Ringraziamo Angelika Berg per l&#39;assistenza di laboratorio. Questo lavoro è stato sostenuto e finanziato dalla Max Planck Society e la Scuola di Jena per microbica Communication (JSMC).

1. Insetto allevamento <ol><li> Acquistare o avere uova grinfie di Spodoptera littoralis dal proprio allevamento. Mantenerle in piastre sterili a temperatura ambiente (RT) fino alla schiusa. </li><li> Preparare la dieta artificiale per gli insetti che allevano come segue: <ol><li> Mettere a bagno i fagioli bianchi 500 g di terra durante la notte in 100 ml di acqua. </li><li> Aggiungere 9,0 g di acido ascorbico e 75 g di agar a 1000 ml di acqua distillata H 2 O e poi bollire. </li><li> Lasciare la miscela a raffreddare e quando solidifica (a una miscela solido ceroso bianco) conservarla a 4 ° C fino all&#39;utilizzo. </li></ol></li><li> Trasferire le larve appena schiusi di una scatola di plastica pulito e posteriori sulla dieta artificiale a 23-25 ​​° C sotto un regime di lunga giornata con 16 ore di illuminazione e 8 ore di oscurità. Cambiare il cibo ogni giorno fino a quando le larve passare attraverso tutti i sei stadi larvali. </li></ol> 2. 13 C-etichettatura del DNA in batteri intestinali metabolicamente attivo <ol><li> Sciogliere 186,1 mg di glucosio completamente 13 C-marcato con acqua distillata e deionizzata (DDH 2 O) e mescolare bene con 100 g di dieta artificiale per l&#39;esperimento SIP. Garantire una concentrazione finale 13 C-glucosio di 10 mm nella dieta artificiale. Questo imita la concentrazione in situ glucosio nell&#39;intestino di S. littoralis larve si nutrono di piante di cotone secondo Shao et al. (presentato). </li><li> Trasferimento 9-15 sano secondo le larve instar dalla casella di allevamento di piastre di Petri di plastica sterile (una larva ogni capsula di Petri) contenenti fresca 13 C-glucosio spillo dieta artificiale. Utilizzare dieta artificiale contenente la stessa quantità di glucosio nativo (12 C-glucosio), come descritto, per l&#39;alimentazione del gruppo di controllo. </li><li> Rinnovare la dieta artificiale frequentemente durante il periodo di incubazione (1 giorno). Utilizzare condizioni di allevamento come al punto 1.3. </li><li> Raccogliere nove larve di ogni trattamento per una successiva elaborazione (estrazione del DNA). Ognireplicare è costituito da tre individui; fare almeno tre repliche per ogni trattamento. </li></ol> 3. Insetto Dissection <ol><li> Pulire e disinfettare gli strumenti di dissezione all&#39;inizio del lavoro con etanolo al 70% (Strumenti = forbici Vännäs, pinze e bisturi con sottili lame usa e getta). </li><li> Prendete gli insetti con un morbido pinza e lavare la pelle superficialmente con acqua distillata. Metterli in ghiaccio per almeno 30 minuti per anestetizzare loro. </li><li> Mentre ancora anestetizzato posto li a 0 ° C per 1 ora per ucciderli. Disinfettare gli insetti morti superficialmente immergendole in etanolo (70%) per un paio di minuti. </li><li> Eseguire la dissezione insetto in un volume di circa 15 ml di PBS 1x depositato su una piastra di Petri sterile (1XPBS = 137 mM NaCl, 2,7 mM KCl, 4,3 mM Na 2 HPO 4, 1,47 mM KH 2 PO 4, regolare il pH a 7,4 , autoclave). Essere sicuri di avere tutto il corpo dell&#39;insetto completamente immerso nel solutlitio durante l&#39;intero periodo di dissezione. </li><li> Iniziare la dissezione facendo un&#39;incisione nella pelle lungo il lato destro e sinistro dell&#39;insetto, inizio alla testa e finire l&#39;ano. Rimuovere tutta la pelle, tubuli malpighiani, e grasso corporeo. Passare a tampone fresco prima di tagliare aperto l&#39;intestino. Sezione l&#39;intestino in fore-, medio-, e hindgut quando è necessario. Conservare il tessuto nel congelatore (-80 a -20 ° C) fino al momento dell&#39;estrazione del DNA </li></ol> 4. Estrazione del DNA e amplificazione <ol><li> Posizionare il tessuto insetto in un tubo da centrifuga da 1,5 ml sterile e asciugare tutti i campioni a 45 ° C in un dispositivo concentratore a vuoto. Schiacciare tessuto essiccato con un pestello di plastica sterile. </li><li> Estrarre il DNA genomico utilizzando un kit adatto per l&#39;estrazione del DNA suolo. Trasferire il tessuto secco al tubo di reazione del kit e seguire le istruzioni come indicato dal produttore. </li><li> Determinare la concentrazione del DNA eluito finale utilizzando uno spettrofotometro. </li><li> Verifya successo estrazione del DNA microbico metagenomic dall&#39;intestino insetto preparando un test PCR diagnostica utilizzando eubatterica primer generali 27f (5 - AGAGTTTGATCCTGGCTCAG -3) e 1492r (5 - GGTTACCTTGTTACGACTT -3). Impostare la reazione di PCR come segue: <ol><li> Impostare una miscela di reazione contenente 50 microlitri 1x tampone, 1,5 mM MgCl 2, 10 mM quattro trifosfati deossinucleoside (dNTP), 2.5 U di Taq DNA Polymerase, 0,5 mM di ciascun primer e 60 ng di DNA estratto come template. </li><li> Eseguire reazioni PCR utilizzando un termociclatore come segue: denaturazione iniziale a 94 ° C per 3 min, seguiti da 35 cicli: 94 ° C per 45 sec, annealing a 55 ° C per 30 sec, ed estensione a 72 ° C per 1 min . Utilizzare una fase di estensione finale a 72 ° C per 10 min. </li><li> Verifica successo amplificazione PCR in un agarosio 1% elettroforesi bromuro di etidio (EB) gel colorato (sciogliere 1 g di agarosio in 100 ml di tampone TAE 1x e macchia con 1ml EB). Cassetta di 5 ml di the PCR prodotto + 1ml di 6x loading dye nelle tasche di gel. (TAE 1x = 40 mM Tris-Base, 20 mM di acido acetico glaciale, 1 mM EDTA, regolare a pH 8). </li><li> Eseguire il gel utilizzando tampone 1xTAE a 300 V, 115 mA per ca. 20 min in una camera di elettroforesi. Utilizzando una camera di documentazione gel (transilluminatore UV collegato ad una fotocamera digitale e computer) osservare il gel e confrontare le dimensioni del vostro prodotto finale con il gene marcatore anche caricato, la dimensione corretta delle ampliconi deve essere di circa 1,5 kb. </li></ol></li><li> Immagazzinare i prodotti di PCR in condizioni di surgelazione, preferibilmente -80 ° C, fino al momento dell&#39;uso. </li></ol> 5. Separazione-CsCl DNA Gradient Ultracentrifugazione <ol><li> Preparare i reagenti per i gradienti per ultracentrifugazione come segue: <ol><li> Preparare una M di cloruro di cesio (CsCl) soluzione 7.163 sciogliendo gradualmente 603,0 g di CsCl in DDH 2 O e riempire fino a un volume finale di 500 ml. </li><li> Accuratamente deTermine la densità della soluzione CsCl preparata pesando 1,0 ml aliquota su un equilibrio tre cifre da triplicato. Questo varia solitamente da 1,88 e 1,89 g / ml a temperatura ambiente. </li><li> Preparare il tampone gradiente (Tris 100 mM, KCl 100 mM e EDTA 1 mM) combinando 50 ml di 1 M Tris-HCl (pH 8,0), 1 ml di 0,5 M EDTA (pH 8) e 3,75 g di KCl in un finale volume di 500 ml con DDH 2 O. Filtro (0,22 micron) e sterilizzare in autoclave questa soluzione. </li></ol></li><li> Separazione DNA <ol><li> Avendo stabilito la concentrazione di DNA individuale degli insetti trattati, misurato come al punto 4.3, piscina quegli insetti corrispondenti ad una replica insieme e normalizzare la loro concentrazione DNA per garantire che ciascuno, ugualmente contribuisce al campione collettivo. Una concentrazione finale di 500-5,000 ng di DNA (misura nuovamente la concentrazione finale) è adatto per il processo ultracentrifugazione 21. </li><li> Per impostare il dislivello medio, unire il DNA quantificato, buffer di pendenza di und 4.8 ml di soluzione 7.163 M CsCl insieme ad un volume misto di 6,0 ml in una provetta sterile da 15 ml con tappo a vite (generazione di una miscela medio DNA gradiente). </li><li> Posizionare accuratamente la miscela medio DNA gradiente preparato in una provetta da 5,1 ml ultracentrifuga (riempire fino alla base del collo tubo) usando una siringa con ago. Evitare di pompaggio o la formazione di eventuali bolle d&#39;aria. Includere almeno un gradiente bianco (usando DDH 2 O invece di DNA) in ogni corsa centrifuga come gradiente di riferimento. </li><li> Coppie di tubi Saldo entro 10 mg di peso dopo ogni dislivello medio richiesto è riempito nella rispettiva provetta ultracentrifuga. Sigillare il tubo con un &quot;Topper Tube&quot; e assicurarsi che il sigillo è a tenuta invertendo il tubo e applicando una pressione moderata a mano. </li><li> Utilizzare un rotore verticale vicino con otto pozzi per lo svolgimento di 5,1 ml tubi ultracentrifugazione per l&#39;ultracentrifugazione. Sigillare accuratamente i pozzetti del rotore e caricare il rotore nello ultracentrifuga secondo il mAistruzioni di azienda i valori. Impostare le condizioni ultracentrifugazione: centrifuga a 50.000 rpm (circa 177.000 xg), temperatura a 20 ° C, e ultracentrifugazione durata per 40 ore con il vuoto. Selezionare massima accelerazione e la decelerazione senza freno. </li><li> Una volta terminato, rimuovere con attenzione i tubi dal rotore della centrifuga con pinze. Metterli in un rack senza disturbare i gradienti formate all&#39;interno dei tubi. Elaborare i campioni di frazionamento gradiente appena possibile per minimizzare qualsiasi diffusione. </li></ol></li><li> Recupero di DNA da gradienti isopicnica separati da frazionamento <ol><li> Utilizzare un accurato sistema di pompa HPLC per effettuare il frazionamento gradiente, che separa ugualmente i gradienti formate dal metodo di spostamento superiore del tubo ultracentrifuga. Collegare la pompa HPLC (100% di pendenza di flusso) per la bottiglia riempita con 1 L di spostamento DDH 2 O e strettamente collegare al tubo della pompa aperta con un 23 G 1 ago della siringa. Aggiungere sufficiente bromophenol colorante blu per la DDH 2 O per dargli un colore blu scuro. Questo facilita la visualizzazione dell&#39;interfaccia tra il gradiente medio e lo spostamento di DDH 2 O. </li><li> Impostare la pompa ad una portata di 850 ml / min ed equilibrare il sistema fino a quando una goccia del colore blu DDH 2 O emerge dalla siringa. </li><li> Fissare accuratamente il tubo ultracentrifuga a un supporto pinza e perforare il fondo del tubo con una siringa 23 G 1 in lungo ago. Collegare la pompa al tubo ultracentrifuga inserendo l&#39;ago attaccato al tubo della pompa nella parte superiore del tubo, e raccogliere gocce dal basso direttamente in provette da 1,5 ml microcentrifuga sterili. Raccogliere una piccola parte ogni 30 sec, pari a circa 425 microlitri per ogni frazione ed un totale di 12 frazioni per gradiente. Si noti che l&#39;ultima frazione (frazione 12) contiene di solito lo spostamento DDH 2 O e deve essere eliminata. </li><li> Dopo il frazionamento, miasure la densità di tutte le frazioni separate utilizzando una bilancia analitica di cui al punto 5.1.2. </li><li> Precipitare il DNA da ogni frazione (circa 425 ml) dalla prima aggiungendo 1 ml di glicogeno (20 mg / mL in DDH 2 O, autoclavato) come supporto per la precipitazione della bassa quantità di DNA. Mescolare bene per inversione. </li><li> Aggiungere due volumi (850 microlitri) di polietilene glicole soluzione (PEG) (sciogliere 150 g di polietilenglicole 6000 e 46,8 g di NaCl in DDH 2 O ad un volume totale di 500 ml. Filtro, sterilizzare e autoclave. La soluzione PEG è 30 % PEG 6000 e 1,6 M NaCl), e mescolare ancora una volta capovolgendo dieci volte. </li><li> Lasciare le provette a temperatura ambiente per almeno due ore (se necessario, durante la notte) per precipitare il DNA. </li><li> Centrifugare i precipitati a 13.000 xg per 30 minuti a RT. Un pellet visibile dovrebbe formare. </li><li> Rimuovere con attenzione il surnatante con una pipetta e lavare il precipitato con 500 ml di etanolo al 70%. Centrifugare sotto lo stessocondizioni per 10 min di nuovo. </li><li> Eliminare attentamente il supernatante e aria asciugare il pellet a temperatura ambiente per 15 min. </li><li> Riprendere il pellet di DNA secca in 30 ml di DDH 2 O e mescolare bene picchiettando delicatamente il tubo. Quantificare il DNA in ogni frazione gradiente come al punto 4.3 Conservare i campioni sotto -20 o -80 ° C se è richiesta una conservazione a lungo termine. </li></ol></li></ol> 6. DNA Caratterizzazione da Pyrosequencing <ol><li> Assicurarsi che il DNA nativo non marcato (12 C) occupa l&#39;intervallo di densità di 1.705 g / ml a 1.720 g / ml, mentre 13 C-marcato DNA ha una densità di circa 1,720-1,735 g / ml. Si noti che sia il nativo e 13 C-marcato DNA estratto da campioni ambientali possono estendersi su più frazioni gradiente. Aspettarsi il DNA luce di essere associata alle frazioni 9-11 e il DNA pesante per essere associati con le frazioni 4-6. </li><li> Combina frazioni chiave per creare un unico &quot;compilato&quot; frazione ac rappresentantecondo la ripartizione picco specifica del DNA densità risolta. In alternativa, altri mezzi per esaminare le frazioni separate utilizzando la spettrometria di massa rapporto isotopico (IRMS) 22 o un metodo di impronte digitali, come elettroforesi su gel denaturante gradiente (DGGE) 23, consentono di scegliere frazioni appropriate prima del sequenziamento. </li><li> Eseguire pyrosequencing delle PCR-amplificate 16S rRNA geni batterici provenienti dalle frazioni pesanti, medi e leggeri compilati di ogni singolo gradiente. Usando questo metodo, l&#39;identificazione della linea e l&#39;abbondanza relativa delle specie di batteri metabolicamente attive nel SIP campioni incubata è possibile. Eseguire pyrosequencing come segue: <ol><li> Eseguire amplicone pyrosequencing utilizzando uno strumento FLX Roche 454 con reagenti titanio. </li><li> Preparare ampliconi codici a barre per multiplexing utilizzando il primer di fusione impostato Gray28F (5 - GAGTTTGATCNTGGCTCAG -3) e Gray519r (5 - GTNTTACNGCGGCKGCTG -3) 24,25 esteso con °e rispettivo fondo adattatore A / B e identificatori multiplex specifico campione (MID). </li><li> Applicare una PCR one-step con 30 cicli, utilizzando un polimerasi Hot Start Taq, per generare la libreria sequenziamento. </li><li> Sequenza gli ampliconi in base al protocollo di fornitori, ed estendere la legge dalla direzione in avanti (Gray28F), come descritto nella <a href="http://www.researchandtesting.com/">http://www.researchandtesting.com/</a> . </li></ol></li></ol> 7. Pyrosequencing Analisi dei dati <ol><li> Analizzare la sequenza grezza letture generato dal 454 pyrosequencing con le &quot;intuizioni quantitativi nella ecologia microbica&quot;, software QIIME gasdotto 26. Esecuzione dell&#39;elaborazione come segue: <ol><li> Inizialmente, convertire il file SFF 454-macchina-generato FASTA, QUAL e file Flowgram con lo script process_sff.py. </li><li> Convalidare il file di mapping (sulla base di check_id_map.py) e assegnare multiplex legge al sam biologicoples con lo script split_libraries.py. Tagliare la bassa qualità si conclude con una dimensione della finestra scorrevole di 50 e un parametro di qualità media cutoff di 25, eliminano anche brevi sequenze ambigue (la lunghezza &lt;200 bp) dal dataset. </li><li> Denoise i dati 454 utilizzando il denoise_wrapper.py. </li><li> Avanti, gruppo l&#39;alta qualità legge in unità tassonomiche operative (Otus) utilizzando il multiplo OTU raccogliendo metodo (pick_otus.py con il 97% similarità di sequenza cut-off). </li><li> Scegliere una sequenza rappresentante di ogni OTU utilizzando pick_rep_set.py. </li><li> Assegnare tassonomia al set rappresentante sequenza in base a assign_taxonomy.py. Utilizzare il classificatore progetto di database ribosomiale (RDP) con una fiducia minima per l&#39;assegnazione record stabilito a 0,80. </li><li> Allineare la sequenza rappresentante insieme contro le preallineati Greengenes fondamentali 16S sequenze utilizzando l&#39;algoritmo PyNast (align_seqs.pycon il minimo identità di sequenza percentuale impostata su 75). </li><li> Inoltre, riducono le chimere da ulteriori analisi eseguendo identify_chimeric_seqs.py. </li><li> Rimuovere tutte le posizioni gap (non utili per l&#39;inferenza filogenetica) con il modello lanemask (filter_alignment.py) prima di costruire un albero filogenetico (make_phylogeny.py). </li><li> Infine, generare tabelle OTU con make_otu_table.py, descrivendo il verificarsi di filotipi batteriche all&#39;interno di ogni campione. Utilizzare la tabella OTU per costruire il heatmap per confrontare l&#39;abbondanza e attività batterica. </li><li> Se necessario, calcolare l&#39;alfa e beta diversità all&#39;interno e tra i campioni, rispettivamente. Allo stesso modo, le curve di rarefazione (grafici di diversità rispetto a profondità sequencing) e Principal Coordinate Analysis (PCOA) Trame rappresentano le relazioni tra le comunità microbiche possono anche essere preparati. </li></ol></li></ol>

<ol>
	<li>Pais, R., Lohs, C., Wu, Y. N., Wang, J. W., Aksoy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+obligate+mutualist+Wigglesworthia+glossinidia+influences+reproduction,+digestion,+and+immunity+processes+of+its+host,+the+tsetse+fly.">The obligate mutualist Wigglesworthia glossinidia influences reproduction, digestion, and immunity processes of its host, the tsetse fly.</a> Appl. Environ. Microbiol. 74, 5965-5974 (2008).</li><li>Freitak, D., Heckel, D. G., Vogel, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dietary-dependent+trans-generational+immune+priming+in+an+insect+herbivore.">Dietary-dependent trans-generational immune priming in an insect herbivore.</a> Proc. Biol. Sci. 276, 2617-2624 (2009).</li><li>Dillon, R. J., Vennard, C. T., Charnley, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Note:+Gut+bacteria+produce+components+of+a+locust+cohesion+pheromone.">A Note: Gut bacteria produce components of a locust cohesion pheromone.</a> J. Appl. Microbiol. 92, 759-763 (2002).</li><li>Douglas, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutritional+interactions+in+insect-microbial+symbioses:+Aphids+and+their+symbiotic+bacteria+Buchnera.">Nutritional interactions in insect-microbial symbioses: Aphids and their symbiotic bacteria Buchnera.</a> Annu. Rev. Entomol. 43, 17-37 (1998).</li><li>Reichardt, N., Barclay, A. R., Weaver, L. T., Morrison, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+stable+isotopes+to+measure+the+metabolic+activity+of+the+human+intestinal+microbiota.">Use of stable isotopes to measure the metabolic activity of the human intestinal microbiota.</a> Appl. Environ. Microbiol. 77, 8009-8014 (2011).</li><li>Dumont, M. G., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+isotope+probing+-+linking+microbial+identity+to+function.">Stable isotope probing - linking microbial identity to function.</a> Nat. Rev. Microbiol. 3, 499-504 (2005).</li><li>Gil, R., Latorre, A., Moya, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+endosymbionts+of+insects:+insights+from+comparative+genomics.">Bacterial endosymbionts of insects: insights from comparative genomics.</a> Environ. Microbiol. 6, 1109-1122 (2004).</li><li>Brune, A., VH, R. e. s. h., Card&#233;, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Encyclopedia of Insects. , 1132 (2005).</li><li>Breznak, J. A., Brune, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+microorganisms+in+the+digestion+of+lignocellulose+by+termites.">Role of microorganisms in the digestion of lignocellulose by termites.</a> Annu. Rev. Entomol. 39, 453-487 (1994).</li><li>Broderick, N. A., Raffa, K. F., Goodman, R. M., Handelsman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Census+of+the+bacterial+community+of+the+gypsy+moth+larval+midgut+by+using+culturing+and+culture-independent+methods.">Census of the bacterial community of the gypsy moth larval midgut by using culturing and culture-independent methods.</a> Appl. Environ. Microbiol. 70, 293-300 (2004).</li><li>Funke, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hydrolysis+of+quorum-sensing+molecules+in+the+gut+of+lepidopteran+larvae.">Rapid hydrolysis of quorum-sensing molecules in the gut of lepidopteran larvae.</a> Chembiochem. 9, 1953-1959 (2008).</li><li>Tang, X. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complexity+and+variability+of+gut+commensal+microbiota+in+polyphagous+lepidopteran+larvae.">Complexity and variability of gut commensal microbiota in polyphagous lepidopteran larvae.</a> PloS One. 7, (2012).</li><li>Amann, R. I., Ludwig, W., Schleifer, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phylogenetic+identification+and+in-situ+detection+of+individual+microbial-cells+without+cultivation.">Phylogenetic identification and in-situ detection of individual microbial-cells without cultivation.</a> Microbiol. Rev. 59, 143-169 (1995).</li><li>Olsen, G. J., Lane, D. J., Giovannoni, S. J., Pace, N. R., Stahl, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+ecology+and+evolution+-+a+ribosomal-rna+approach.">Microbial ecology and evolution - a ribosomal-rna approach.</a> Annu. Rev. Microbiol. 40, 337-365 (1986).</li><li>Pilloni, G., von Netzer, F., Engel, M., Lueders, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electron+acceptor-dependent+identification+of+key+anaerobic+toluene+degraders+at+a+tar-oil-contaminated+aquifer+by+Pyro-SIP.">Electron acceptor-dependent identification of key anaerobic toluene degraders at a tar-oil-contaminated aquifer by Pyro-SIP.</a> FEMS Microbiol. Ecol. 78, 165-175 (2011).</li><li>Lu, Y. H., Conrad, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+stable+isotope+probing+of+methanogenic+archaea+in+the+rice+rhizosphere.">In situ stable isotope probing of methanogenic archaea in the rice rhizosphere.</a> Science. 309, 1088-1090 (2005).</li><li>Radajewski, S., Ineson, P., Parekh, N. R., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable-isotope+probing+as+a+tool+in+microbial+ecology.">Stable-isotope probing as a tool in microbial ecology.</a> Nature. 403, 646-649 (2000).</li><li>Lueders, T., Pommerenke, B., Friedrich, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable-isotope+probing+of+microorganisms+thriving+at+thermodynamic+limits:+Syntrophic+propionate+oxidation+in+flooded+soil.">Stable-isotope probing of microorganisms thriving at thermodynamic limits: Syntrophic propionate oxidation in flooded soil.</a> Appl. Environ. Microbiol. 70, 5778-5786 (2004).</li><li>Kunapuli, U., Lueders, T., Meckenstock, R. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+stable+isotope+probing+to+identify+key+iron-reducing+microorganisms+involved+in+anaerobic+benzene+degradation.">The use of stable isotope probing to identify key iron-reducing microorganisms involved in anaerobic benzene degradation.</a> ISME J. 1, 643-653 (2007).</li><li>Fuhrer, T., Fischer, E., Sauer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+identification+and+quantification+of+glucose+metabolism+in+seven+bacterial+species.">Experimental identification and quantification of glucose metabolism in seven bacterial species.</a> J. Bacteriol. 187, 1581-1590 (2005).</li><li>Dunford, E. A., Neufeld, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Stable-Isotope+Probing+(DNA-SIP).">DNA Stable-Isotope Probing (DNA-SIP).</a> J. Vis. Exp. (42), (2010).</li><li>Yamasaki, S., Nomura, N., Nakajima, T., Uchiyama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cultivation-independent+identification+of+candidate+dehalorespiring+bacteria+in+tetrachloroethylene+degradation.">Cultivation-independent identification of candidate dehalorespiring bacteria in tetrachloroethylene degradation.</a> Environ. Sci. Technol. 46, 7709-7716 (2012).</li><li>Lueders, T., Manefield, M., Friedrich, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+sensitivity+of+DNA-+and+rRNA-based+stable+isotope+probing+by+fractionation+and+quantitative+analysis+of+isopycnic+centrifugation+gradients.">Enhanced sensitivity of DNA- and rRNA-based stable isotope probing by fractionation and quantitative analysis of isopycnic centrifugation gradients.</a> Environ. Microbiol. 6, 73-78 (2004).</li><li>Ishak, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+diversity+in+Solenopsis+invicta+and+Solenopsis+geminata+ant+colonies+characterized+by+16S+amplicon+454+pyrosequencing.">Bacterial diversity in Solenopsis invicta and Solenopsis geminata ant colonies characterized by 16S amplicon 454 pyrosequencing.</a> Microb. Ecol. 61, 821-831 (2011).</li><li>Sun, Y., Wolcott, R. D., Dowd, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tag-encoded+FLX+amplicon+pyrosequencing+for+the+elucidation+of+microbial+and+functional+gene+diversity+in+any+environment.">Tag-encoded FLX amplicon pyrosequencing for the elucidation of microbial and functional gene diversity in any environment.</a> Methods Mol. Biol. 733, 129-141 (2011).</li><li>Kuczynski, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+QIIME+to+Analyze+16S+rRNA+Gene+sequences+from+microbial+communities.">Using QIIME to Analyze 16S rRNA Gene sequences from microbial communities.</a> Curr. Protoc. Microbiol. Chapter 1, Unit1E 5 (2012).</li><li>Dillon, R. J., Dillon, V. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gut+bacteria+of+insects:+nonpathogenic+interactions.">The gut bacteria of insects: nonpathogenic interactions.</a> Annu. Rev. Entomol. 49, 71-92 (2004).</li><li>Neufeld, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+stable-isotope+probing.">DNA stable-isotope probing.</a> Nat. Protoc. 2, 860-866 (2007).</li><li>Dumont, M. G., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+isotope+probing+-+linking+microbial+identity+to+function.">Stable isotope probing - linking microbial identity to function.</a> Nat. Rev. Microbiol. 3, 499-504 (2005).</li></ol>

Non abbiamo nulla da rivelare.

L&#39;intestino della maggior parte degli insetti ospita una comunità microbica ricco e complesso, in genere 10 7 -10 9 cellule procariote alloggiano lì, superando in numero le cellule dell&#39;ospite nella maggior parte dei casi. Così, l&#39;intestino insetto è un &quot;hot spot&quot; per diverse attività microbiche, che rappresenta molteplici aspetti delle relazioni microbici, da patogenesi di obbligare mutualismo 27. Anche se molti studi hanno descritto una straordinaria varietà...

Associazioni simbiotiche Insect-batteriche sono conosciute per un gran numero di specie di insetti 7. In queste associazioni simbiotiche, i microrganismi svolgono un ruolo importante nella crescita e nello sviluppo di insetti. I microbi hanno dimostrato di contribuire alla riproduzione insetto 1, feromone biosintesi 3, alimentazione, compresa la sintesi di amminoacidi essenziali 4, e la digestione del cibo inaccessibili all&#39;host. Nonostante la grande varietà di associazioni gut-batterica, tanto meno si sa circa il ruolo funzionale che svolgono a favore degli insetti. Solo in caso di termiti, la digestione simbiotico di lignocellulosa effettuata da procarioti, protozoi e funghi, è stata ampiamente studiata 8,9. In contrasto con questo, poco si sa circa l&#39;associazione simbiotica presente nell&#39;intestino degli insetti generalisti cioè il leafworm cotone, Spodoptera littoralis. Inoltre, a causa del loro spostamento frequente di piante ospiti, generaleTSI insetti e loro intestino comunità batteriche associate sono esposti in modo permanente alle nuove sfide legate alle loro abitudini alimentari consumando piante con una pletora di sostanze fitochimiche. Oltre a questo, l&#39;ambiente intestinale in lepidotteri, costituisce di per sé un ambiente difficile per la crescita di batteri causa della elevata budello pH 10. In particolare nel caso di S. littoralis, si va dal 10,5 al foregut, ca. 9 nella midgut a pH quasi 7 nella hindgut 11. D&#39;altra parte, la comunità batterica associata con l&#39;intestino di S. littoralis è semplice. Tang, Freitak, et al. 12 hanno riportato un massimo di 36 filotipi appartenenti ad un totale di 7 diverse specie batteriche come unici membri della comunità batterica associata a questo insetto. Oltre a questo, non complicata procedura allevamento è necessaria per la crescita degli insetti in laboratorio. Inoltre, questo e il breve ciclo di vita dell&#39;insetto facilitare multi-gstudi enerational, trasformando questa specie in un sistema modello ideale per lo studio delle interazioni gut-microbo. Con l&#39;avvento delle tecnologie di sequenziamento basate sulla PCR, il numero di studi che si occupano di budello biota di diversi organismi (cioè esseri umani, insetti o organismi marini) è aumentata. Inoltre, i risultati sono indipendenti da isolamento e la coltura dei batteri intestinali nutrito come in passato. Quasi il 99% dei batteri non sono coltivabili e la simulazione delle condizioni ambientali prevalenti nell&#39;intestino è difficile 12. Utilizzando PCR, 16S rRNA frammenti di geni (un gene marcatore filogenetico ampiamente utilizzato tra i batteri) potrebbero essere selettivamente amplificati da un modello di DNA misto di comunità batteriche intestinali, sequenziati e clonati. Con queste informazioni, l&#39;utente è in grado di identificare le specie batteriche dopo aver recuperato le informazioni sulla sequenza da database pubblici 13,14. Tuttavia, la sequenza si avvicina a descrivere battericacomunità rimangono insufficienti a causa della mancanza di informazioni sul contributo metabolica intrinseca delle singole specie all&#39;interno della comunità. Stabile-isotopo sondaggio (SIP) è una tecnica priva di cultura promettente. E &#39;spesso utilizzato in microbiologia ambientale per analizzare filogenesi microbica legati a particolari attività metaboliche. Ciò si ottiene usando stable, isotopi etichettato atomi di substrati in biomarker microbici, quali acidi grassi derivati ​​da fosfolipidi, DNA e RNA 5. Quando si considera acidi nucleici, la metodologia è basata sulla separazione di 13 C-marcato DNA o RNA dal DNA non marcato dal gradiente di densità ultracentrifugazione 6. A causa di questa connessione diretta tra l&#39;etichetta DNA e l&#39;attività metabolica, un&#39;analisi molecolare a valle degli acidi nucleici individua le specie e fornisce informazioni sulle attività metaboliche. Inoltre, la combinazione di DNA-SIP e pyrosequencing come applicato dallaPilloni, von Netzer, et al. 15, permette una particolare identificazione semplice e sensibile delle specie batteriche presenti nella frazione DNA pesante 13 C-marcato. Fino ad ora, questa tecnica è stata applicata per descrivere le comunità batteriche coinvolte in processi biochimici nel terreno sotto 16,17 aerobiche e anaerobiche condizioni 18,19. Oltre all&#39;uso in scienze ambientali, la tecnica è stata applicata per la medicina come riportato da Reichardt, et al. 5, che descrive le attività metaboliche dei diversi gruppi filogenetici del microbiota intestinale umano in risposta ad un carboidrato nondigestible. Qui usiamo 13 C-glucosio di &#39;label&#39; il DNA delle specie batteriche metabolicamente attivi nell&#39;intestino. Il glucosio è uno zucchero utilizzato dalla maggior parte delle specie batteriche lungo la diffusa Entner-Doudoroff (ED) percorso, anche se le eccezioni sono noti 20. Questogiustifica l&#39;utilizzo di 13 C-glucosio come sonda metabolico affidabile che fornisce un collegamento tra metaboliti di interesse e la fonte di carbonio lungo percorsi stabiliti. A seconda della domanda scientifica, altri substrati, cioè 13 C-metano, 13 CO 2, o piante ottenute sotto atmosfera di 13 CO 2, può essere utilizzato per affrontare attività metaboliche. A questo punto, presentiamo il protocollo applicato nella caratterizzazione metabolica della comunità batterica intestinale di un insetto generalista, cioè S. littoralis (Lepidoptera, Noctuidae). Inoltre, la tecnica è stata accoppiata con pyrosequencing, che a sua volta permette l&#39;identificazione di insetto comunità batterica intestinale con alta risoluzione e precisione. Come substrato principale, 13 C-glucosio marcato è stato utilizzato durante gli esperimenti.

<table border="0" cellpadding="0" cellspacing="0" width="872"> 
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:384px;">Dumont #5 Mirror Finish Forceps</td>
			<td style="width:203px;">Fine Science Tools</td>
			<td style="width:135px;">11251-23</td>
			<td style="width:151px;"> </td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vannas Spring Scissors</td>
			<td>Fine Science Tools</td>
			<td>15000-00</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Speed Vacuum Concentrator 5301</td>
			<td>Eppendorf Germany</td>
			<td>5305 000.304</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Plastic pestle</td>
			<td>Carl Roth GmbH Co. Germany</td>
			<td>P986.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NanoVue spectrophotometer</td>
			<td>GE HealthCare, UK</td>
			<td>28-9569-58</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mastercycler pro/thermocycler</td>
			<td>Eppendorf Germany</td>
			<td>6321 000.515</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agagel Standard Horizontal Gel Electrophoresis chamber</td>
			<td>Biometra</td>
			<td>Discontinued</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultracentrifuge (Optima L-90K)</td>
			<td>Beckman</td>
			<td>A20684</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultracentrifuge rotor (NVT 90)</td>
			<td>Beckman</td>
			<td>362752</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HPLC pump</td>
			<td>Agilent</td>
			<td>1100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Quick-Seal, Polyallomer tube</td>
			<td>Beckman</td>
			<td>342412</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Transilluminator UVstar 15 </td>
			<td>Biometra</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

identification of metabolically active bacteria in the gut of the generalist spodoptera littoralis via dna stable isotope probing using 13c-glucose

Guts della maggior parte degli insetti sono abitate da comunità complesse di batteri non patogeni simbiotici. All&#39;interno di queste comunità microbiche è possibile identificare commensali o batteri mutualistiche specie. Questi ultimi, sono stati osservati per servire molteplici funzioni per l&#39;insetto, ossia ad assistere nella riproduzione insetto 1, stimolare la risposta immunitaria 2, produzione feromone 3, così come la nutrizione, tra cui la sintesi di amminoacidi essenziali 4, tra gli altri. Data l&#39;importanza di queste associazioni, sono stati fatti molti sforzi per caratterizzare le comunità fino ai singoli membri. Tuttavia, la maggior parte di questi sforzi sono stati entrambi basati su metodi di coltivazione o invocato la generazione di frammenti del gene 16S rRNA che sono stati sequenziati per l&#39;identificazione finale. Purtroppo, questi approcci solo individuate le specie batteriche presenti nell&#39;intestino e non hanno fornito alcuna informatione sull&#39;attività metabolica dei microrganismi. Per caratterizzare le specie batteriche metabolicamente attive nell&#39;intestino di un insetto, abbiamo usato isotopo stabile tastatura (SIP) in vivo impiegando 13 C-glucosio come substrato universale. Questa è una tecnica priva di cultura promettente che permette il collegamento di filogenesi microbica per la loro particolare attività metabolica. Ciò è possibile inseguimento stabili, isotopi etichettato atomi di substrati in biomarker microbici, come DNA e RNA 5. L&#39;incorporazione di 13 C isotopi nel DNA aumenta la densità del DNA marcato rispetto al non marcato (12 C) uno. Alla fine, il DNA 13 C-marcato o RNA è separato mediante ultracentrifugazione in gradiente di densità del 12 C-marcato una simile 6. La successiva analisi molecolare dei isotopomeri separati acidi nucleici fornisce il collegamento tra l&#39;attività metabolica e l&#39;identità delle specie. Qui vi presentiamo il protocollo utilizzato per caratterizzare i batteri metabolicamente attivi nell&#39;intestino di un insetto generalista (il nostro modello di sistema), Spodoptera littoralis (Lepidoptera, Noctuidae). L&#39;analisi filogenetica del DNA è stata effettuata usando pyrosequencing, che ha permesso alta risoluzione e precisione nell&#39;identificazione del budello insetto comunità batterica. Come substrato principale, 13 C-glucosio marcato è stato usato negli esperimenti. Il substrato è stato alimentato agli insetti con una dieta artificiale.

Per ottenere un&#39;etichettatura adeguata dei batteri metabolicamente attive presenti nell&#39;intestino dell&#39;insetto, l&#39;insetto deve essere esposto alla ricca-C substrato 13 per un periodo già ottimizzata sufficiente per consentire la separazione della frazione più pesante etichettata facilmente dal marcato leggero. Nel nostro caso, 13 C-glucosio è stata integrata nella dieta artificiale ad una concentrazione finale di 10 mM per 1 giorno (Figura 1A). La stessa quantit?...

Watch this Scientific Journal Video about Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose at JoVE.co

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

La comunità batterica attivo associato con l&#39;intestino di Spodoptera littoralis, è stato determinato mediante stabile-isotopo probing (SIP) accoppiato a pyrosequencing. Utilizzando questa metodologia, l&#39;identificazione delle specie di batteri metabolicamente attivi all&#39;interno della comunità è stato fatto con alta risoluzione e precisione.

Identificazione dei batteri metabolicamente attivo nell&#39;intestino del generalista<em&gt; Spodoptera littoralis</em&gt; Via DNA isotopi stabili Probing Utilizzo<sup&gt; 13</sup&gt; C-glucosio

Guts of most insects are inhabited by complex communities of symbiotic nonpathogenic bacteria. Within such microbial communities it is possible to ...

identification-metabolically-active-bacteria-gut-generalist

Research

JoVE Journal

Biology

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

15.2K Views.  Max Planck Institute for Chemical Ecology.  La comunità batterica attivo associato con l'intestino di Spodoptera littoralis, è stato determinato mediante stabile-isotopo probing (SIP) accoppiato a pyrosequencing. Utilizzando questa metodologia, l'identificazione delle specie di batteri metabolicamente attivi all'interno della comunità è stato fatto con alta risoluzione e precisione. 

Video: Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

Extracting DNA from the Gut Microbes of the Termite (Zootermopsis Angusticollis) and Visualizing Gut Microbes

Termites are among the few animals known to have the capacity to subsist solely by consuming wood.  The termite gut tract contains a dense and species-rich microbial population that assists in the degradation of lignocellulose predominantly into acetate, the key nutrient fueling termite metabolism (Odelson &amp; Breznak, 1983).  Within these microbial populations are bacteria, methanogenic archaea and, in some ("lower") termites, eukaryotic protozoa. Thus, termites are excellent research subjects for studying the interactions among microbial species and the numerous biochemical functions they perform to the benefit of their host.  The species composition of microbial populations in termite guts as well as key genes involved in various biochemical processes has been explored using molecular techniques (Kudo et al., 1998; Schmit-Wagner et al., 2003; Salmassi &amp; Leadbetter, 2003). These techniques depend on the extraction and purification of high-quality nucleic acids from the termite gut environment.  The extraction technique described in this video is a modified compilation of protocols developed for extraction and purification of nucleic acids from environmental samples (Mor  et al., 1994; Berthelet et al., 1996; Purdy et al., 1996; Salmassi &amp; Leadbetter, 2003; Ottesen et al. 2006) and it produces DNA from termite hindgut material suitable for use as template for polymerase chain reaction (PCR).

Extracting DNA from the Gut Microbes of the Termite Zootermopsis Angusticollis and Visualizing Gut Microbes

This video illustrates the technique for extracting DNA from the species of microbes resident in the termite hindgut. The preparation of a wet mount slide, which is useful for visualizing the gut microbial community is also illustrated, and a tour through the species-rich gut environment is given.

Estrazione del DNA da microbi intestinali della Termite (Zootermopsis Angusticollis) e visualizzare microbi intestinali

Termites are among the few animals known to have the capacity to subsist solely by consuming wood.  The termite gut tract contains a dense and ...

Ricerca

Biologia

DNA Stable-Isotope Probing (DNA-SIP)

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and nutrients into cellular biomass. As such, this cultivation-independent technique has been an important methodology for assigning metabolic function to the diverse communities inhabiting a wide range of terrestrial and aquatic environments. Following the incubation of an environmental sample with stable-isotope labelled compounds, extracted nucleic acid is subjected to density gradient ultracentrifugation and subsequent gradient fractionation to separate nucleic acids of differing densities. Purification of DNA from cesium chloride retrieves labelled and unlabelled DNA for subsequent molecular characterization (e.g. fingerprinting, microarrays, clone libraries, metagenomics). This JoVE video protocol provides visual step-by-step explanations of the protocol for density gradient ultracentrifugation, gradient fractionation and recovery of labelled DNA. The protocol also includes sample SIP data and highlights important tips and cautions that must be considered to ensure a successful DNA-SIP analysis.

DNA Stable-Isotope Probing DNA-SIP

DNA stable-isotope probing is a cultivation-independent method to identify and characterize active communities of microorganisms that are capable of utilizing specific substrates. Assimilation of substrate enriched in heavy isotope leads to incorporation of labelled atoms into microbial biomass. Density gradient ultracentrifugation retrieves labelled DNA for downstream molecular analyses.

DNA Stabile-isotopica Probing (DNA-SIP)

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

Ricostituzione in vitro di Active T. castaneum telomerasi

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Visualization of DNA Replication in the Vertebrate Model System DT40 using the DNA Fiber Technique

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not only ensure faithful genome duplication in the face of endogenous and exogenous DNA damage but also prevent genomic instability, a recognized causative factor in tumor development.
Here, we describe a simple and cost-effective fluorescence microscopy-based method to visualize DNA replication in the avian B-cell line DT40. This cell line provides a powerful tool to investigate protein function in vivo by reverse genetics in vertebrate cells1. DNA fiber fluorography in DT40 cells lacking a specific gene allows one to elucidate the function of this gene product in DNA replication and genome stability. Traditional methods to analyze replication fork dynamics in vertebrate cells rely on measuring the overall rate of DNA synthesis in a population of pulse-labeled cells. This is a quantitative approach and does not allow for qualitative analysis of parameters that influence DNA synthesis. In contrast, the rate of movement of active forks can be followed directly when using the DNA fiber technique2-4. In this approach, nascent DNA is labeled in vivo by incorporation of halogenated nucleotides (Fig 1A). Subsequently, individual fibers are stretched onto a microscope slide, and the labeled DNA replication tracts are stained with specific antibodies and visualized by fluorescence microscopy (Fig 1B). Initiation of replication as well as fork directionality is determined by the consecutive use of two differently modified analogues. Furthermore, the dual-labeling approach allows for quantitative analysis of parameters that influence DNA synthesis during the S-phase, i.e. replication structures such as ongoing and stalled forks, replication origin density as well as fork terminations. Finally, the experimental procedure can be accomplished within a day, and requires only general laboratory equipment and a fluorescence microscope.

DT40, a model vertebrate genetic system, provides a powerful tool to analyze protein function. Here we describe a simple method that allows qualitative analysis of parameters that influence DNA synthesis during the S-phase in DT40 cells at the single molecule level.

Visualizzazione della replicazione del DNA nei vertebrati DT40 sistema modello utilizzando la tecnica del DNA Fiber

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not ...

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

Identificazione delle modificazioni post-traduzionali di proteine ​​vegetali Complessi

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

Immunoprecipitazione della cromatina Saggio per la identificazione di Arabidopsis interazioni proteina-DNA<em&gt; In Vivo</em

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Amplificazione, sequenziamento di prossima generazione, e DNA genomico mappatura dei siti di integrazione retrovirali

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ecologically-important endpoints, though they are rarely considered in toxicological studies. D. melanogaster is emerging as a toxicology model for the behavioral, neurological, and genetic impacts of toxicants, to name a few. More importantly, species in the genus Drosophila can be utilized as a model system for an integrative framework approach to incorporate emergent properties and answer ecologically-relevant questions in&#160;toxicology research. The aim of this paper is to provide a protocol for exposing species in the genus Drosophila to pollutants to be used as a model system for a range of phenotypic outputs and ecologically-relevant questions. More specifically, this protocol can be used to 1) link multiple biological levels of organization and understand the impact of toxicants on both individual- and population-level fitness; 2) test the impact of toxicants at different stages of developmental exposure; 3) test multigenerational and evolutionary implications of pollutants; and 4) test multiple contaminants and stressors simultaneously.

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

In this paper, we provide a detailed protocol for exposing species in the genus Drosophila to pollutants with the goal of studying the impact of exposure on a range of phenotypic outputs at different developmental stages and for more than one generation.

Protocollo sperimentale per l'utilizzo di Drosophila come sistema modello invertebrati marini per test di tossicità in laboratorio

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ...

Establishing Stable Binary Cultures of Symbiotic Saccharibacteria from the Oral Cavity

Many bacterial species cannot be cultured in the laboratory using standard methods, posing a significant barrier to studying the majority of microbial diversity on earth. Novel approaches are required to culture these uncultured bacteria so that investigators can effectively study their physiology and lifestyle using the powerful tools available in the laboratory. The Candidate Phyla Radiation (CPR) is one of the largest groups of uncultivated bacteria, comprising ~15% of the living diversity on earth. The first isolate of this group was a member of the Saccharibacteria phylum, 'Nanosynbacter lyticus' strain TM7x. TM7x is an unusually small bacterium that lives as a symbiont in direct contact with a bacterial host, Schaalia odontolytica, strain XH001. Taking advantage of the unusually small cell size and its lifestyle as a symbiotic organism, we developed a protocol to rapidly culture Saccharibacteria from dental plaque. This protocol will show how to filter a suspension of dental plaque through a 0.2 &#181;m filter, then concentrate the collected Saccharibacteria cells and infect a culture of host organisms. The resulting coculture can be passaged as any normal bacterial culture and infection is confirmed by PCR. The resulting binary culture can be maintained in the laboratory and used for future experiments. While contamination is a possibility, the binary culture can be purified by either further filtering and reinfection of host, or by plating the binary culture and screening for infected colonies. We hope this protocol can be expanded to other sample types and environments, leading to the cultivation of many more species in the CPR.

We demonstrate a method for isolating difficult-to-grow members of the novel bacterial phylum, Saccharibacteria, by filtering dental plaque and co-culturing with host bacteria.

Stabilire culture binarie stabili di Saccharibacteria simbiotici dalla cavità orale

Many bacterial species cannot be cultured in the laboratory using standard methods, posing a significant barrier to studying the majority of microbial ...

Identification of Alternative Splicing and Polyadenylation in RNA-seq Data

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also be utilized to explore other complex regulatory mechanisms at the exon level. Alternative splicing and polyadenylation play a crucial role in the functional diversity of a gene by generating different isoforms to regulate gene expression at the post-transcriptional level, and limiting analyses to the whole gene level can miss this important regulatory layer. Here, we demonstrate detailed step by step analyses for identification and visualization of differential exon and polyadenylation site usage across conditions, using Bioconductor and other packages and functions, including DEXSeq, diffSplice from the Limma package, and rMATS.

Alternative splicing (AS) and alternative polyadenylation (APA) expand the diversity of transcript isoforms and their products. Here, we describe bioinformatic protocols to analyze bulk RNA-seq and 3' end sequencing assays to detect and visualize AS and APA varying across experimental conditions.

Identificazione di splicing alternativo e poliadenilazione in dati di RNA-seq

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also ...