이 작품은 헬렌 Bateup에 뇌 연구 재단의 씨 그랜트 (BRFSG-2014-02)에 의해 지원되었다. 더크 Hockemeyer는 엘리슨 의료 재단의 노화에 새 학자와 글렌 재단뿐만 아니라 Shurl와 케이 쿠 르치 재단이 지원됩니다. DH는 NIH 보조금 1R01CA196884-01에 의해 지원됩니다.

이 논문에서 설명하는 절차를 검토하고 UC 버클리 줄기 세포 연구 감독위원회에 의해 승인되었다. 1. 편집을 위해 줄기 세포를 준비 <ol><li> 성장과 마이 토마 이신 C-불 활성화 마우스 배아 섬유 아세포의 2.4 × 10 6 세포 / 플레이트를 포함하는 6 웰 플레이트에 문화 인간 만능 줄기 세포 (hPSCs) (MEF) 피더는 젤라틴 (32)에 성장. 웰 (hESC의 매체) 당 인간 배아 줄기 세포의 배지 3 ㎖에 hPSCs을 유지하고 성장 37 3 %, O2 / 5 % CO 2 ° C 배양기. 주 :이 프로토콜의 성공을 위해,이 저산소 배양기에서 hPSCs을 유지할 필요가 없다; 그러나 이는 시간 및 세포 수를 적절히 조절해야하므로 hPSCs가 높은 O 2 환경에서 빠르게 증식하는 것을 주목하는 것이 중요하다. 또한 저산소 유지 hPSCs 자발적인 분화 (33)의 더 낮은 비율을 주목해야한다. <ol><li> 티O 500 ml의 hESC의 미디어를 380 ml의 DMEM / F12, 75 ml의 태아 소 혈청 (FBS)를 결합 할, 25 ml의 마네 세럼 교체 (KSR). 글루타민 (1 mM의 최종 농도), 5 ml의 100 배 비 필수 아미노산, 100 단위 / ml의 페니실린 - 스트렙토 마이신 (P / S), 염기성 섬유 아세포 성장 인자 (bFGF를) (4 NG / ml의 최종 농도)와 2- 추가 머 캅토 에탄올 (5.5 μm의 최종 농도). </li></ol></li><li> 미디어 (3 ㎖)의 전체 볼륨을 제거 유리 피펫과 진공을 사용하여 미디어를 변경합니다. 3 ㎖ 따뜻한 hESC의 미디어 혈청 학적 피펫을 사용하여 교체하십시오. hPSCs 약 50 %의 합류 (주 1)가 될 때까지 반복 매체는 매일 변경됩니다. </li><li> 어느 날 (주 1) 대상으로하기 전에, 기존의 미디어를 제거하고 10 μm의 Y-27632 보충 따뜻한 hESC의 미디어를 추가, hESC의 미디어를 변경합니다. </li><li> 또한 일 -1에, DR4 마우스 (2.4 × 10 6 세포 / 판) (34)로부터 약제 내성 MEF 피더 세포의 두 6 자 또는 10cm 플레이트를 준비합니다. 참고 : 일반적으로, 6 웰 플레이트는 광고입니다것이 유리 10 CM 플레이트, 그들은 더 많은 미디어를 수용 할 수있다. 6 웰 플레이트는 다른 우물에서 서로 다른 클론이 독립적 확인합니다. 그러나, 10cm 플레이트는이 과정에 사용할 수있는 현미경에 따라 쉽게 따기 수 있습니다. </li></ol> 2. 편집 만능 줄기 세포 <ol><li> 1.5 ㎖의 튜브에 CRISPR / Cas9 px330 인코딩하는 플라스미드 (도 1)의 ZFN 1 및 2, 1 및 2 TALEN, 또는 15 μg의 5 μg의 각각의 피펫 팅함으로써 형질 감염 용액을 준비한다. 피펫 (30)도이 튜브에 수리 플라스미드의 μg의. 마지막으로, 튜브에 피펫 1X 인산염 완충 식염수 (PBS)를 300 μL에 볼륨을 불러옵니다. 주 : 300 μL 하에서 형질 용액의 총 부피를 유지하기 위해 300 NG / μL의 최소 농도 (임의의 적합한 키트) midiprep으로 플라스미드를 준비한다. 이 플라스미드를 선형화하기 위해, 또는 endoto를 사용하여, 페놀 / 클로로포름 추출을 수행 할 필요가 없다티베트 무료 플라스미드 준비 키트. </li><li> 유리 피펫과 진공을 사용 hPSCs에서 용지를 제거합니다. 각 웰에 피펫 2 ml의 따뜻한 1X PBS는 세포를 씻어. </li><li> 바로 유리 피펫과 진공을 사용하여 PBS를 제거합니다. 각 웰의 세포에 직접 0.5 ml의 0.25 % 트립신 - EDTA (에틸렌 다이아 민 테트라 초산) 솔루션을 추가합니다. 약 10 분 동안 인큐베이터 (37 ° C / 5 % CO 2 / 3 %의 O 2)에 넣습니다. 지대 층은 판을 들어 올릴 시작할 때까지. </li><li> 트립신 반응을 정지 각 웰에 2 ml의에게 따뜻한 esWash 미디어 (470 ml의 DMEM / F12, 25 ML의 FBS, 100 단위 / ㎖의 P / S)를 추가합니다. </li><li> 시트로 내려와 그 피더 세포를 확인합니다. 모든 웰을 결합 아니라 단일 50ml의 원뿔형 튜브에 각각의 내용을 피펫. 10 ㎖의 혈청 학적 피펫을 사용하여 씹다 세포. 이 세포층을 중단 할 필요가 없습니다; hPSCs 부드러운 분쇄하여 세포층의 떨어져 올 것이다. 세포 현탁액 15 ml를가한다. </li><li> volu을 가지고 관에 esWash 미디어의 25 ML을 추가나 40 ml의 총. 큰 피더 덩어리가 1-2 분 동안 튜브의 바닥에 정착하도록 허용합니다. 새로운 50 ML 원뿔 튜브에 혈청 학적 피펫과 보증금을 사용하여 관에서 뜨는 (~ 38 ㎖) 제거합니다. </li><li> 190 X g에서 5 분 동안 스핀 다운. 유리 피펫과 진공을 이용하여 튜브에서 뜨는을 제거합니다. 세포 펠렛을 방해하지해야합니다. 1X PBS 500 μL에 세포를 재현 탁. 앞서 제조 된 플라스미드 형질 감염 용액으로 결합한다. 이 단계에서 세포를 계산합니다. 전기 당 5-10000000 세포를 사용합니다. </li><li> , 4mm의 전기 큐벳에 전체 800 μL 서스펜션을 피펫 3-5 분 동안 얼음에 배치합니다. 250 V, 500 μF, ∞ 저항 및 4mm의 큐벳 크기 : 전기의 다음 매개 변수를 사용하여 시스템에 지수 프로그램을 사용하여 Electroporate 세포. 전기 한 후, 3 분 동안 다시 얼음에 큐벳을 놓습니다. 참고 : 전기 시스템의 전기의 일정한 시간을 준수하십시오. 시정세포 수와 DNA 순도에 따라 달라집니다. 나열된 조건으로 유전자 펄서 II를 사용할 때 성공적인 형질 감염은 일반적으로 10 내지 14 밀리 초 사이에 일정한 시간을 갖는다. 시정이 값에 따라 다릅니다 때 낮은 전기 효율이 발생할 수 있습니다. </li><li> 따뜻한 hESC의 미디어는 10 μm의 Y-27632 보충 18 ml의 일렉트로 세포를 재현 탁. 플레이트 (3) DR4 피더 세포를 6 웰 플레이트의 각 웰에이 단일 세포 현탁액의 용액. 인큐베이터 (37 ° C / 5 % CO 2 / 3 %의 O 2)로 돌아갑니다. </li></ol> 긍정적 인 식민지 3. 선택 <ol><li> 2 일, 유리 피펫과 진공을 사용하여 모든 용지를 제거합니다. 10 μm의 Y-27632 보충 따뜻한 hESC의 미디어 3 ㎖로 교체하십시오. 3 일, 유리 피펫과 진공을 사용하여 모든 용지를 제거합니다. Y-27632을 포함하지 않고 따뜻한 hESC의 미디어 3 ㎖로 교체하십시오. 4 일, 유리 피펫과 진공을 사용하여 모든 용지를 제거합니다. 3 ml의 selecti에 대한 항생제로 보충 따뜻한 hESC의 미디어를 교체에. 인큐베이터 (37 ° C / 5 % CO 2 / 3 %의 O 2)로 돌아갑니다. 참고 : 저항 카세트에 달려 항생제 사용의 타입 수리 템플릿에 포함. WIBR # 3 hPSCs (NIH 레지스트리 0079), 0.5 μg의 / ㎖의 퓨로 마이신, 70 μg의 / ㎖의 G418 (네티), 35 μg의 / ㎖ 하이 그로 마이신에 대해 작업 할 때 성공적으로 사용되어왔다. 선택 농도는 약 1 주일 내에 야생형 세포를 죽이는 데 필요한 항생제의 최소 농도를 구축하여 경험적으로 결정되어야한다. </li><li> 일 5-12, 항생제로 보충 따뜻한 hESC의 매체와 오래된 미디어마다 교체, 매일 미디어를 변경합니다. 주 : 세포사 다량 예상된다. 개별 식민지는 하루에 8-10 주위에 명백해질 것이다. 항생제없이 일반 hESC의 미디어는 연속 선정 12-14 일 후에 사용할 수 있습니다. 세포 밀도가 높거나 세포사가 느린 경우, 미디어의 산성화는 피해야하며 미디어 volu을 증가시킬 필요가있을 수도선택의 처음 몇 일 동안 저 (최대 4 ~ 5 ml의에). </li></ol> 4. 따기 선정 식민지 (일 12-14) <ol><li> 하루 12 ~ 14에 식민지를 관찰한다. 해부 현미경에서 선택하고 그들이 차별화하기 시작 세포를 포함하지 않도록 할 준비가 식민지를 관찰한다. 대략적인 크기는 800-1,200 μM해야한다. 식민지는 12 일 전에이 크기에 도달 할 경우, 그들은 다음 뽑힐 것이 좋습니다. 주 : 각 타겟팅 실험의 경우, 원하는 유전자형 격리되어 있도록 필요한만큼의 콜로니를 선택한다. 예를 들어, AAV-CAGGS-EGFP 수리 템플릿 AAVS1 편집은 지속적으로 강력한 통합을 보여, 만 12 ~ 24 식민지가 약 5 ~ 10 heterozygously 대상으로 클론을 얻기 위해 고른 것을 요구하고있다. 더 많은 식민지를 요구할 수있다 다른 대상으로 실험 (표 1)을 포착 할 수 있습니다. 정확한 표적화 이벤트 주파수는 SS의 효율성과 같은 요소에 따라N은 DSB, 인서트의 크기 및 선택 전략을 소개. 올바르게 적절히 표적 클론을 얻기 위해 요구되는 콜로니 수를 줄여, 목표 부위에 집적 할 때 여기에 제시된 AAVS1 궤적 유전자 트랩 방법의 경우, 선택 마커 만 표시된다. </li><li> (각 식민지가 포착을 위해 / 판 2.4 × 10 6 세포, 잘 하나가 사용됩니다) 어느 날 따기 전에 MEFs에 12 웰 플레이트를 준비합니다. </li><li> 수확의 날, 유리 피펫과 진공을 사용하여 12도 MEF 플레이트에서 모든 미디어를 제거하고 1 ml의 hESC의 매체를 교체합니다. 또한 수확의 날, 뽑힐거야 6 웰 플레이트에 hESC의 미디어를 변경합니다. </li><li> 피더 층에서 개별 식민지의 기계적 분리 용 유리 피펫을 당깁니다. 에 후드 분젠 버너를 통해 피펫을 내리고 유리 전성 때까지 확장 지점에서 부드럽게. 빠르게 화염에서 제거하고 피펫 떨어져 각 지점을 만들어냅니다. 브레이크좁은 채널을 떠나, 구부러진 축에서 약 2cm를 가리 킵니다. 1-2 초 동안 불꽃에 노출시킴으로써 채널의 끝을 연마. 참고 : 선택적으로하지만,이 문화의 clonality을 줄일 수 있습니다, 식민지에게 P20 피펫 팁을 선택, 무딘 끝이 잠재적 이후 먹이는 오염, 미디어에 각각의 식민지에서 세포의 더 많은 양을 제거 할 수있다. </li><li> P1000 필터 피펫 팁을 복용하고 좁은 끝 흡입 전구를 부착하여 장치를 따기 조립합니다. 광각 단에서 뽑아 유리 피펫을 삽입합니다. </li><li> hPSCs의 6 웰 플레이트는 조직 문화 후드에 장착 된 해부 현미경의 무대에 포착 할 수 놓습니다. 피킹 장치의 전구를 압축하고 부드럽게 미디어에 조각을 해제 않도록주의하면서, 절제와 10 ~ 20 동일한 크기의 조각으로 개별 식민지를 잘라. 전구를 해제하여 피펫으로 식민지의 절제 hPSC 조각을 가져 가라. 전송하는 동안 가능한 한 작은 매체을보십시오. </li><li> TRANSF어 12 웰 MEF 판의 하나의 잘, 지금 깨진 식민지를 발표, 직접 우물에 다시 전구를 압축에 개별 식민지. 단일 세포 유래 클론의 고유 식별 할 수 있도록 각 웰 레이블. 유리 피펫 각 시간을 변경 필요한만큼의 식민지, 반복합니다. 참고 : 따기 식민지 배울 수있는 시간이 걸릴 수 있습니다. 그것은 대상으로 식민지를 분리하기 전에 몇 가지 제어 세포에 대한 실험 연습하는 것이 좋습니다. </li><li> 부드럽게 잘 각각의 중앙에 세포의 축적을 방지하기 위해 먼저 판을 흔들, 인큐베이터 (37 ° C / 3 %, O2 / 5 % CO 2) 12 잘 접시를 돌려줍니다. </li><li> 다음날 이후의 각 날, 유리 피펫과 진공을 사용하여 미디어의 전체 볼륨을 제거하고 세포가 약 50 %의 합류 때까지 따뜻한 hESC의 미디어 1.5 ㎖로 대체 (이것은 일반적으로 10~12일 소요). </li><li> 10~12일 후, 각 웰에서 두 식민지에 하나를 선택하고 다시 새로운 12 웰 MEF 플레이트로 전송peating는 복제 플레이트를 생성하는 4.1-4.8 단계를 반복합니다. </li><li> 원래 MEF 플레이트의 각 웰에 남아있는 식민지에서 DNA를 (아래 참조)의 압축을 풉니 다. <ol><li> 유리 피펫과 진공을 사용하여 모든 우물에서 용지를 제거합니다. 잘 세포를 세척하는 각 상에 PBS 1X 피펫 1ml를. 유리 피펫과 진공을 사용하여 PBS를 제거합니다. 피펫 세포 용해 완충액 250 μL (H 2 O에 최종 농도 : 10 mM 트리스 염산, 5mM의 EDTA, 0.2 % SDS, 200 mM의 염화나트륨, 0.08 ㎎ / ㎖ 프로 테-K)를 각 웰 상. 인큐베이터에있는 장소 (37 ° C / 3 %, O2 / 5 % CO 2) O / N. </li><li> 다음 날, 피펫 각각의 내용을 잘으로 개인 1.5 ml의 튜브. 피펫 각 튜브에 이소 프로필 알콜을 250 μL DNA를 침전한다. 적극적으로 튜브를 흔들어. 흰색 침전물을 볼 수 있어야합니다. </li><li> 테이블 탑 원심 분리기에서 13,000 rpm에서 3 분 동안 각 튜브를 스핀 다운. 스핀 다운 후, 액체 폐기물에 경사에 의해 상층 액을 버린다. 작은 DNA 펠릿의 바닥에 붙어 남아 있어야한다튜브. DNA 펠렛을 세척하기 위해 각 튜브에 70 % 에탄올 250 μL 피펫. 격렬하게 흔들어. 테이블 탑 원심 분리기에서 13,000 rpm에서 3 분 동안 각 튜브를 스핀 다운. </li><li> 아래로 회전 한 후, 액체 폐기물에 경사에 의해 상층 액을 버린다. 작은 DNA 펠렛 튜브의 바닥에 붙어 남아 있어야한다. 튜브에 남아있는 액체가 존재하지 않도록 나머지 상등액을 피펫. 5 ~ 10 분 동안 벤치 탑에 건조 열린 튜브를 남겨주세요. 건조 후, 250 ㎕의 TE 버퍼에 재현 탁을 DNA. DNA를 용해 할 수 있도록 6 시간 동안 37 ° C에서 발생. </li></ol></li><li> PCR 최적화 된 사전 또는 남부 오점 전략을 사용하여 각 샘플을 유전자형. 참고 :.. AAVS1는 AAV-CAGGS-EGFP 수리 템플릿을 사용하여 대상의 경우, 남부 오점 전략 등 2009 년 4 포괄적 인 남부 블로 팅 프로토콜, 남부에서 찾을 수 있습니다 Hockemeyer에서 찾아 볼 수있다 2006 (35)의 다중 PCR 유전자형하십시오. 같은 실험, 프라이머 및 조건이 될 수 있습니다표 2 (36)에서 발견. </li><li> 제대로 대상이되지 않는 우물을 취소하고 매일 제대로 표적 세포에 hESC의 미디어를 변경 계속합니다. 그들이 대략 50 % 컨 플루 언트 될 때, 세포를 동결 프로토콜을 오해 아래 참조. <ol><li> 어느 날 동결하기 전에, 기존의 미디어를 제거하고 10 μm의 Y-27632 보충 따뜻한 hESC의 미디어를 추가, hESC의 미디어를 변경합니다. </li><li> 동결의 날이 15 ML 원뿔 튜브에서 아래로 동결되고있는 12 웰 플레이트 잘 당 용액 A와 용액 B의 0.5 ml의 각을 준비합니다. 얼음에 장소 솔루션을 제공합니다. 솔루션 : 50 % hESC의 미디어와 50 % FBS; 용액 B : 80 % FBS와 20 % 디메틸 술폭 시드 (DMSO). </li><li> 동결하기 전에 단일 세포로 hPSC의 식민지를 떼어 놓다. 따라서 볼륨을 확장,이 작업을 수행하는 단계 2.2-2.8를 수행합니다. A. 용액 0.5ml를 완전히 재현 탁 세포 펠렛 </li><li> 세포 현탁액, 피펫 최대 0.5 ml의 용액 B를 추가하고 아래로 세포 현탁액이 균일하게 할 수 있습니다. 탁E 2ml의 cryotube에 세포 현탁액 (~ 1 ㎖) 및 예금의 총량. 단단히에 캡 나사. </li><li> -80 ° C의 냉동고 O / N의 장소 cryotube. 동결 한 다음날, -80 ° C 냉동고에서 냉동 된 세포를 제거하고 즉시 장기 보관 용 액체 질소 탱크에 배치했다. </li></ol></li></ol>

저자는 더 경쟁 재정적 이익을 선언하지 않습니다.

유전자 편집 인간 다 능성 줄기 세포의 동종 집단을 분리 여기 제시된 방법은 표적 유전자좌 만 다른 동종 hPSC 라인을 생성하기위한 강력한 방법이다. 이러한 세포는 인간 세포의 분화 및 발달을 프로빙 메커니즘뿐만 아니라 제어 유전 설정에서 단일 유전자 질환의 병태 생리에 대한 이해를위한 이상적인 시스템이다. 여기에서 입증 된 바와 같이, 그 궤적 AAVS1 대상으로 통합을 달성하기 위해 3 개의 독립적 인 SSN 설계 전략 (ZFNs, TALENs 및 CRISPR / Cas9)를 사용하는 것이 가능하다. 이 방법은 각각 자신의 장점과 단점이 있습니다. 전위 ZFNs 이용하고, 어느 정도, TALENs 개별 클레아 (42)의 결합 도메인 DNA를 향상시키기 위해 공학 반복있게 설계 유연성이다. 이 클레아 최적화는 CRI와 달성 것 이상의 ZFNs 및 TALENs의 특이성을 증가시킬 수SPR / Cas9 시스템. 이러한 선택성은 표적 특이성이 요구되는 높은 수준의 임상 적 응용에 중요 할 수있다. CRISPR / Cas9 시스템의 주요 장점은 사용의 용이함이다. TALEN과 ZFN 건설 키트 (Addgene (21)를 통해 예) 공중에 이용 가능하게되었지만, 단지 필요한 커스터마이즈 20 염기쌍 올리고 그대로 px330 플라스미드를 사용하는 경우, CRISPR / Cas9 기반 보장 번호는 (구성하는 것이 훨씬 쉽다 디자인 14). 이 간단하게 자신의 연구에서 게놈 편집을 포함하고자하는 연구소에 대한 유리한 것으로 증명한다. 유전자 편집 hPSC 라인을 만드는 nucleofection 43 포함한 다른 형질 전환 방법이있다; 그러나 전기는 일관되고 비용 효율적인 4,5,25 것으로 나타났다. Nucleofection는 SSN 효율을 증가 직접 핵 내로 Cas9 가이드 RNA의 리보 착체를 형질하는데 사용될 수있다D 충실도 (44). MEFs에에 hPSCs 성장 과도한 차별없이 만능 상태에서 hPSCs을 유지하기 위해 강력하고 저렴한 방법입니다. 또한, 유 전적으로 동일한 콜로니 쉽게 분리 가능하다. 대안 적으로, 그러나 이러한 배양 조건은 배양 물 공급 계보다 더 비쌀 수 MEFs에 hPSCs없이 배양 할 수있다. 또한, 전체 프로세스는 매우 드문 편집 이벤트 단리 또는 편집 평행 실험에서 많은 별개 세포주의 생성을 가능하게 확장된다. 여기에 설명 된 프로토콜이 강력; 그러나 정확하게 편집 클론을 얻을 수있는 효율에 영향을주는 여러 가지 주요 단계가있다. 이 방법의 가장 중요한 구성 요소는 높은 품질의 MEFs에 약물 내성 DR4의 MEFs에 데있다. 단일 hPSCs의 생존 얇은이며, 저품질 MEFs에 미분화 hPSC 라인들의 분리를 방해한다. 둘째로, Y-27632의 사용은 또한이상 핵형 45 세포 선택적 압력을 생성하지 않고 단일 세포 생존을 허용하는 키. 셋째, 잘 간격 식민지를 따기 유래 세포 라인의 유전 적 동질성을 보장합니다. 마지막으로, 개구부가 많은 작은 조각으로 콜로니를 파괴하기에 충분히 작도록 다수의 콜로니를 새로운 잘 성장할 것이라는 보장 유리 피펫을 준비하는 것이 중요하다. 복제 판은 유전자형에 대한 격리 식민지의 원판을 떠나 문화가하려면이 잘 간격 서브 클론의 수확을 허용합니다. 이 프로토콜에 도전 부분은 유리 피펫으로 당겨 수동이다 이것은 사전에 연습을해야한다. 이는 유리 피펫을 필요로하지 않는 클론 피킹 여러 기술들이 있다는 것을 유의해야한다. 실험자들은 그들에게 가장 적합한 하나를 찾을 것을 권장합니다. 간단한 개조로 극복 할 수있다이 프로토콜에 제한이 있습니다. O를위한 실험할수 있답니다 그 수리 템플릿 선택 카세트를 포함하지 않는, 편집 한 세포 농축의 다른 방법을 사용해야합니다 수리 또는 하나없이 관심의 궤적을 방해. 양성 클론을 찾기 위해 고른해야 콜로니의 수는 선택의 부재시 크게 증가합니다. 효율성을 개선하기위한 한 가지 전략은 형광 단백질을 발현하는 비 - 통합 된 플라스미드를 공동 형질 감염이다. 세포 이틀간 회복시킨 후, 표적 세포는 형광 활성화 세포 정렬을 사용하여 긍정적 인 형광에 정렬 및 29 플레이 팅 될 수있다. 이 프로세스는 전기 천공에 의해 플라스미드로 형질 감염되어 세포 풍부하여 셀의 동시 편집 이벤트의 가능성을 증가시킨다. 여기에 설명 된 기술들은 동시에 여러 궤적 14,46,47 타겟팅 여러 가이드의 RNA를 사용하여 확장 될 수있다. 대부분의 프로토콜은 hPSCs을 차별화하기 위해 설립 된독특한 세포 유형으로, 관심의 30 종류의 세포에 각종 유전자 조작을 허용한다. 전반적으로, 우리는 관계없이 SSN 선택의 hPSCs 효율적인 게놈 편집의 가능성을 증명하고있다. 우리는이 기술은 임의의 게놈 유전자좌 유전자 편집 된 동종 hPSC 라인을 생성하도록 구성 될 수 있다는 것을 제안한다.

게놈 편집 기술은 빠르게 분자 및 세포 생물학 1 표준 도구로 진화하고있다. hPSCs 유전자 그대로 차 인간 세포의 자기 갱신 소스를 나타내는 인간 다 능성 줄기 세포 (hPSCs)의 유전자 조작은 특히 중요하다. hPSCs는 질병 모델링 또는 이식 요법 2,3-위한 소스와 같은 다양한 유형의 세포로 분화 될 수있다. AAVS1의 궤적에서 리포터 구조의 대상으로 통합을위한 내생 DNA 복구 메커니즘과 함께 사이트 별 클레아 제 (보장 번호)의 세 가지 유형을 사용하는 프로토콜은 여기에 설명했다. hPSCs에 보장 번호의 형질 전환 후, 우리는 기자를 숨겨 동종 세포 인구를 분리하는 방법을 보여줍니다. 특히 만능 세포 게놈 줄기, 게놈을 조작 할 수있는 능력은 사용 보장 번호는 징크 핑거 뉴 클레아 제 (ZFNs) 및 전사 activat의 유틸리티와 같은 새로운 현상이 아니다유전자 편집 또는 같은 이펙터 클레아 제 (TALENs)는 몇 년 전 4-10 증명되었다. 그러나, S. pyogenes의의 CRISPR의 출현 / Cas9 기술을 11-13로, 유전자 편집 (14)가 널리 접근이되고있다. 모든 보장 번호가 아닌 동종 최종 합류 (NHEJ)를하거나 상동 감독 수리 (HDR) (15)를 사용하여 내인성 세포 메커니즘에 의해 수리 지정된 대상 사이트 1,4,5,11에서 이중 가닥 DNA 휴식 (DSB)를 소개합니다. NHEJ는 오류가 발생하기 쉬운 것이다 및 신규 요소 SSN과 수리 주형의 공동 형질 감염을 통해 도입 될 수 있도록 허용하면서 HDR, 유전자 기능의 상실을 초래 프레임 시프트 돌연변이를 도입 할 수있다. 유전자 편집을 용이하게 DNA 복구의 기본 원리는 각 SSN위한 대체로 동일하다고 생각되지만, 플랫폼 간의 몇 가지 차이점을 알 수있다. 드 ZFNs의 노보 설계 유연성과 클레아 최적화 16 공개의 그러나 사용을 허용개인 ZFNs을 설계 할 수 어셈블리 라이브러리 및 검사 도구는 시간이 소요될 수 있습니다. ZFN 매개 타겟팅 원하는 궤적이 결정되면, ZFN 쌍은 온라인 ZiFit 공구 (17)로 설계 될 수있다. 디자인 후, ZFNs는 모듈 식으로 플라스미드 복제 (18)의 여러 라운드를 통해 조립 될 수있다. 또한, 많은 상업적으로 이용 가능한, 사전 검증 ZFNs (19)이있다. 이야기 클레아 제는 온라인 도구와 공개적으로 사용 가능한 구성 요소 17, 20를 사용하여 설계 할 수있다. 예를 들어, TALENs 빠르게 플래시 어셈블리 (21) 또는 PCR 기반의 계층 적 골든 게이트 어셈블리 (22)를 사용을 통해, 다섯 이야기 반복 블록에서 조립 될 수있다. SSN 설계 및 CRISPR / Cas9를 사용하여 건축 속도의 용이성 널리 접근 도구를 편집 게놈을 만들었습니다. 가이드의 RNA의 다중화는 단일 구조 (14) 여러 궤적을 대상으로하는 CRISPR의 짧은 가이드 RNA 매개 타겟팅 / Cas9도 있습니다. 디자인대상 궤적에 인접 유전자 편집을위한 Cas9의 protospacer 인접 모티브 (S. 대한 NGG의 trinucleotide가 Cas9를 pyrogenes PAM)의 확인이 필요합니다. px330 플라스미드 14으로 PAM의 20 염기쌍 (5 &#39;)에 상응하는 올리고 뉴클레오티드를 삽입하여, 구조체는 하나의 복제 단계에서 조립 될 수있다. S. 이외에 오게 네스 Cas9, N.에서 Cas9 NNNNGATT-5&#39;-3 &#39;(PAM)를 인식 뇌수막염 (NmCas9)는 hPSCs 23 효율적인 유전자 편집을 허용하는 것으로 나타났다. SSN 설계의 용이성의 차이뿐만 아니라, 각각의 플랫폼은 특정 속성을 갖는다. 예를 들어, ZFNs 및 TALENs Cas9은 주로 생성 종단 DSBs을 무디게 생각하면서 네 뉴클레오티드 5 &#39;오버행 (24)를 생성 FokI 클레아 도메인을 이용한다. ZFNs, TALENs 및 Cas9는 온 - 오프 비율 표적 DNA에 자신의 단백질 안정성에 차이가, 그리고 DNA 검사의 모드 모두 C의이론적으로 편집 한 결과의 작은 차이가 발생 울드. 추가 연구가 완전히 이러한 차이의 결과를 이해하도록 요구 될 것이지만, 여기 세 플랫폼 매우 견고하고 용이 hPSCs 유전자 변형을 생성하기 위해 사용될 수있다 프로토콜을 설명한다. 에 관계없이 SSN 선택의, 전기는 hPSCs (25)에있는 SSN과 동성 수리 템플릿을 형질하는 강력한 절차입니다. 항생제 내성에 대한 선택 후 식민지를 생존의 수는 궤적 특정 매개 변수 및 편집 전략 (유전자 삽입과 선택 모드의 예를 들면, 크기)에 따라 달라집니다. 여기에 설명 된 프로토콜은 일반적으로 약 150-400 단세포 유래 콜로니를 초래한다. 유전자 편집이 프로토콜을 이용하여 AAVS1 유전자좌 이전 보장 번호 4,5의 효과를 보여주기 위해 사용되었다. AAV-CAGGS-EGFP 수리 템플릿은 유전자 트랩 STR을 사용ategy는 궤적 특정 방식으로 퓨로 마이신 내성을 부여합니다. 간단히, 수리 템플릿은 promoterless의 퓨로 마이신 저항 카세트의 상류 스플 라이스 수용체 사이트가 포함되어 있습니다. AAVS1 유전자좌 PPP1R12C 유전자의 첫번째 인트론에 올바르게 통합하면, 저항 카세트 편집 유전자의 프로모터로부터 발현된다. 이 특정 AAVS1 분석의 견고 함은 우리가 각각의 SSN 플랫폼의 효율성을 비교할 수 있습니다. 보장 번호를 이용하여 유전자 편집 방해 및 / 또는 이론적으로 어떤 유전자를 변경하는 기능이 주어진 강력하다. hPSCs이 전략을 적용하는 단계가 후속 hPSCs 이러한 뉴런 26 인간 세포 유형의 다수로 분화 할 수 있기 때문에, 범용성을 제공한다 (27) 간세포, 심근 세포와 28. 또한, 환자 유래 유도 다 능성 줄기 세포의 사용은 환자의 특정 유전 배경 (29)에서 공지의 보수 또는 질병을 유발하는 돌연변이의 도입을 허용 </sup&gt;, 질병 메커니즘과 환자 자신의 세포 (30)를 사용하여 테스트 치료제를 조사에서 플랫폼을 제공한다. 요약하면, hPSCs에서 유전자 편집 인간 발달과 질병 (31)의 기본적인 생물학을 조사하기위한 효율적이고 다양한 접근 방법이다.

<table><tbody><tr><td>DMEM/F12</td><td>Life Technologies</td><td>11320082</td><td></td></tr><tr><td>Fetal Bovine Serum (HI)</td><td>Life Technologies</td><td>10082-147</td><td></td></tr><tr><td>Knockout Serum</td><td>Life Technologies</td><td>10828-028</td><td></td></tr><tr><td>Fibroblast Growth Factor - basic</td><td>Life Technologies</td><td>PHG0261</td><td></td></tr><tr><td>Pen/Strep</td><td>Life Technologies</td><td>15140-122</td><td></td></tr><tr><td>Glutamine</td><td>Life Technologies</td><td>25030-081</td><td></td></tr><tr><td>MEM NEAA</td><td>Life Technologies</td><td>11140-050</td><td></td></tr><tr><td>2-mercaptoethanol</td><td>Life Technologies</td><td>21985-023</td><td></td></tr><tr><td>Y-27632</td><td>Calbiochem</td><td>688000</td><td></td></tr><tr><td>6-well plates</td><td>Corning</td><td>3506</td><td></td></tr><tr><td>12-well plates</td><td>Corning</td><td>3512</td><td></td></tr><tr><td>4 mm Electroporation cuvettes</td><td>Bio-rad</td><td>165-2081</td><td></td></tr><tr><td>X-cel gene pulser II</td><td>Bio-rad</td><td>165-2661</td><td></td></tr><tr><td>0.25% Trypsin-EDTA</td><td>Life Technologies</td><td>25200-056</td><td></td></tr><tr><td>10&amp;times; Phosphate buffered saline (PBS) pH7.4&amp;nbsp;</td><td>Life Technologies</td><td>70011-044</td><td></td></tr><tr><td>Puromycin</td><td>Life Technologies</td><td>A11138-02</td><td></td></tr><tr><td>Pasteur pipettes, plugged</td><td>VWR</td><td>14672-412</td><td></td></tr><tr><td>Tris-HCl</td><td>Sigma-Aldrich</td><td>S5941</td><td></td></tr><tr><td>NaCl</td><td>Sigma-Aldrich</td><td>S9888</td><td></td></tr><tr><td>SDS</td><td>Sigma-Aldrich</td><td>L3771</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>E5134</td><td></td></tr><tr><td>Proteinase-K</td><td>Life Technologies</td><td>AM2544</td><td></td></tr><tr><td>Ethanol</td><td>VWR</td><td>TX89125-172SFU</td><td></td></tr><tr><td>Isopropyl Alcohol</td><td>VWR</td><td>MK303216</td><td></td></tr><tr><td>TE Buffer</td><td>Life Technologies</td><td>12090-015</td><td></td></tr><tr><td>Dimethyl Sulfoxide (DMSO)</td><td>Sigma-Aldrich</td><td>D8418</td><td></td></tr><tr><td>1.8 ml Cryotubes</td><td>ThermoScientific</td><td>377267</td><td></td></tr></tbody></table>

establishment of genome-edited human pluripotent stem cell lines: from targeting to isolation

인간 다 능성 줄기 세포 (hPSCs)의 게놈 편집은 인간 발달을 이해하고 질병의 병태 생리를 조사하는 유전자 제어 및 임상 적 플랫폼을 제공합니다. 게놈 편집을 위해 특정 사이트 클레아 제를 (보장 번호)를 사용함으로써, 다른 동종 설정에서 특정 유전자 변경을 품고 새로운 hPSC 라인의 빠른 도출이 가능해진다. 아연 손가락 클레아 제 (ZFNs), 전사 활성제와 같은 이펙터 클레아 제 (TALENs) 및 클러스터 정기적으로 interspaced 짧은 회문 반복 (CRISPR)은 / Cas9은 가장 일반적으로 사용되는 보장 번호입니다. 이러한 뉴 클레아의 모든함으로써 게놈 현장에서 정확한 유전자 편집을 촉진, 특정 사이트에서 이중 가닥 DNA 휴식을 도입하여 작동합니다. SSN-묵상 게놈 편집 삽입 / 삭제 돌연변이 또는 Alt를 도입하거나 세포의 내생 DNA 회복 메커니즘, 비 동종 끝 (NHEJ)에 가입하고 상동 감독 수리의 두 (HDR)를 활용이중 가닥 휴식의 사이트에있는 상동 수리 템플릿을 사용하여 게놈 어. hPSCs의 전기는 형광등 기자들과 항생제 내성 카세트로 유전자를 통합 보장 번호 및 수리 템플릿을 형질의 효율적인 수단이다. 전기 천공 후에, 항생제 내성을 선택하여 수리 구조체를 혼입 hPSCs들만을 분리하는 것이 가능하다. 기계적 hPSC 콜로니를 분리하고 유전자형을 통해 목표 부위에 적절한 통합을 확인 올바르게 표적 유전자와 동종 세포주의 격리를 허용한다. 이 프로토콜의 유효성은 EGFP 및 퓨로 마이신 저항이 인간 다 능성 줄기 세포의 AAVS1 면책 궤적으로 구성 통합하는 세 가지 SSN 플랫폼을 사용하여 여기에 설명된다.

여기에서 우리는 유전자 조작 hPSC 라인을 만들 수있는 세 가지 다른 SSN 플랫폼과 호환 프로토콜을 보여줍니다. 우리는 EGFP 기자와 퓨로 마이신 저항 카세트 4를 소개하는 수리 템플릿을 사용하여 이전에 발행 된 ZFNs 4, TALENs 5 CRISPR / Cas9s (37)를 사용하여 AAVS1의 궤적에서 WIBR 번호 3 인간 배아 줄기 세포를 대상으로. 우리는 미분화 hPSCs의 유지 보수 및 확장을 허용하는 세포 배양 워크 플로우 (그림 2)에 대한 MEFs에 우리 hPSCs을 배양,이 또한 효과적이고 확장 성있는 비용이다. 세포가 필요 이상으로 증가하는 경우 형질 다 능성 세포의 수 및 그 결과 얻어진 정확하게 타겟팅 hPSC 콜로니의 수를 줄이고, 분화 증가의 위험이있다. 우리는 electropSSN 플랫폼 당 5.0 × 10 6 세포를 orated과 DR4 MEFs에의 한 6 웰 플레이트에 각 대상에서 세포를 도금. 선택 후, 각각의 플랫폼은 EGFP 양성 식민지 (그림 3)과, 타겟이 불분명 한 homozygously 대상 및 heterozygously 대상 클론 (표 3 그림 4A, B)의 조합의 결과. 여기에 제시된 조건에서, 우리는 AAVS1 TALENs 가장 EGFP 양성 클론의 결과 것을 찾을 수 있습니다. 이 실험에 사용 된 수리 템플릿은 EGFP 기자와 퓨로 마이신 저항 카세트의 상류 스플 라이스 수용체 사이트로 구성되어 있습니다. 이 &quot;유전자 트랩&quot;전략 (도 1)를 이용하여, 구조가 퓨로 마이신 내성 카세트의 발현을 구동하는 내인성 프로모터를 사용 AAVS1 궤적의 첫번째 인트론에 삽입한다. 발현을 방지한다 수리 템플릿 내에 퓨로 마이신 내성 유전자의 발현을 구동 프로모터의 부족<html> 임의의 통합 이벤트입니다. 따라서, 우리는 모든 퓨로 마이신 내성 클론 AAVS1 사이트에서 타겟이 될 것이라고 기대하고있다. 그것은하지만 대부분의 PCR 전략 (그림 1, 그림 4C)에 의해, 클론의 일부는 내부 프로브를 사용하여 남부 얼룩에 의해 검출되는 AAVS1의 궤적에서 벗어난 통합을 수행하는 것을 주목해야한다 4. 이러한 통합 이벤트는 대부분 도너 플라스미드 (4)의 여러 통합 선도 이종성 타겟팅 이벤트의 결과이다. 우리는 각각의 SSN 실험에서 24 식민지를 포착하고 모든 플랫폼이 매우 높은 타겟팅 효율성을했고, 최소한의 차이를 보였다 것으로 나타났습니다. PCR 심문 같이 TALEN 플랫폼이 가장 homozygously 표적 클론 (표 3)가 있었을 때, CRISPR / Cas9 가장 정확하게 표적 클론을 수득 하였다. /files/ftp_upload/53583/53583fig1highres.jpg &quot;폭 =&quot;700 &quot;/&gt; 유전자의 그림 1. 도식은 AAV-CAGGS-EGFP 수리 템플릿.에서 Hockemeyer 등. 수정을 사용하여 AAVS1의 궤적을 편집, 2009 년 <a href="https://www.jove.com/files/ftp_upload/53583/53583fig1highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/53583/53583fig2highres.jpg" width="700" /> WIBR # 3 세포의 그림 2. 식민지. (3) 인간 배아 줄기 세포 이전 대상에 WIBR 번호의 식민지의 대표 시야 이미지. 차별화의 부족과 비 이상적인 하나 (오른쪽)에 반대 이상적인 식민지 (왼쪽)에있는 세포층의 명확한 분리를합니다. <a href="https://www.jove.com/files/ftp_upload/53583/53583fig2highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a><img alt="그림 3" src="/files/ftp_upload/53583/53583fig3highres.jpg" width="700" /> 그림 3. EGFP 양성 WIBR # 3 세포. WIBR 번호 AAVS1의 궤적에서 EGFP 발현 수리 템플릿을 대상으로 3 세포의 대표 이미지. ZFNs로 편집 대표 식민지의 이미지, TALENs 및 CRISPR / Cas9이 표시됩니다. <a href="https://www.jove.com/files/ftp_upload/53583/53583fig3highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/53583/53583fig4highres.jpg" width="700" /> 그림 4. 유전자형 전략은 정확한 타겟팅을 확인합니다. (A) 세 SSN 플랫폼에서, 타겟이 불분명 한 이형과 동형 접합 대상으로 클론을 보여주는 대표적인 PCR 유전형 결과. WT CTL은 야생형 제어 =. (B) 파트 :이형 대상 복제 및 3 &#39;외부 프로브 검출 동형 접합 대상 복제를 보여주는 대의 적 남부 오점 결과. 조각 크기 : WT-6.5 KB, 편집 - 6.9 킬로바이트 (C) 적절하게 편집 클론 및 비 - 무작위 이중 통합 이형 클론을 도시 주제 서던 블롯 결과. 조각 크기 :. 제대로 편집-6.9 KB, 비정상적인 추가 통합-5 KB <a href="https://www.jove.com/files/ftp_upload/53583/53583fig4highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table fo:keep-together.within-page="1"><tbody><tr><td> 연구 </td><td> 유전자 표적 </td><td> 플랫폼 </td><td> 수리 템플릿 유형 </td><td> 클론의 # 고른 </td><td> 타겟팅 효율성 </td></tr><tr><td> 교회의 머슴 등. 2014 </td><td> TPP1 </td><td> ZFN </td><td> GFP - 순수하지 않아 </tD&gt; <td> 보고되지 않은 </td><td> 보고되지 않은 </td></tr><tr><td> 교회의 머슴 등. 2014 </td><td> TERT </td><td> ZFN </td><td> 하이 그로 마이신 </td><td> 보고되지 않은 </td><td> 보고되지 않은 </td></tr><tr><td> Hockemeyer 등. 2009 </td><td> POU5F1 </td><td> ZFN </td><td> GFP - 순수하지 않아 </td><td> (31) </td><td> 39.0 % </td></tr><tr><td> Hockemeyer 등. 2009 </td><td> PITX3 </td><td> ZFN </td><td> GFP - 순수하지 않아 </td><td> (74) </td><td> 14.9 % </td></tr><tr><td> Hockemeyer 등. 2011 </td><td> POU5F1 </td><td> TALEN </td><td> GFP - 순수하지 않아 </td><td> (68) </td><td> 91.0 % </td></tr><tr><td> Hockemeyer 등. 2011 </td><td> PITX3 </td><td> TALEN </td><td> GFP - 순수하지 않아 </td><td> (96) </td><td> 13.0 % </td></tr><tr><td> MERKLE 등. 2015 </td><td> VASA </td><td> Cas9 </td><td> 리포터 - 네티 </td><td> 139 </td><td> 94.0 % </td></tr><tr><td> MERKLE 등. &lt;/ EM&gt; 2015 </td><td> CRH </td><td> Cas9 </td><td> 리포터 - 네티 </td><td> (30) </td><td> 93.0 % </td></tr><tr><td> MERKLE 등. 2015 </td><td> HCRT </td><td> Cas9 </td><td> 리포터 - 네티 </td><td> (154) </td><td> 92.0 % </td></tr><tr><td> MERKLE 등. 2015 </td><td> HMX2 </td><td> Cas9 </td><td> 리포터 - 네티 </td><td> (11) </td><td> 45.0 % </td></tr><tr><td> 포스터 등. 2014 </td><td> LRG5-Nterm </td><td> ZFN </td><td> GFP - 순수하지 않아 </td><td> 보고되지 않은 </td><td> 30.0 % </td></tr><tr><td> 포스터 등. 2014 </td><td> LRG5-Cterm </td><td> ZFN </td><td> GFP - 순수하지 않아 </td><td> 보고되지 않은 </td><td> 14.0 % </td></tr><tr><td> Soldner 등. 2011 </td><td> SNCA </td><td> ZFN </td><td> 순수하지 않아 </td><td> (96) </td><td> 1.0 % </td></tr></tbody></table> 표 다른 유전자의 1 설명 corre으로,이 방법을 사용하여 대상sponding 이전에 발표 된 연구에서 가져온 효율성을 대상으로. 4,5,38-41 <table fo:keep-together.within-page="1"><tbody><tr><td> 현장 </td><td> 순서 </td><td> 노트 </td></tr><tr><td> AAVS1-F 프라이머 </td><td> CTCTAACGCTGCCGTCTCTC </td><td> PCR 조건 : T의 M = 57 ° C, 35주기 </td></tr><tr><td> AAVS1-WT-R 프라이머 </td><td> GCTTCTCCTCTTGGGAAGTG </td><td> (WT) 밴드 : 1,273 BP </td></tr><tr><td> AAVS1는 타겟팅-R 프라이머 </td><td> CGTCACCGCATGTTAGAAGA </td><td> 타겟 밴드 : 992 BP </td></tr><tr><td> T2-Cas9 가이드 </td><td> GGGCCACTAGGGACAGGAT </td><td> 말리에서 외. 2013 </td></tr><tr><td> AAVS1-ZFN 오른쪽 </td><td> TAGGGACAGGAT </td><td> Hockemeyer에서 등. 2009 </td></tr><tr><td> AAVS1-ZFN 왼쪽 </td><td> TGGGGTGTCACC </td><td> Hockemeyer에서 등. 2009 </td></tr><tr><td> AAVS1-TALEN 오른쪽 </td><td> TCCTAACCACTGTCTTT </td><td> Hockemeyer에서 등. 2011 </td></tr><tr><td> AAVS1-TALEN 왼쪽 </td><td> CCCCTCCACCCCACAGT </td><td> Hockemeyer에서 등. 2011 </td></tr></tbody></table> 프라이머 및 SSN 대상 시퀀스의 표 2. 목록. <table fo:keep-together.within-page="1"><tbody><tr><td> 구축 대상 </td><td> EGFP + 식민지의 수 </td><td> 대상 고른 클론 (PCR 검증) </td><td> (남부 오점으로) 이전보고 정확한 타겟팅 효율성 </td></tr><tr><td> ZFN </td><td> (150) </td><td> 86.9 % (73.9 %의 HET / 13.0 % 호모) </td><td> 56 % (50 % HET / 6 % 호모) </td></tr><tr><td> TALEN </td><td> (412) </td><td> 91.3 % (47.8 %의 HET / 39.1 % 호모) </td><td> 47 % (37.5 %의 HET / 9.3 % 호모) </td></tr><tr><td> CRISPR-Cas9 </td><td> (235) </td><td> 95.7 % (69.5 %의 HET / 26.3 % 호모) </td><td> 보고되지 않은 </td></tr></tbody></table> 표 3. 비교 EGFP 양성의 숫자와는 TALEN, ZFN을 목표로하고 CRISPR / Cas9 인간 줄기 세포 식민지. PCR은 이전 실험 4,5에 적절한 하나의 통합 검증 남부 오점에 비교 실험에 대한 AAVS1 궤적에서 통합을 확인했습니다.

Watch this Scientific Journal Video about Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation at JoVE.com

Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

게놈 편집 인간 다 능성 줄기 세포의 설립 : 분리에 타겟팅에서

Genome editing of human pluripotent stem cells (hPSCs) can be done quickly and efficiently. Presented here is a robust experimental procedure to genetically engineer hPSCs as exemplified by editing the AAVS1 safe harbor locus to express EGFP and introduce antibiotic resistance.

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human ...

establishment-genome-edited-human-pluripotent-stem-cell-lines-from

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

13.5K 조회수.  University of California, Berkeley. Genome editing of human pluripotent stem cells (hPSCs) can be done quickly and efficiently. Presented here is a robust experimental procedure to genetically engineer hPSCs as exemplified by editing the AAVS1 safe harbor locus to express EGFP and introduce antibiotic resistance. 

비디오: Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

Transfection, Selection, and Colony-picking of Human Induced Pluripotent Stem Cells TALEN-targeted with a GFP Gene into the AAVS1 Safe Harbor

Targeted transgene addition can provide persistent gene expression while circumventing the gene silencing and insertional mutagenesis caused by viral vector mediated random integration. This protocol describes a universal and efficient transgene targeted addition platform in human iPSCs based on utilization of validated open-source TALENs and a gene-trap-like donor to deliver transgenes into a safe harbor locus. Importantly, effective gene editing is rate-limited by the delivery efficiency of gene editing vectors. Therefore, this protocol first focuses on preparation of iPSCs for transfection to achieve high nuclear delivery efficiency. When iPSCs are dissociated into single cells using a gentle-cell dissociation reagent and transfected using an optimized program, >50% cells can be induced to take up the large gene editing vectors. Because the AAVS1 locus is located in the intron of an active gene (PPP1R12C), a splicing acceptor (SA)-linked puromycin resistant gene (PAC) was used to select targeted iPSCs while excluding random integration-only and untransfected cells. This strategy greatly increases the chance of obtaining targeted clones, and can be used in other active gene targeting experiments as well. Two weeks after puromycin selection at the dose adjusted for the specific iPSC line, clones are ready to be picked by manual dissection of large, isolated colonies into smaller pieces that are transferred to fresh medium in a smaller well for further expansion and genetic and functional screening. One can follow this protocol to readily obtain multiple GFP reporter iPSC lines that are useful for in vivo and in vitro imaging and cell isolation.

TALEN-mediated gene editing at the safe harbor AAVS1 locus enables high-efficiency transgene addition in human iPSCs. This protocol describes the procedures for preparing iPSCs for TALEN and donor vector delivery, transfecting iPSCs, and selecting and isolating iPSC clones to achieve targeted integration of a GFP gene to generate reporter lines.

형질, 선택 및 인간 유도 만능 줄기 세포의 콜로니 따기는 AAVS1 세이프 하버 (Safe Harbor)에 GFP 유전자 TALEN는 타겟팅

Targeted transgene addition can provide persistent gene expression while circumventing the gene silencing and insertional mutagenesis caused by viral ...

연구

발생학

Genome Editing and Directed Differentiation of hPSCs for Interrogating Lineage Determinants in Human Pancreatic Development

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding human development and dissecting disease mechanisms in a dish. To capitalize on this potential application requires efficient genome-editing tools to generate hPSC mutants in disease-associated genes, as well as in vitro hPSC differentiation protocols to produce disease-relevant cell types that closely recapitulate their in vivo counterparts. An efficient genome-editing platform for hPSCs named iCRISPR has been developed through the TALEN-mediated targeting of a Cas9 expression cassette in the AAVS1 locus. Here, the protocols for the generation of inducible Cas9 hPSC lines using cells cultured in a chemically defined medium and a feeder-free condition are described. Detailed procedures for using the iCRISPR system for gene knockout or precise genetic alterations in hPSCs, either through non-homologous end joining (NHEJ) or via precise nucleotide alterations using a homology-directed repair (HDR) template, respectively, are included. These technical procedures include descriptions of the design, production, and transfection of CRISPR guide RNAs (gRNAs); the measurement of the CRISPR mutation rate by T7E1 or RFLP assays; and the establishment and validation of clonal mutant lines. Finally, we chronicle procedures for hPSC differentiation into glucose-responsive pancreatic &#946;-like cells by mimicking in vivo pancreatic embryonic development. Combining iCRISPR technology with directed hPSC differentiation enables the systematic examination of gene function to further our understanding of pancreatic development and diabetes disease mechanisms.

Protocols to generate hPSC mutant lines using the iCRISPR platform and to differentiate hPSCs into glucose-responsive &#946;-like cells are described. Combining genome editing technology with hPSC-directed differentiation provides a powerful platform for the systematic analysis of the role of lineage determinants in human development and disease progression.

인간의 췌장 개발에 리니지의 결정 요인을 들여다보기위한 게놈 편집 및 hPSCs의 감독 차별화

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding ...

유전학

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

인간 다능성 줄기 세포에서 CRISPR-CAS9를 사용하여 정의된 게놈 수정 생성

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing in mammalian cells. Here we describe detailed procedures to seamlessly genome edit the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus as an example in human pluripotent stem cells. Combining a piggyBac-based donor plasmid and the CRISPR-Cas9 nickase mutant in a two-step genetic selection, we demonstrate correct and efficient targeting of the HNF4&#945; locus.

Here, we describe a detailed method for seamless gene editing in human pluripotent stem cells using a piggyBac-based donor plasmid and the Cas9 nickase mutant. Two point mutations were introduced into exon 8 of the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus in human embryonic stem cells (hESCs).

원활한 게놈 편집을 사용하여 인간 만능 줄기 세포에 점 돌연변이 도입

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing ...

Transfecting and Nucleofecting Human Induced Pluripotent Stem Cells

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human embryonic stem cells (HESCs)1. While improvements in several gene delivery methods have been described2-9, transfection remains a capricious process for HESCs, and has not yet been reported in human induced pluripotent stem cells (iPSCs). In this video, we demonstrate how our lab routinely transfects and nucleofects human iPSCs using plasmid with an enhanced green fluorescence protein (eGFP) reporter. Human iPSCs are adapted and maintained as feeder-free cultures to eliminate the possibility of feeder cell transfection and to allow efficient selection of stable transgenic iPSC clones following transfection. For nucleofection, human iPSCs are pre-treated with ROCK inhibitor11, trypsinized into small clumps of cells, nucleofected and replated on feeders in feeder cell-conditioned medium to enhance cell recovery. Transgene-expressing human iPSCs can be obtained after 6 hours. Antibiotic selection is applied after 24 hours and stable transgenic lines appear within 1 week. Our protocol is robust and reproducible for human iPSC lines without altering pluripotency of these cells.

Despite recent advancements in genetic modification, transfection of human embryonic stem cells (HESCs) remains a capricious process. To our knowledge, systematic and efficient methods to transfect human induced pluripotent stem cells (iPSCs) have not been reported. Here, we describe robust protocols to efficiently transfect and nucleofect human iPSCs.

인간 유도 만능의 줄기 세포를 Transfecting 및 Nucleofecting

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human ...

생물학

Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus

Even with the revolution of gene-targeting technologies led by CRISPR-Cas9, genetic modification of human pluripotent stem cells&#160;(hPSCs)&#160;is still time consuming. Comparative studies that use recombinant lines with transgenes integrated into safe harbor loci could benefit from approaches that use site-specific targeted recombinases, like Cre or FLPe, which are more rapid and less prone to off-target effects. Such methods have been described, although they do not significantly outperform gene targeting in most aspects. Using Zinc-finger nucleases, we previously created a master cell line in the AAVS1 locus of hPSCs&#160;that contains a GFP-Hygromycin-tk expressing cassette, flanked by heterotypic FRT sequences. Here, we describe the procedures to perform FLPe recombinase-mediated cassette exchange (RMCE) using this line. The master cell line is transfected with a RMCE donor vector, which contains a promoterless Puromycin resistance, and with FLPe recombinase. Application of both a positive (Puromycin) and negative (FIAU) selection program leads to the selection of RMCE without random integrations. RMCE generates fully characterized pluripotent polyclonal transgenic lines in 15 d&#160;with 100% efficiency. Despite the recently described limitations of the AAVS1 locus, the ease of the system paves the way for hPSC transgenesis in isogenic settings, is necessary for comparative studies, and enables semi-high-throughput genetic screens for gain/loss of function analysis that would otherwise be highly time consuming.

Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus

Here we report a rapid and efficient gene editing method based on RMCE in the AAVS1 locus of human Pluripotent Stem Cells (hPSCs) that improves upon previously described systems. Using this technique, isogenic lines can be rapidly and reliably generated for proper comparative studies, facilitating transgenesis-mediated research with hPSCs.

에서 재조합 효소 중재 카세트 교환에 의해 재조합 인간 다 능성 줄기 세포의 신속하고 효율적인 생성<em&gt; AAVS1</em&gt; 로커스

Even with the revolution of gene-targeting technologies led by CRISPR-Cas9, genetic modification of human pluripotent stem cells&#160;(hPSCs)&#160;is ...

의학

Selecting and Isolating Colonies of Human Induced Pluripotent Stem Cells Reprogrammed from Adult Fibroblasts

Herein we present a protocol of reprogramming human adult fibroblasts into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding Oct3/4, Sox2, Klf4 and c-myc (OSKM) in the presence of sodium butyrate 1-3. We used this method to reprogram late passage (&gt;p10) human adult fibroblasts derived from Friedreich's ataxia patient (GM03665, Coriell Repository). The reprogramming approach includes highly efficient transduction protocol using repetitive centrifugation of fibroblasts in the presence of virus-containing media. The reprogrammed hiPSC colonies were identified using live immunostaining for Tra-1-81, a surface marker of pluripotent cells, separated from non-reprogrammed fibroblasts and manually passaged 4,5. These hiPSC were then transferred to Matrigel plates and grown in feeder-free conditions, directly from the reprogramming plate. Starting from the first passage, hiPSC colonies demonstrate characteristic hES-like morphology. Using this protocol more than 70% of selected colonies can be successfully expanded and established into cell lines. The established hiPSC lines displayed characteristic pluripotency markers including surface markers TRA-1-60 and SSEA-4, as well as nuclear markers Oct3/4, Sox2 and Nanog. 
The protocol presented here has been established and tested using adult fibroblasts obtained from Friedreich's ataxia patients and control individuals 6, human newborn fibroblasts, as well as human keratinocytes.

We present a protocol for efficient reprogramming of human somatic cells into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding Oct3/4, Sox2, Klf4 and c-myc (OSKM) and identification of correctly reprogrammed hiPSC by live staining with Tra-1-81 antibody.

인간 유도 Pluripotent 줄기 세포의 선택 및 분리 식민지는 성인 섬유아 세포에서 다시 프로그램

Herein we present a protocol of reprogramming human adult fibroblasts into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding ...

Efficient Generation Human Induced Pluripotent Stem Cells from Human Somatic Cells with Sendai-virus

A few years ago, the establishment of human induced pluripotent stem cells (iPSCs) ushered in a new era in biomedicine. Potential uses of human iPSCs include modeling pathogenesis of human genetic diseases, autologous cell therapy after gene correction, and personalized drug screening by providing a source of patient-specific and symptom relevant cells. However, there are several hurdles to overcome, such as eliminating the remaining reprogramming factor transgene expression after human iPSCs production. More importantly, residual transgene expression in undifferentiated human iPSCs could hamper proper differentiations and misguide the interpretation of disease-relevant in vitro phenotypes. With this reason, integration-free and/or transgene-free human iPSCs have been developed using several methods, such as adenovirus, the piggyBac system, minicircle vector, episomal vectors, direct protein delivery and synthesized mRNA. However, efficiency of reprogramming using integration-free methods is quite low in most cases.
Here, we present a method to isolate human iPSCs by using Sendai-virus (RNA virus) based reprogramming system. This reprogramming method shows consistent results and high efficiency in cost-effective manner.

Here, we present our established method to reprogram human somatic cells into transgene-free human iPSCs with Sendai virus, which shows consistent outcome and enhanced efficiency.

센다이 바이러스와 인간의 체세포의 효율적인 생성 인간 유도 만능 줄기 세포

A few years ago, the establishment of human induced pluripotent stem cells (iPSCs) ushered in a new era in biomedicine. Potential uses of human iPSCs ...

Efficient iPS Cell Generation from Blood Using Episomes and HDAC Inhibitors

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using episomal plasmids and histone deacetylase (HDAC) inhibitors. The advantages of this approach include: (1) the use of a minimal amount of peripheral blood as a source material; (2) nonintegrating reprogramming vectors; (3) a cost effective method for generating vector free iPSCs; (4) a single transfection; and (5) the use of small molecules to facilitate epigenetic reprogramming. Briefly, peripheral blood mononuclear cells (PBMCs) are isolated from routine phlebotomy samples and then cultured in defined growth factors to yield a highly proliferative erythrocyte progenitor cell population that is remarkably amenable to reprogramming. Nonintegrating, nontransmissible episomal plasmids expressing OCT4, SOX2, KLF4, MYCL, LIN28A, and a p53 short hairpin (sh)RNA are introduced into the derived erythroblasts via a single nucleofection. Cotransfection of an episome that expresses enhanced green fluorescent protein (eGFP) allows for easy identification of transfected cells. A separate replication-deficient plasmid expressing Epstein-Barr nuclear antigen 1 (EBNA1) is also added to the reaction mixture for increased expression of episomal proteins. Transfected cells are then plated onto a layer of irradiated mouse embryonic fibroblasts (iMEFs) for continued reprogramming. As soon as iPSC-like colonies appear at about twelve days after nucleofection, HDAC inhibitors are added to the medium to facilitate epigenetic remodeling. We have found that the inclusion of HDAC inhibitors routinely increases the generation of fully reprogrammed iPSC colonies by 2 fold. Once iPSC colonies exhibit typical human embryonic stem cell (hESC) morphology, they are gently transferred to individual iMEF-coated tissue culture plates for continued growth and expansion.

Here we describe a protocol for generating human induced pluripotent stem cells from peripheral blood using an episome based reprogramming strategy and histone deacetylase inhibitors.

에피 솜과 HDAC 억제제를 사용하여 혈액에서 효율적인 유도 만능 줄기 세포 생성

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using ...

Derivation and Characterization of a Transgene-free Human Induced Pluripotent Stem Cell Line and Conversion into Defined Clinical-grade Conditions

Human induced pluripotent stem cells (hiPSCs) can be generated with lentiviral-based reprogramming methodologies. However, traces of potentially oncogenic genes remaining in actively transcribed regions of the genome, limit their potential for use in human therapeutic applications1. Additionally, non-human antigens derived from stem cell reprogramming or differentiation into therapeutically relevant derivatives preclude these hiPSCs from being used in a human clinical context2. In this video, we present a procedure for reprogramming and analyzing factor-free hiPSCs free of exogenous transgenes. These hiPSCs then can be analyzed for gene expression abnormalities in the specific intron containing the lentivirus. This analysis may be conducted using sensitive quantitative polymerase chain reaction (PCR), which has an advantage over less sensitive techniques previously used to detect gene expression differences3. Full conversion into clinical-grade good manufacturing practice (GMP) conditions, allows human clinical relevance. Our protocol offers another methodology&#8212;provided that current safe-harbor criteria will expand and include factor-free characterized hiPSC-based derivatives for human therapeutic applications&#8212;for deriving GMP-grade hiPSCs, which should eliminate any immunogenicity risk due to non-human antigens. This protocol is broadly applicable to lentiviral reprogrammed cells of any type and provides a reproducible method for converting reprogrammed cells into GMP-grade conditions.

We describe a protocol for deriving lentiviral-based reprogrammed and characterized factor-free human induced pluripotent stem cells and conversion into putative clinical-grade conditions.

의 유도 및 특성 형질 전환 유전자가없는 인간 유도 다 능성 정의 임상 수준의 조건으로 세포주 및 변환 줄기

Human induced pluripotent stem cells (hiPSCs) can be generated with lentiviral-based reprogramming methodologies. However, traces of potentially oncogenic ...