이 작품은 우수 온타리오 센터와 온타리오 연구 기금 JK 보조금에 의해 가능하게되었다. 우리는 촬영하는 동안 기술 지원을 Siddika Pardhan 박사 피터 퍼거슨 감독에게 감사의 말씀을 전합니다.

참고 : 다음 프로토콜이 부착 세포와 함께 사용하도록 설계되었습니다. 수정은 정지에서 재배 비 부착 세포에 방법을 적용해야합니다. 프로토콜에 설명 된 CAM 실험은 형광 표지 (예를 들면, GFP, RFP 등)를 발현하는 세포와 함께 사용하도록 설계된다. 나인 일된 닭 배아 CAM 실험에 대한 실험 프로토콜의 2 일에 필요합니다. 1. 준비 및 안티센스 올리고 뉴클레오티드와 종양 세포의 형질 (ASOS) <ol><li> 관심의 세포를 포함하는 T75 플라스크 (들)에서 대기음 매체는 1XPBS로 세척하고, 0.25 % 트립신 / EDTA 2 ㎖를 추가합니다. 각 플라스크에 완전 성장 배지 10 ㎖를 첨가하고 50 ㎖ 튜브 용액에 세포를 옮긴다. 세포를 세어 최종 농도는 1 ㎖ 당 1.0 × 105 세포가되도록 양을 조정한다. </li><li> T25 플라스크의 라벨 두 그룹 : 한 그룹은 1-8 표시 여덟 플라스크를 포함하며, U 될 것입니다실시간 대사 측정 실험 SED; 두 번째 그룹은 8 주 형틀을 포함하고 닭 배아 CAM 실험에 사용한다. 인큐베이터에있는 각 플라스크 및 장소 (37 ° C, 5 % CO 2 O / N)에 솔루션 세포 2 ㎖를 추가합니다. </li><li> 다음날 아침 (주 0, 0 분), 라벨 세 5 ml의 튜브를 다음과 같이 제어 (비 대상 ASO 또는 siRNA를), &#39;관심의 대상&#39;(즉, 대상 ASO 또는 siRNA를), 리포 펙 타민 2000 (또는 유사한 형질 전환 시약). 적합한 튜브에서 무 혈청 배지로 적당한 농도 ASO 스톡 용액을 희석. <ol><li> 적절한 튜브에 형질 전환 시약의 요구량을 첨가하고, 5 분 동안 무 혈청 배지에서 배양한다. ASO 튜브에 형질 전환 시약 솔루션을 추가하고 20 분 동안 품어. </li></ol></li><li> 각 그룹에서 플라스크 1-4의 각 제어 ASO 형질 전환 시약 용액 250 μl를 추가, 250각각의 그룹 내의 5-8 플라스크 각각에 &#39;관심 대상&#39;ASO 형질 감염 시약 용액 μL. 4 시간 (37 ᵒC, 5 % CO 2)에 대해 품어. <ol><li> 배양하는 동안, 2.1 절에 설명 된 단계를 수행한다. 배양 후, CAM 실험 그룹의 각 플라스크에 완전 배지 3 ㎖을 추가하고 인큐베이터로 복귀 O / N (37 ᵒC, 5 % CO 2). 2.2 절에 설명에 따라 대사 실험 그룹을 처리합니다. 섹션 4의 설명에 따라 설정 CAM 실험을 처리합니다. </li></ol></li></ol> 2. 바이오 센서 칩 준비 및 셀 시드 <ol><li> 무균 환경에서 조심스럽게 PBS 400 ㎕의 여섯 바이오 센서 칩을 씻는다. 20 분 동안 70 % 에탄올 400 μL와 칩 멸균. PBS의 400 μL로 3 회 세척 할 것. <ol><li> 무균 조직이 배양 내부의 칩을 배치전자 요리 오염을 방지합니다. &#39;제어&#39;라고 표시된 접시에 세 개의 칩을 놓고 &#39;관심의 대상&#39;이라는 레이블이 붙은 접시에 세. </li></ol></li><li> &#39;제어&#39;와 &#39;관심의 대상&#39;으로 두 개의 50 ㎖ 튜브 레이블. PBS로 세포를 씻으 0.25 % 트립신 / EDTA의 적절한 볼륨을 추가합니다. 단일 층 분리 될 때까지 기다린 후 각 플라스크에서 세포를 수집합니다. 적절한 튜브에 용액을 증착. <ol><li> 세포를 세어 6.0x10 최종 농도가 105 세포 / ㎖가되도록 양을 조정한다. 초기 농도가 너무 낮 으면 원심 분리하고 세포를 재현 탁. </li></ol></li><li> (칩당 1.25x10 5 세포의 총) 해당 그룹의 각 바이오 센서 칩에 셀 용액 250 μL를 추가한다. 칩 혼란의 위험을 최소화하기 위해 한 번에 하나의 그룹이 태스크를 수행한다. 증발을 방지하기 위하여 습도 챔버 내부의 칩을 함유하는 멸균 접시를 놓은 습도 차를 배치mber 인큐베이터에서 O / N (37 ᵒC, 5 % CO 2). </li><li> 이튿날 아침 (주 1)은, 각 칩으로부터 신중 매체 대기음 0.2 % 소 태아 혈청 (FBS) 및 1X 페니실린 및 스트렙토 마이신 (P / S)이 보충 된 성장 배지 250 μL로 대체. 4 시간 (37 ᵒC, 5 % CO 2)에 대해 품어. </li></ol> 3. 대사 측정 시스템 준비 및 솔루션 준비 <ol><li> 배양 중에 필요한 약액과 다가오는 대사 분석 용 측정 시스템을 준비한다. 참고 : 대사 측정 시스템은 여섯 모듈의 총이 포함되어 있습니다. 각 모듈은 실험 당 하나의 칩을 수용한다. <ol><li> 다음 실험 그룹으로 분석 세분 : 하나의 칩을 &#39;제어&#39;와 분석의 기간 동안 차량을받을 수있는 그룹 &#39;관심의 대상&#39;에서 각각; 각 그룹은 두 개의 칩 중 소정의 기간에 대한 약물 치료를받을ssay, 세척 기간 동안 차량 하였다. </li><li> 감작 약물 연구의 경우, 해당 특정 약물에 맞는 약물 치료의 길이, 타이밍 및 농도를 변경. 주 : 시스플라틴의 경우, 다음 단계는 A549 세포와 경험적으로 결정하고, 세포주에 따라 달라질 수있다. 4 μL / 분의 기본 유량을 갖는 모든 단계를 수행한다. 성장 배지 + 0.2 % FBS, 1X 및 P / S 6 HR 매체에서 6 μM 시스플라틴의 24 시간 + 0.2 % FBS 1 배 P / S 성장 배지 + 0.2 % FBS, 1X 및 P / S에 24 시간 성장 배지 + 0.2 % FBS, 1X 및 P / S (18)의 HR 0.1 % 트리톤 X의 4 시간 참고 :이 단계로부터의 편차 원하는 유량과 실험의 지속 기간에 기초하여 중간 및 약물 용액의 필요한 양을 결정하기 위해 계산을 필요로 할 것이다. 다음 섹션은 위에서 설명 된 단계를 기준으로합니다. </li></ol></li><li> 라벨 및 성장 배지 + 0.2 % FBS를 50 ml의 열네 50 ㎖ 튜브를 채우기D 1 배 P / S. 한 대사 측정 시스템 튜브 랙에 여섯, 다른 여섯, 또한 시스플라틴과 튜브가 들어 세 번째 튜브 랙의 나머지 두 놓습니다. 증발을 방지하기 위하여 공기 투과성 막을 처음 두 실 랙. </li><li> 1 배 P / S 중간 + 0.2 % FBS에서 (해당 볼륨의) 6 μM 시스플라틴의 솔루션을 준비합니다. 네 표지 50 ㎖ 튜브에 시스플라틴 용액의 필요한 양을 분배. <ol><li> 세 번째 대사 측정 튜브 랙에 남아있는 4 개의 슬롯에 튜브를 놓습니다. 튜브가 원하는 biomodules에 해당하는 해당 슬롯에 배치되어 있는지 확인합니다. 공기 투과 막으로 튜브를 밀봉합니다. </li></ol></li><li> 준비하고 여섯 50 ㎖ 튜브에 라벨을 20 ml의 배지에서 0.1 % 트리톤-X 솔루션의 각각을 입력합니다. 트리톤-X 솔루션은 남아있는 세포를 용해하고 각각의 칩에 대한 &#39;제로&#39;가치를 제공 할 것입니다. 네 번째 대사 측정 단위 튜브 랙에 튜브를 삽입하고 재치 밀봉H 과도한 증발을 방지하기 위해 공기 permable 막. </li><li> biomodules에 칩을 넣고 실험을 시작합니다. </li></ol> 4. CAM 실험 약물 치료와 주사 참고 : CAM 실험을위한 닭 배아를 준비하는 단계와 절차는 다른 19 설명되어 있습니다 <ol><li> CAM 실험 48 시간 후 - 형질 전환 (2 일)을 처리하기 시작합니다. 두 차량 플라스크 및 시스플라틴 두에 &#39;제어&#39;와 그룹 &#39;관심의 대상&#39;을 하위 나눕니다. 플라스크에서 매체를 대기음 3 신선한 매체의 ml의, 또는 6 μM 시스플라틴 (cisplatin) 중 하나와 함께 보충. 6 시간 (37 ᵒC, 5 % CO 2)에 대해 품어. </li><li> 세척 한 후, 매체를 대기음 세포를를 Trypsinize; 네 적절하게 레이블 15 ml의 튜브에 용액에 트립신 세포를 수집합니다. <ol><li> 원심 분리기와 PBS로 세포를 세 번 씻는다. PBS 5ml에 세포 펠렛을 다시 일시세포를 카운트 좋아. </li><li> 최종 세포 농도가 1.0 × 6 세포 / ml가되도록 양을 조정한다. 주입 표지 5 ml의 튜브에 세포 솔루션을 전송하고 얼음에 배치합니다. 세포가 잘 혼합되도록 조심스럽게 주입 전에 튜브를 전환. </li></ol></li><li> 주사 (9 일 이전) (24) 닭의 배아 (그룹 당 6)의 총을 옆으로 설정합니다. 1 ml의 시린지에 연결된가요 성 튜브에 부착 된 유리를 사용하여 바늘 주사를 수행한다. 주입을 수행하는 개별 처리 그룹 멀게한다. <ol><li> 스테레오 현미경을 이용하여, CAM의 정맥 순환에 1.0 × 100 μL 부피의 5 세포를 주입. 세포의 전체 볼륨을 주입하는 속도가 느린, 맥동 기술을 사용합니다. 부드러운 혈액의 흐름을 줄기 및 유출을 흡수 닦아 부드럽게 주사 부위를 가볍게 두 드리십시오. 적절하게 각 주입 다음 각 배아 컨테이너 레이블. </li></ol></li><li> 존재와 DISTRI 확인CAM의 혈관 세포의 형광 bution는 형광 현미경을 사용하여 가시화하여 주 사후. 종양 세포의 수가 적을 나타나거나 유통이 좋지있는 모든 배아에주의하십시오. </li><li> 습도 챔버에서 닭 배아를 놓고 인큐베이터 (37 ° C, 습도 60 %)에 저장합니다. 전이성 초점을 열거하기 전에 7~9일 기다립니다. </li></ol> 5. 전이성 초점 열거 <ol><li> 7~9일 배양 기간 동안 배아를 모니터링하고 죽은 사람을 버린다. 습도 챔버는 배양 기간 동안 항상 습기가 남아 있는지 확인합니다. </li><li> 20X 배율 스테레오 형광 현미경을 이용하여, 정규, 격자 형상의 패턴으로 배아 CAM의 전체 상부 표면을 스캔. </li><li> 다음 배아 당 최종 총 수를 집계, 뷰의 각 필드에 전이 병소의 수를 계산합니다. 각 그룹의 여섯 배아 이렇게하면 평균 O를 제공 할 것입니다치료 당 F 전이성 초점. </li></ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

저자가 공개하는 게 없다.

때문에 임상 시험과 관련된 고유의 비용과 위험에, 더 적절하게 신규 항암 치료법을 평가하기위한 예비 임상 시험 방법론보다 엄격한 개발이 요구된다. 현재 일반적으로 사용되는 기술 덜 효과​​적 일 수있다 모든 전시 잠재적으로 유망한 치료 대상 / 에이전트를 구별하는 능력을 제한 할 수 있습니다 약점, 그리고 그. 우리는 기존 방식의 많은 단점을 해결 새로운 항암 접근법을 평가하는 프로...

세포 독성 암 치료는 치료 실패, 재발로 이어질 수있는 중요한 임상 적 문제가 대상 및 / 또는에 대한 내성을 획득하고, 환자 사망률 1 증가했다. 대부분의 종양에서 이질성의 높은 수준을 고려할 때, 충분히 높은 세포 수의 종양은 그 세포가 생존 2,3- 대해 의존하는 분자 경로를 표적으로 단일 또는 조합 요법에 내성 세포의 서브 세트를 포함 할 것이다 수학적 확실성이다. 종양 세포에 긍정적 재발 선도, 치료 기간 동안 선택 될 수있다. 동시에 전 또는 치료 매개 선택 이후에, 다른 암 세포 생존 메카니즘을 대상 신규 치료법의 개발은, 따라서 임상 적으로 중요한 것이다. 종양에서 게놈의 불안정성 게놈 돌연변이의 높은 수준의 비 종양 (4) 숙주 세포로부터 암세포를 구별 기본적인 특징이다. 따라서, usefu- DNA 손상 화학 요법의 효능을 증가시키는 저항의 발생을 예방하기 위해 L 전략 적극적 종양 세포 5 DNA 복구를 억제하는 것이다. 이것은 예비 임상 탐구되고 조사 및 신규 DNA 복구 다양한 대상의 활성 필드이다. 이들 소분자 또는 안티센스 표적 계 억제제의 수는 개발되어 6-8 테스트 겪고있다. 목적은 임상 시험에서 안전성과 효능을 가장 유망한 전임상 후보를 식별하고 평가하는 것입니다. 임상 시험의 고비용 (차선 전임상 평가를 포함한 여러 이유로) 실패의 위험이 새로운 치료법의 개발에 9 진행 강력한 장애물이다. 적절히 치료 대상 및 새로운 약물 후보를 평가할 수있는 적절하고 엄격한 전임상 모델의 사용은 임상 시험 (10)의 높은 실패율을 감소시킬 수있다 </suP&gt;. 시험 관내 (세포 증식 분석법) 종양 세포의 능력에있어서, b) 치료 - 유도 환원에서 종양 세포의 증식을 감소시키는 능력) 측정 : 일부 공통적으로 사용 전임상 방법은 신규 한 항암 요법의 효과이다을 평가 폼 조직 배양 콜로니 (콜로니 형성 어 세이) 시험 관내 (레 독스 염료 변환) 시험 관내 종양 세포 사멸, d) 요법 - 유도 유도 (세포 사멸, 괴사가 포식이 연관된 종양 세포 대사 활동에있어서, c) 요법 - 유도 환원 생체 내에서 유사 분열 등) (11), 전자)와 함께 인간과 마우스 이종 이식 12-14의 성장 또는 절제의 감소를 치료 유도. 체외 나열된 방법 중 가장 큰 문제점은 이들 중 어느 것도 후보 치료제의 효과를 실시간 평가를 제공하지 않는다는 것이다. 오히려, 그들은 단지 선택된 넓게 분리 된 시점에서 정보를 제공 할치료 과정 동안. 이러한 측정은 정확하게 종양 세포 반응의 강도 및 타이밍을 반영하는 능력을 감소 하였다. 생체 내 마우스 이종 이식 모델은 또한 높은 비용, 완료하는 시간의 길이, 차선 투여 및 치료시기 (스케줄링)의 위험에 의해 제한된다. 또한, 설치류 이종 이식 모델 차 인간 종양 세포의 반응을 시험 관내 평가와 비교하여 인간에서의 임상 효능 한정 예측 및 후보 치료 개입 (15, 16)에 확립 된 인간 종양 세포주가 있다는 증거가있다. 우리는 위에서 설명한보다 일반적인 절차의 단점을 해결하는 방식으로, 예비 임상 신약 조합을 평가하기 위하여 새로운 조합 프로토콜을 고안했다. 증식, 콜로니 형성 또는 산화 환원 염료 변환 분석 대신에, 우리는 실시간으로 세포 부착, 호흡, 산성화를 분석 대사 측정 유닛을 이용전체 치료 기간 동안 17. 동시에, 우리는 닭 배아 침윤 및 전이의 융모 18,19 막 (CAM) 모델을 사용하여 생체 내에서 조합 치료의 효과를 조사 하였다. 우리는 일반적으로 사용되는 화학 요법 약물 시스플라틴의 효과를 강화시키는 데 BRCA2 타겟팅 안티센스 올리고 뉴클레오티드 (ASO)의 능력을 평가하기 위해 다음 방법을 사용 하였다.

<table border="0" cellpadding="0" cellspacing="0" >
	<tbody>
		<tr >
			<td >Name of Material/ Equipment</td>
			<td >Company</td>
			<td >Catalog Number</td>
			<td >Comments/Description</td>
		</tr>
		<tr >
			<td >A549 cells</td>
			<td >ATCC</td>
			<td >CCL-185</td>
			<td>http://www.atcc.org/products/all/CCL-185.aspx</td>
		</tr>
		<tr >
			<td >AeraSeal film&#160;</td>
			<td >Carl Roth GmbH</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >AMEM</td>
			<td >Wisent Bioproducts</td>
			<td >210-011-QK</td>
			<td></td>
		</tr>
		<tr >
			<td >Antisense oligodeoxynucleotides</td>
			<td >Avecia</td>
			<td ></td>
			<td>BRCA2 target sequence: 5&#39; - UAAGGAACGUCAAGAGAUAC - 3&#39; (bases 7241-7259 )</td>
		</tr>
		<tr >
			<td >Axio Zoom V16 Microscope</td>
			<td >Carl Zeiss</td>
			<td ></td>
			<td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td>
		</tr>
		<tr >
			<td >Bionas Biosensor Chips</td>
			<td >Bionas GmbH and Micronas GmbH</td>
			<td >BIS8001D</td>
			<td></td>
		</tr>
		<tr >
			<td >Bionas Discovery 2500 System&#160;</td>
			<td >Bionas GmbH</td>
			<td ></td>
			<td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td>
		</tr>
		<tr >
			<td >Cisplatin</td>
			<td >Sigma Aldrich</td>
			<td >479306</td>
			<td></td>
		</tr>
		<tr >
			<td >Fertilized chicken eggs</td>
			<td >Sourced locally</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Fetal bovine serum&#160;</td>
			<td >Gibco - Life Technologies</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Lipofectamine 2000&#160;</td>
			<td >Invitrogen - Life Technologies&#160;</td>
			<td >12566014</td>
			<td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td>
		</tr>
		<tr >
			<td >PBS</td>
			<td >Wisent Bioproducts</td>
			<td >311-010-CL</td>
			<td></td>
		</tr>
		<tr >
			<td >Trypsin (0.25%)/EDTA</td>
			<td >Wisent Bioproducts</td>
			<td >325-043-CL</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

이질성 때문에 동일한 경로를 대상으로 인간의 암 치료 단독 투여 또는 조합 요법에 내재 돌연변이 하이 레벨로, 실패 할 가능성이있다. 중점 치료에 고유 및 / 또는 적응 저항에 대한 책임이 있습니다 경로의 억제에 배치해야합니다. 조사의 활성 필드는 일반적으로 개발 및 화학 요법과 방사선 요법을 사용의 작용을 촉진하고, 내성을 방지 DNA 수리 억제제의 시험이다. 우리는 DNA 손상 약물 시스플라틴에 종양 세포를 감작하는 수단으로 BRCA2 억제의 효과를 평가하기 위해 신규 한 프로토콜을 사용했다. 종양 세포 대사 (호흡 산성화)는 분 단위로 분에 치료 효과를 묘사하기 위해 72 시간 동안 실시간으로 모니터링 하였다. 조합에서, 우리는 닭 배아 융모 막 (CAM) 혈관 외 유출과 침략의 모델을 이용하여 전이 주파수의 평가를 수행 하였다. 이프로토콜은 새로운 암 치료 요법을 평가하기 위해 생체 외 및 생체 방법에 사용되는 일반적으로의 약점 중 일부를 해결합니다. 이는 이러한 세포 증식 분석, 세포 사멸 분석과 같은 일반적인 방법에 더하여 사용될 수 있으며, 생체 내 뮤린 이종 이식 연구에서 더욱 밀접 후보 타겟 및 에이전트들 사이를 구별하고, 또한 개발을위한 가장 유망한 후보를 선택한다.

결과 및 수치는 출판 일 (22)의 허가 적응. BRCA2 억제 시스플라틴 처리 된 종양 세포 호흡의 감소를 유도 ASO를 BRCA2가 타겟팅 및 시스플라틴 단독 제어 ASO 시스플라틴을받은 세포에 비해 호흡에서 이른 감소 및 비가역을 나타내 처리 인간 A549 폐암 세포; 처리 된 세포를 시스플라틴 치료 24 시간 BRCA2 ASO 제어 ASO 호흡 사이의 차이 후 39 % (...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

암 약물 과민 반응의 효과를 평가<em&gt; 체외</em&gt; 및<em&gt; 생체</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

8.2K 조회수.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

비디오: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent until many years after removal of the primary tumor and adjuvant therapy. A likely explanation of this phenomenon is that tumor cells have seeded metastatic sites, are resistant to conventional therapies, and remain dormant for long periods of time 1-4.
The existence of dormant cancer cells at secondary sites has been described previously as quiescent solitary cells that neither proliferate nor undergo apoptosis 5-7. Moreover, these solitary cells has been shown to disseminate from the primary tumor at an early stage of disease progression 8-10 and reside growth-arrested in the patients' bone marrow, blood and lymph nodes 1,4,11. Therefore, understanding mechanisms that regulate dormancy or the switch to a proliferative state is critical for discovering novel targets and interventions to prevent disease recurrence. However, unraveling the mechanisms regulating the switch from tumor dormancy to metastatic growth has been hampered by the lack of available model systems.
in vivo and ex vivo model systems to study metastatic progression of tumor cells have been described previously 1,12-14. However these model systems have not provided in real time and in a high throughput manner mechanistic insights into what triggers the emergence of solitary dormant tumor cells to proliferate as metastatic disease. We have recently developed a 3D in vitro system to model the in vivo growth characteristics of cells that exhibit either dormant (D2.OR, MCF7, K7M2-AS.46) or proliferative (D2A1, MDA-MB-231, K7M2) metastatic behavior in vivo . We demonstrated that tumor cells that exhibit dormancy in vivo at a metastatic site remain quiescent when cultured in a 3-dimension (3D) basement membrane extract (BME), whereas cells highly metastatic in vivo readily proliferate in 3D culture after variable, but relatively short periods of quiescence. Importantly by utilizing the 3D in vitro model system we demonstrated for the first time that the ECM composition plays an important role in regulating whether dormant tumor cells will switch to a proliferative state and have confirmed this in in vivo studies15-17. Hence, the model system described in this report provides an in vitro method to model tumor dormancy and study the transition to proliferative growth induced by the microenvironment.

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

A modified 3-D in vitro system is presented in which growth characteristics of several tumor cell lines in reconstituted basement membrane correlate with the dormant or proliferative behavior of the tumor cells at a metastatic secondary site in vivo.

체외에서</em전이성 종양 성장에 휴면하고 스위치를 연구하기> 시스템

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent ...

연구

의학

Multi-modal Imaging of Angiogenesis in a Nude Rat Model of Breast Cancer Bone Metastasis Using Magnetic Resonance Imaging, Volumetric Computed Tomography and Ultrasound

Angiogenesis is an essential feature of cancer growth and metastasis formation. In bone metastasis, angiogenic factors are pivotal for tumor cell proliferation in the bone marrow cavity as well as for interaction of tumor and bone cells resulting in local bone destruction. Our aim was to develop a model of experimental bone metastasis that allows in vivo assessment of angiogenesis in skeletal lesions using non-invasive imaging techniques.
For this purpose, we injected 105 MDA-MB-231 human breast cancer cells into the superficial epigastric artery, which precludes the growth of metastases in body areas other than the respective hind leg1. Following 25-30 days after tumor cell inoculation, site-specific bone metastases develop, restricted to the distal femur, proximal tibia and proximal fibula1. Morphological and functional aspects of angiogenesis can be investigated longitudinally in bone metastases using magnetic resonance imaging (MRI), volumetric computed tomography (VCT) and ultrasound (US).
MRI displays morphologic information on the soft tissue part of bone metastases that is initially confined to the bone marrow cavity and subsequently exceeds cortical bone while progressing. Using dynamic contrast-enhanced MRI (DCE-MRI) functional data including regional blood volume, perfusion and vessel permeability can be obtained and quantified2-4. Bone destruction is captured in high resolution using morphological VCT imaging. Complementary to MRI findings, osteolytic lesions can be located adjacent to sites of intramedullary tumor growth. After contrast agent application, VCT angiography reveals the macrovessel architecture in bone metastases in high resolution, and DCE-VCT enables insight in the microcirculation of these lesions5,6. US is applicable to assess morphological and functional features from skeletal lesions due to local osteolysis of cortical bone. Using B-mode and Doppler techniques, structure and perfusion of the soft tissue metastases can be evaluated, respectively. DCE-US allows for real-time imaging of vascularization in bone metastases after injection of microbubbles7.
In conclusion, in a model of site-specific breast cancer bone metastases multi-modal imaging techniques including MRI, VCT and US offer complementary information on morphology and functional parameters of angiogenesis in these skeletal lesions.

In the pathogenesis of bone metastasis, angiogenesis is a crucial process and therefore represents a target for imaging and therapy. Here, we present a rat model of site-specific breast cancer bone metastasis and describe strategies to non-invasively image angiogenesis in vivo using magnetic resonance imaging, volumetric computed tomography and ultrasound.

자기 공명 영상, 체적 계산의 Tomography 및 초음파를 이용한 유방암의 뼈 전이의 누드 쥐 모델에서 Angiogenesis의 멀티 모달 이미징

Angiogenesis is an essential feature of cancer growth and metastasis formation. In bone metastasis, angiogenic factors are pivotal for tumor cell ...

Live Imaging of Drug Responses in the Tumor Microenvironment in Mouse Models of Breast Cancer

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional co-culture systems are frequently used to explicate tumor-stroma interactions, including their role in drug responses. However, many of the interactions that occur in vivo in the intact microenvironment cannot be completely replicated in these in vitro settings. Thus, direct visualization of these processes in real-time has become an important tool in understanding tumor responses to therapies and identifying the interactions between cancer cells and the stroma that can influence these responses. Here we provide a method for using spinning disk confocal microscopy of live, anesthetized mice to directly observe drug distribution, cancer cell responses and changes in tumor-stroma interactions following administration of systemic therapy in breast cancer models. We describe procedures for labeling different tumor components, treatment of animals for observing therapeutic responses, and the surgical procedure for exposing tumor tissues for imaging up to 40 hours. The results obtained from this protocol are time-lapse movies, in which such processes as drug infiltration, cancer cell death and stromal cell migration can be evaluated using image analysis software.

We describe a method for imaging response to anti-cancer treatment in vivo and at single cell resolution.

유방암의 마우스 모델에서 종양 Microenvironment에 약물 응답의 영상을 라​​이브

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional ...

Slow-release Drug Delivery through Elvax 40W to the Rat Retina: Implications for the Treatment of Chronic Conditions

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these diseases. Chronic retinal diseases such as retinal oedema or neovascularization usually require multiple intraocular injections to effectively treat the condition. However, the risks associated with these injections increase with repeated delivery of the drug. Therefore, alternative delivery methods need to be established in order to minimize the risks of reinjection. Several other investigations have developed methods to deliver drugs over extended time, through materials capable of releasing chemicals slowly into the eye. In this investigation, we outline the use of Elvax 40W, a copolymer resin, to act as a vehicle for drug delivery to the adult rat retina. The resin is made and loaded with the drug. The drug-resin complex is then implanted into the vitreous cavity, where it will slowly release the drug over time. This method was tested using 2-amino-4-phosphonobutyrate (APB), a glutamate analogue that blocks the light response of the retina. It was demonstrated that the APB was slowly released from the resin, and was able to block the retinal response by 7 days after implantation. This indicates that slow-release drug delivery using this copolymer resin is effective for treating the retina, and could be used therapeutically with further testing.

This paper details how Elvax 40W can be used as a slow-release method for drug delivery to the adult rat retina. The protocol for preparing, loading, and delivering the drug-resin complex to the eye is described.

쥐의 망막에 Elvax 40W를 통해 서방 약물 전달 : 만성 질환의 치료를위한 시사점

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these ...

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study model. As the use of mouse models are often a vital step in preclinical drug discovery and drug development1-8, it is necessary to design a system to introduce drugs into mice in a uniform, reproducible manner. Ideally, the system should permit the collection of blood samples at regular intervals over a set time course. The ability to measure drug concentrations by mass-spectrometry, has allowed investigators to follow the changes in plasma drug levels over time in individual mice1, 9, 10. In this study, paclitaxel was introduced into transgenic mice as a continuous arterial infusion over three hours, while blood samples were simultaneously taken by retro-orbital bleeds at set time points. Carotid artery infusions are a potential alternative to jugular vein infusions, when factors such as mammary tumors or other obstructions make jugular infusions impractical. Using this technique, paclitaxel concentrations in plasma and tissue achieved similar levels as compared to jugular infusion. In this tutorial, we will demonstrate how to successfully catheterize the carotid artery by preparing an optimized catheter for the individual mouse model, then show how to insert and secure the catheter into the mouse carotid artery, thread the end of the catheter out through the back of the mouse&#8217;s neck, and hook the mouse to a pump to deliver a controlled rate of drug influx. Multiple low volume retro-orbital bleeds allow for analysis of plasma drug concentrations over time.

This method was developed with the goal of delivering a steady drug solution via the carotid artery, to assess the pharmacokinetics of novel drugs in mouse models.

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study ...

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of women are alive 5 years after diagnosis. The omentum is a preferred site of HGSC metastasis formation. Despite the clinical importance of this microenvironment, the contribution of omental adipose tissue to ovarian cancer progression remains understudied. Omental adipose is unusual in that it contains structures known as milky spots, which are comprised of B, T, and NK cells, macrophages, and progenitor cells surrounding dense nests of vasculature. Milky spots play a key role in the physiologic functions of the omentum, which are required for peritoneal homeostasis. We have shown that milky spots also promote ovarian cancer metastatic colonization of peritoneal adipose, a key step in the development of peritoneal metastases. Here we describe the approaches we developed to evaluate and quantify milky spots in peritoneal adipose and study their functional contribution to ovarian cancer cell metastatic colonization of omental tissues both in vivo and ex vivo. These approaches are generalizable to additional mouse models and cell lines, thus enabling the study of ovarian cancer metastasis formation from initial localization of cells to milky spot structures to the development of widespread peritoneal metastases.

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

We outline a protocol that implements both in vivo and ex vivo approaches to study ovarian cancer colonization of peritoneal adipose tissues, particularly the omentum. Furthermore, we present a protocol to quantitate and analyze immune cell-structures in the omentum known as milky spots, which promote metastases of peritoneal adipose.

생체 내 및 생체 외 복막 지방이에 밀키 스팟 구조의 난소 암 전이성 식민지를 연구하는 접근 방식

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

췌장암 새로운 치료 전략을 개발하기위한 전지 특성 줄기 공부

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Depletion of Mouse Cells from Human Tumor Xenografts Significantly Improves Downstream Analysis of Target Cells

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic patient tumors in different assays1. Human tumor xenografts represent the gold standard with respect to tumor biology, drug discovery, and metastasis research 2-4. Tumor xenografts can be derived from different types of material like tumor cell lines, tumor tissue from primary patient tumors4 or serially transplanted tumors. When propagated in vivo, xenografted tissue is infiltrated and vascularized by cells of mouse origin. Multiple factors such as the tumor entity, the origin of xenografted material, growth rate and region of transplantation influence the composition and the amount of mouse cells present in tumor xenografts. However, even when these factors are kept constant, the degree of mouse cell contamination is highly variable.
Contaminating mouse cells significantly impair downstream analyses of human tumor xenografts. As mouse fibroblasts show high plating efficacies and proliferation rates, they tend to overgrow cultures of human tumor cells, especially slowly proliferating subpopulations. Mouse cell derived DNA, mRNA, and protein components can bias downstream gene expression analysis, next-generation sequencing, as well as proteome analysis 5. To overcome these limitations, we have developed a fast and easy method to isolate untouched human tumor cells from xenografted tumor tissue. This procedure is based on the comprehensive depletion of cells of mouse origin by combining automated tissue dissociation with the benchtop tissue dissociator and magnetic cell sorting. Here, we demonstrate that human target cells can be can be obtained with purities higher than 96% within less than 20 min independent of the tumor type.

Human tumor xenografts are vascularized and infiltrated by cells of mouse origin during the growth phase in vivo. To circumvent the bias caused by these contaminating cells during downstream analysis, we developed a method allowing for comprehensive depletion of all mouse cells by magnetic cell sorting.

인간 종양 이종 이식에서 마우스 세포의 고갈은 크게 대상 세포의 다운 스트림 분석을 향상

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic study in the liver. Here, numerous assays are described to comprehensively measure the phenotype and parameters of hepatic steatosis in mouse and hepatocyte models. 
Combining the physiological, histological, and biochemical methods, this system can be used to assess the progress of hepatic steatosis. In vivo, the measurements of body weight and nuclear magnetic resonance (NMR) provide a general understanding of mice in a non-invasive manner. Hematoxylin and Eosin (H&amp;E) and Oil Red O staining determine the histological morphology and lipid deposition of liver tissue under nutrient overload conditions, such as high-fat diet feeding. Next, the total lipid contents are isolated by chloroform/methanol extraction, which are followed by a biochemical analysis for triglyceride and cholesterol. Moreover, mouse primary hepatocytes are treated with high glucose plus insulin to stimulate lipid accumulation, an efficient in vitro model to mimic diet-induced hyperglycemia and hyperinsulinemia in vivo. Then, the lipid deposition is measured by Oil Red O staining and chloroform/methanol extraction. Oil Red O staining determines intuitive hepatic steatotic phenotypes, while the lipid extraction analysis determines the parameters that can be analyzed statistically. The present protocols are of interest to scientists in the fields of fatty liver diseases, insulin resistance, and type 2 diabetes.

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Here, optimized methods to generate in vivo and in vitro models of hepatic steatosis and to analyze the steatotic phenotypes and related physiological parameters are described.

의 최적화 분석<em&gt; 생체</em&gt; 및<em&gt; 체외</em&gt; 간 지방증

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

암 약물 과민 반응의 효과를 평가

요약

더 많은 비디오 탐색

이 비디오의 챕터

체외에서 시스템

자기 공명 영상, 체적 계산의 Tomography 및 초음파를 이용한 유방암의 뼈 전이의 누드 쥐 모델에서 Angiogenesis의 멀티 모달 이미징

유방암의 마우스 모델에서 종양 Microenvironment에 약물 응답의 영상을 라이브

쥐의 망막에 Elvax 40W를 통해 서방 약물 전달 : 만성 질환의 치료를위한 시사점

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

생체 내 및 생체 외 복막 지방이에 밀키 스팟 구조의 난소 암 전이성 식민지를 연구하는 접근 방식

췌장암 새로운 치료 전략을 개발하기위한 전지 특성 줄기 공부

인간 종양 이종 이식에서 마우스 세포의 고갈은 크게 대상 세포의 다운 스트림 분석을 향상

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

의 최적화 분석

암 약물 과민 반응의 효과를 평가

요약

더 많은 비디오 탐색

이 비디오의 챕터

체외에서 시스템

자기 공명 영상, 체적 계산의 Tomography 및 초음파를 이용한 유방암의 뼈 전이의 누드 쥐 모델에서 Angiogenesis의 멀티 모달 이미징

유방암의 마우스 모델에서 종양 Microenvironment에 약물 응답의 영상을 라​​이브

쥐의 망막에 Elvax 40W를 통해 서방 약물 전달 : 만성 질환의 치료를위한 시사점

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

생체 내 및 생체 외 복막 지방이에 밀키 스팟 구조의 난소 암 전이성 식민지를 연구하는 접근 방식

췌장암 새로운 치료 전략을 개발하기위한 전지 특성 줄기 공부

인간 종양 이종 이식에서 마우스 세포의 고갈은 크게 대상 세포의 다운 스트림 분석을 향상

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

의 최적화 분석

유방암의 마우스 모델에서 종양 Microenvironment에 약물 응답의 영상을 라이브