympathetic neurons are dependent on nerve growth factor (NGF) for survival, differentiation and axonal growth and the wide-spread availability of NGF facilitates their culture and experimental manipulation (2, 3, 6).  For these reasons, cultured sympathetic neurons have been used in a wide variety of studies including neuronal development and differentiation, mechanisms of programmed and pathological cell death, and signal transduction (1, 2, 5, and 6).  Dissecting out the SCG from newborn rats and culturing sympathetic neurons is not very complicated and can be mastered fairly quickly.  In this article, we will describe in detail how to dissect out the SCG from newborn rat pups and to use them to establish cultures of sympathetic neurons.  The article will also describe the preparatory steps and the various reagents and equipment that are needed to achieve this.

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia SCG

This is a protocol describing how to isolate and culture primary sympathetic neurons from superior cervical ganglia (SCG) of newborn rat pups.

Protokoll zur Kultivierung sympathischen Neuronen aus Ratten-Superior Halsganglien (SCG)

The superior cervical ganglia (SCG) in rats are small, glossy, almond-shaped structures that contain sympathetic neurons.  These neurons provide ...

A Protocol for the Production of KLRG1 Tetramer

Killer cell lectin-like receptor G1 (KLRG1) is a type II transmembrane glycoprotein inhibitory receptor belonging to the C type lectin-like superfamily. KLRG1 exists both as a monomer and as a disulfide-linked homodimer. This well-conserved receptor is found on the most mature and recently activated NK cells as well as on a subset of effector/memory T cells.
Using KLRG1 tetramer as well as other methods, E-, N-, and R-cadherins were identified as KLRG1 ligands. These Ca2+-dependent cell-cell adhesion molecules comprises of an extracellular domain containing five cadherin repeats responsible for cell-cell interactions, a transmembrane domain and a cytoplasmic domain that is linked to the actin cytoskeleton. 
Generation of the KLRG1 tetramer was essential to the identification of the KLRG1 ligands. KLRG1 tetramer is also a unique tool to elucidate the roles cadherin and KLRG1 play in regulating the immune response and tissue integrity.

This protocol describes the production of KLRG1 tetramer, which is a powerful tool for the analysis of KLRG1 ligands.

Ein Protokoll für die Produktion von KLRG1 Tetramer

Killer cell lectin-like receptor G1 (KLRG1) is a type II transmembrane glycoprotein inhibitory receptor belonging to the C type lectin-like superfamily. ...

A Protocol for Computer-Based Protein Structure and Function Prediction

Genome sequencing projects have ciphered millions of protein sequence, which require knowledge of their structure and function to improve the understanding of their biological role. Although experimental methods can provide detailed information for a small fraction of these proteins, computational modeling is needed for the majority of protein molecules which are experimentally uncharacterized. The I-TASSER server is an on-line workbench for high-resolution modeling of protein structure and function. Given a protein sequence, a typical output from the I-TASSER server includes secondary structure prediction, predicted solvent accessibility of each residue, homologous template proteins detected by threading and structure alignments, up to five full-length tertiary structural models, and structure-based functional annotations for enzyme classification, Gene Ontology terms and protein-ligand binding sites. All the predictions are tagged with a confidence score which tells how accurate the predictions are without knowing the experimental data. To facilitate the special requests of end users, the server provides channels to accept user-specified inter-residue distance and contact maps to interactively change the I-TASSER modeling; it also allows users to specify any proteins as template, or to exclude any template proteins during the structure assembly simulations. The structural information could be collected by the users based on experimental evidences or biological insights with the purpose of improving the quality of I-TASSER predictions. The server was evaluated as the best programs for protein structure and function predictions in the recent community-wide CASP experiments. There are currently &gt;20,000 registered scientists from over 100 countries who are using the on-line I-TASSER server.

Guidelines for computer based structural and functional characterization of protein using the I-TASSER pipeline is described. Starting from query protein sequence, 3D models are generated using multiple threading alignments and iterative structural assembly simulations. Functional inferences are thereafter drawn based on matches to proteins with known structure and functions.

Ein Protokoll für die Computer-Based Protein Structure and Function Prediction

Genome sequencing projects have ciphered millions of protein sequence, which require knowledge of their structure and function to improve the ...

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and behavioural research. As a vertebrate, zebrafish share considerable genetic sequence similarity with humans and are being used as an animal model for various human disease conditions. The advantages of zebrafish in comparison to other common vertebrate models include high fecundity, low maintenance cost, transparent embryos, and rapid development. Due to the spur of interest in zebrafish research, the need to establish and maintain a productive zebrafish housing facility is also increasing. Although literature is available for the maintenance of a zebrafish laboratory, a concise video protocol is lacking. This video illustrates the protocol for regular housing, feeding, breeding and raising of zebrafish larvae. This process will help researchers to understand the natural behaviour and optimal conditions of zebrafish husbandry and hence troubleshoot experimental issues that originate from the fish husbandry conditions. This protocol will be of immense help to researchers planning to establish a zebrafish laboratory, and also to graduate students who are intending to use zebrafish as an animal model.

Regular Care and Maintenance of a Zebrafish Danio rerio Laboratory: An Introduction

This protocol outlines regular maintenance and care to maintain optimal conditions for zebrafish husbandry. The video illustrates the protocol for system maintenance, regular housing, feeding, breeding, and raising of zebrafish larvae.

Regelmäßige Pflege und Wartung eines Zebrafisch (<em&gt; Danio rerio</em&gt;) Labor: Eine Einführung

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and ...

A Protocol for Phage Display and Affinity Selection Using Recombinant Protein Baits

Using recombinant phage as a scaffold to present various protein portions encoded by a directionally cloned cDNA library to immobilized bait molecules is an efficient means to discover interactions. The technique has largely been used to discover protein-protein interactions but the bait molecule to be challenged need not be restricted to proteins. The protocol presented here has been optimized to allow a modest number of baits to be screened in replicates to maximize the identification of independent clones presenting the same protein. This permits greater confidence that interacting proteins identified are legitimate interactors of the bait molecule. Monitoring the phage titer after each affinity selection round provides information on how the affinity selection is progressing as well as on the efficacy of negative controls. One means of titering the phage, and how and what to prepare in advance to allow this process to progress as efficiently as possible, is presented. Attributes of amplicons retrieved following isolation of independent plaque are highlighted that can be used to ascertain how well the affinity selection has progressed. Trouble shooting techniques to minimize false positives or to bypass persistently recovered phage are explained. Means of reducing viral contamination flare up are discussed.

Phage display is a powerful technique to capture proteins or protein moieties that interact with an immobilized molecule of interest. Once a decision of the type of phage cDNA library to create and screen has been made, the protocol described here permits efficient affinity selection leading to identification of interactors.

Ein Protokoll für die Phagen-Display-und Affinity Auswahl mit rekombinantem Protein-Köder

Using  recombinant phage as a scaffold to present various protein portions encoded by  a directionally cloned cDNA library to immobilized bait molecules ...

SIVQ-LCM Protocol for the ArcturusXT Instrument

SIVQ-LCM is a new methodology that automates and streamlines the more traditional, user-dependent laser dissection process.&#160;It aims to create an advanced, rapidly customizable laser dissection platform technology. In this report, we describe the integration of the image analysis software Spatially Invariant Vector Quantization (SIVQ) onto the ArcturusXT instrument. The ArcturusXT system contains both an infrared (IR) and ultraviolet (UV) laser, allowing for specific cell or large area dissections. The principal goal is to improve the speed, accuracy, and reproducibility of the laser dissection to increase sample throughput. This novel approach facilitates microdissection of both animal and human tissues in research and clinical workflows.

SIVQ-LCM is an innovative approach that harnesses a computer algorithm, Spatially Invariant Vector Quantization (SIVQ), to drive the laser capture microdissection (LCM) process. The SIVQ-LCM workflow greatly improves the speed and accuracy of microdissection, with applications in both the research and clinical settings.

SIVQ LCM-Protokoll für das Instrument ArcturusXT

SIVQ-LCM is a new methodology that automates and streamlines the more traditional, user-dependent laser dissection process.&#160;It aims to create an ...

A Protocol for Lentiviral Transduction and Downstream Analysis of Intestinal Organoids

Intestinal crypt-villus structures termed organoids, can be kept in sustained culture three dimensionally when supplemented with the appropriate growth factors. Since organoids are highly similar to the original tissue in terms of homeostatic stem cell differentiation, cell polarity and presence of all terminally differentiated cell types known to the adult intestinal epithelium, they serve as an essential resource in experimental research on the epithelium. The possibility to express transgenes or interfering RNA using lentiviral or retroviral vectors in organoids has increased opportunities for functional analysis of the intestinal epithelium and intestinal stem cells, surpassing traditional mouse transgenics in speed and cost. In the current video protocol we show how to utilize transduction of small intestinal organoids with lentiviral vectors illustrated by use of doxycylin inducible transgenes, or IPTG inducible short hairpin RNA for overexpression or gene knockdown. Furthermore, considering organoid culture yields minute cell counts that may even be reduced by experimental treatment, we explain how to process organoids for downstream analysis aimed at quantitative RT-PCR, RNA-microarray and immunohistochemistry. Techniques that enable transgene expression and gene knock down in intestinal organoids contribute to the research potential that these intestinal epithelial structures hold, establishing organoid culture as a new standard in cell culture.

In this video protocol we give a step by step explanation of lentiviral transduction in organoids of primary intestinal epithelium and of processing and downstream analysis of these cultures by quantitative RT-PCR, RNA-microarray and immunohistochemistry.

Ein Protokoll für Lentivirale Transduktion und Downstream-Analyse der Darm Organoide

Intestinal crypt-villus structures termed organoids, can be kept in sustained culture three dimensionally when supplemented with the appropriate growth ...

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (&#948;15N and &#948;13C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.

Most common gut content analyses of macroinvertebrates are visual. Requiring intense knowledge about morphological diversity of prey organisms, they miss soft bodied prey and, due to strong comminution of prey, are nearly impossible for some organisms, including amphipods. We provide detailed, novel genetic approaches for macroinvertebrate prey identification in the diet of amphipods.

Laborprotokoll für genetische Darm Inhaltsanalysen der aquatischen Makroinvertebraten Using gruppenspezifische rDNA Primer

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the ...