국립 보건원에 의해 지원되었다이 작품은 구강 질환 열기 자금 SKLOD2015OF01 (RB)의 R01 - DK100584 및 중국 국가 중점 실험실을 부여합니다. 우리는 도움을 Wenping 조, Tadatoshi 사토, 그리고 켈리 Lauter 감사합니다.

이 연구는 매사추세츠 종합 병원의 기관 동물 관리 및 사용위원회 (IACUC)에 의해 승인되었습니다. 시작하기 전에이 동물 실험에 대한 적절한 기관의 승인을 얻습니다. 일부 기술은 지역 IACUC 요구 사항에 따라 조정해야 할 수도 있습니다. 1. GFP - PTX 마우스 <ol><li> 또한 상대에 대한 이전 십주 - 8시 PTHcre + 마우스 및 로사 - mTmG 마우스를 얻습니다. </li><li> C57BL / 6 배경으로 마우스를 얻기 위해 6 세대 C57BL / 6 마우스와 (FVB 배경 129 혼합)를 PTHcre + 마우스를 교잡. </li><li> Inbreed PTHcre + 생쥐 PTHcre + / + 마우스 (17)를 얻었다. 참고 : 유전자형을 수행 꼬리의 끝에서 DNA를 추출하여 PCR을 위해 그것을 사용합니다. 다음과 같이 PCR 프라이머는 이형 접합 및 PTHcre 형질 전환 유전자의 동형 접합체를 확인하십시오 : 정방향 프라이머 A, CCTGTCAAGGATGTGGAAGA을, 프라이머 A를 역 &#39;, TCAGATCACACCACACAGCA을, F를orward 프라이머 B는 CAGTTGTCTTTAGTTTACTCAGCATCAG는 프라이머 B &#39;, GATAATCGCGAACATCTTCAGGTT 17 역. </li><li> 로사 - mTmG 마우스 (18)와 크로스 PTHcre + / + 마우스 16. 경우 4 주 오래 mTmG 새끼, PTHcre을 유아. </li><li> 0.6 밀리그램 / g의 체중에 tribromoethanol의 IP 주입 (AVERTIN)에 의해 mTmG 마우스, 또는 케타민 / 자일 라진과 같은 다른 에이전트 10 주 이전 PTHcre - 8 마취. 승인 된 프로토콜에 따라 수술 후 48 시간 동안 진통으로 부 프레 노르 핀 0.1 ㎎ / ㎏ 사우스 캐롤라이나 모든 12 시간을 사용합니다. 발가락 핀치 철수 반사 또는 다른 방법으로 마취의 적절한 깊이를 확인합니다. 앙와위에서 동물을 놓습니다. </li><li> 확장 및 단일 에지 블레이드를 사용하여 피부를 도용하여 복부 목 영역을 준비합니다. 포비돈 요오드 살균 패드로 면도 피부를 소독. </li><li> 수술 부위의 오염을 감소시키고 멸균 마이크를 사용하여 무균 수술 드레이프 동물 커버수술에 대한 rosurgical 악기. </li><li> 수술 용 메스로 피부에 2cm 길이의 절개를 잘라. 근막을 해부과 곡선 톱니 모양의 집게와 무딘 절개에 의해 옆으로 침샘을 누릅니다. </li><li> 할로겐 빛과 4를 사용하여 해부 현미경 - 5 배 배율을 잘라 날카로운 집게 팁을 사용하여 paratracheal 근육을 분리하고 호흡 관을 폭로. </li><li> 다음 기관에있는 좌우 엽으로 갑상선을 확인합니다. </li><li> 형광등을 광원을 전환하고 두 녹색 형광 부갑상선을 시각화. 참고 : 일반적으로 두 개의 부갑상선은이나 갑상선의 표면 근처에 위치하고 있습니다,하지만 때때로, 그들은 멀리 떨어져 있습니다. </li><li> 조심스럽게 수술 집게와 가위를 사용하여 녹색 부갑상선을 제거합니다. 지혈을위한 멸균 거즈를 사용하여 조심스럽게 모든 녹색 조직이 제거되었는지 확인 기관을 따라 확인합니다. </리&gt; <li> 6-0 polyglactin에게 910 봉합사를 사용하여 중단 봉합하여 paratracheal 근육을 닫습니다. 6-0 polyglactin에게 910 봉합사를 사용 홀스 테드 봉합하여 피부 절개를 닫습니다. </li><li> 선택적 : 유체 교체를 위해 마우스에 10 μL / g 체중 통상 0.9 % 멸균 식염수를 주입한다. </li><li> 체온 복구를위한 따뜻한 인큐베이터 (37 ° C)에 별도의 케이지에 수술 후 동물을 놓습니다. 쥐가 깨어과 가로 누운 위치에되면, 케이지 바닥에 일부 젤라틴 음식 펠릿 차우와 물을 넣어. </li><li> 2 시간의 수술 후 관찰 기간 후, 동물 시설에 마우스를 반환하고 수술 후 관리를위한 지역의 요구 사항을 따르십시오. </li><li> 삼일 부갑상선 후, 10 μL 꼬리 혈액을 수득 및 혈액 가스 시스템 칼슘 ++ / 산도 분석기와 같은 분석을 사용하여 이온화 칼슘 ++ 혈액을 측정한다. 혈액의 성공적인 부갑상선 결과는 칼슘 ++ 같거나 가짜로 작동하는 죄수의 -2SD보다 낮은 이온화트롤 마우스 (N = 30의 실험에서 1.20 밀리몰 / L). </li></ol> 2. PTH는-CRE-IDTR 마우스 <ol><li> 상대에 대한 이전 십주 - 8에서 PTHcre +와 DTR은 FL / FL 마우스를 얻습니다. </li><li> C57BL / 6 배경으로 마우스를 얻기 위해 6 세대 C57BL / 6 마우스와 (FVB 배경 129 혼합)를 PTHcre 마우스를 교잡. </li><li> PTHcre + (C57BL / 6 배경) 마우스 PTHcre + / + 마우스 (17)를 얻을 수 Inbreed. 참고 : 마우스 꼬리 끝에서 DNA를 추출하여 PCR에 사용 된, 유전자형을 수행합니다. 유전자형 프라이머 : 정방향 프라이머 A, CCTGTCAAGGATGTGGAAGA, &#39;앞으로 프라이머 B, CAGTTGTCTTTAGTTTACTCAGCATCAG는, 프라이머 B 역 TCAGATCACACCACACAGCA&#39;GATAATCGCGAACATCTTCAGGTT (17) 프라이머 A를 역. </li><li> DTR과 PTHcre + / + 마우스 (16) 메이트 FL / FL PTHcre-IDTR 마우스를 얻기 위해 마우스 19. </li><li> diphtheri을 희석하여 DT 솔루션을 준비0.5 μg의 / ml의 농도로 멸균 식염수 독소 분말. -80 ° C에서 살균 필터 및 저장 분취. </li><li> 주입 실험 10 주 PTHcre-IDTR 마우스 - (8)을 선택합니다. 실온에서 해동 DT 분취은 복강 5 μg의 / kg (10 μL / g) 동물의 체중에 DT 관리. 최대 효율 최소 독성, DT 투여는 3 일 간격 (17)이 주입의 전체에 대해 반복된다. </li><li> 삼일 두 번째 주사 후, 각 PTHcre-IDTR / PTHcre-IDTR - mTmG 마우스에서 10 μL 꼬리 혈액을 혈액 칼슘 ++ 혈액 가스 시스템 칼슘 ++ / 산도 분석기를 사용하여 측정한다. 참고 : 우리는 피와 마우스는 칼슘 차량 주입 제어 마우스 (N = 22)의 평균보다 2SD에 해당 hypoparathyroid 마우스와 같은 ++보다 낮은 1.18 밀리몰 / L를, 이온화 정의합니다. </li></ol>

<ol>
	<li>Brandi, M. L., Brown, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Hypoparathyroidism. , (2015).</li><li>van Abel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+control+of+renal+Ca(2+)+transport+proteins+by+parathyroid+hormone.">Coordinated control of renal Ca(2+) transport proteins by parathyroid hormone.</a> Kidney Int. 68, 1708-1721 (2005).</li><li>Sebastian, E. M., Suva, L. J., Friedman, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+effects+of+intermittent+PTH(1-34)+and+PTH(7-34)+on+bone+microarchitecture+and+aortic+calcification+in+experimental+renal+failure.">Differential effects of intermittent PTH(1-34) and PTH(7-34) on bone microarchitecture and aortic calcification in experimental renal failure.</a> Bone. 43, 1022-1030 (2008).</li><li>Rodriguez-Ortiz, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+deficiency+reduces+circulating+levels+of+FGF23.">Calcium deficiency reduces circulating levels of FGF23.</a> J Am Soc Nephrol. 23, 1190-1197 (2012).</li><li>Liao, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relationship+between+Fibroblast+Growth+Factor+23+and+Biochemical+and+Bone+Histomorphometric+Alterations+in+a+Chronic+Kidney+Disease+Rat+Model+Undergoing+Parathyroidectomy.">Relationship between Fibroblast Growth Factor 23 and Biochemical and Bone Histomorphometric Alterations in a Chronic Kidney Disease Rat Model Undergoing Parathyroidectomy.</a> PloS one. 10, e0133278 (2015).</li><li>Fox, J., Care, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+low+calcium+and+low+phosphorus+diets+on+the+intestinal+absorption+of+water+in+intact+and+parathyroidectomized+pigs.">Effect of low calcium and low phosphorus diets on the intestinal absorption of water in intact and parathyroidectomized pigs.</a> Calcif Tissue Int. 31, 253-255 (1980).</li><li>Finco, D. R., Brown, S. A., Ferguson, D. C., Crowell, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+parathyroidectomy+of+the+dog.">Selective parathyroidectomy of the dog.</a> Can J Vet Res. 57, 288-292 (1993).</li><li>Can, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Parathyroid+allotransplantation+in+rabbits+without+cultivation.">Parathyroid allotransplantation in rabbits without cultivation.</a> Int J Clin Exp Med. 7, 280-284 (2014).</li><li>Dunn, T. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanoblasts+in+the+stroma+of+the+parathyroid+glands+of+strain+C58+mice.">Melanoblasts in the stroma of the parathyroid glands of strain C58 mice.</a> j Natl Cancer Inst. 10, 725-733 (1949).</li><li>Sakai, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Osteoclast+development+in+immobilized+bone+is+suppressed+by+parathyroidectomy+in+mice.">Osteoclast development in immobilized bone is suppressed by parathyroidectomy in mice.</a> J Bone Miner Metab. 23, 8-14 (2005).</li><li>Miao, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Skeletal+abnormalities+in+Pth-null+mice+are+influenced+by+dietary+calcium.">Skeletal abnormalities in Pth-null mice are influenced by dietary calcium.</a> Endocrinology. 145, 2046-2053 (2004).</li><li>Gunther, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+ablation+of+parathyroid+glands+reveals+another+source+of+parathyroid+hormone.">Genetic ablation of parathyroid glands reveals another source of parathyroid hormone.</a> Nature. 406, 199-203 (2000).</li><li>Hough, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activating+calcium-sensing+receptor+mutation+in+the+mouse+is+associated+with+cataracts+and+ectopic+calcification.">Activating calcium-sensing receptor mutation in the mouse is associated with cataracts and ectopic calcification.</a> Proc Natl Acad Sci U S A. 101, 13566-13571 (2004).</li><li>Hannan, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Calcilytic+Agent+NPS+2143+Rectifies+Hypocalcemia+in+a+Mouse+Model+With+an+Activating+Calcium-Sensing+Receptor+(CaSR)+Mutation:+Relevance+to+Autosomal+Dominant+Hypocalcemia+Type+1+(ADH1).">The Calcilytic Agent NPS 2143 Rectifies Hypocalcemia in a Mouse Model With an Activating Calcium-Sensing Receptor (CaSR) Mutation: Relevance to Autosomal Dominant Hypocalcemia Type 1 (ADH1).</a> Endocrinology. 156, 3114-3121 (2015).</li><li>Libutti, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Parathyroid+gland-specific+deletion+of+the+mouse+Men1+gene+results+in+parathyroid+neoplasia+and+hypercalcemic+hyperparathyroidism.">Parathyroid gland-specific deletion of the mouse Men1 gene results in parathyroid neoplasia and hypercalcemic hyperparathyroidism.</a> Cancer Res. 63, 8022-8028 (2003).</li><li>Bi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diphtheria+Toxin-+and+GFP-Based+Mouse+Models+of+Acquired+Hypoparathyroidism+and+Treatment+with+a+Long-Acting+Parathyroid+Hormone+Analog.">Diphtheria Toxin- and GFP-Based Mouse Models of Acquired Hypoparathyroidism and Treatment with a Long-Acting Parathyroid Hormone Analog.</a> J Bone Miner Res. , (2015).</li><li>Muzumdar, M. D., Tasic, B., Miyamichi, K., Li, L., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+global+double-fluorescent+Cre+reporter+mouse.">A global double-fluorescent Cre reporter mouse.</a> Genesis. 45, 593-605 (2007).</li><li>Buch, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Cre-inducible+diphtheria+toxin+receptor+mediates+cell+lineage+ablation+after+toxin+administration.">A Cre-inducible diphtheria toxin receptor mediates cell lineage ablation after toxin administration.</a> Nat Methods. 2, 419-426 (2005).</li><li>Dunn, T. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanoblasts+in+the+stroma+of+the+parathyroid+glands+of+strain+C58+mice.">Melanoblasts in the stroma of the parathyroid glands of strain C58 mice.</a> J Natl Cancer Inst. 10, 725-733 (1949).</li></ol>

The authors declare that they have no competing financial interests.

우리는 부갑상선에 선택적으로 GFP 발현과 유전자 변형 마우스를 사용하여 GFP 유도 부갑상선의 기술을 보여줍니다. PTHcre에서, mTmG 마우스, 이중 형광 (Cre 호텔 발현 세포 및 비 Cre 호텔에서 빨간 토마토의 녹색 GFP 세포를 표현) 명확하게 파악하고, 정확하게 갑상선을 제거하지 않고 모든 부갑상선을 제거 할 수있게. 우리는 형광 적색 비 부갑상선 조직을 식별 할 수있는 능력에 대해 이중 형광 mTmG 마우스의 사용이 선호되지만, 우리의 방법은 또한 토마토 레드 (B6.Cg-CT (ROSA) 26Sortm14 (같이 단일 형광 동물을 사용하여 잘 작동해야 CAG-tdTomato) Hze / J) 마우스입니다. 절차 수행 비교적 쉽게 마우스 당 약 20 분을 요구하고, 심각하고 지속적인 hypoparathyroid 표현형을 초래한다. 또한, GFP 양성 부갑상선의 또 다른 장점은 비정상적인 부갑상선의 검출 용이성이다. 우리의 연구는 보여쉽게 녹색 형광에 의해 우리의 마우스 모델에서 감지 B6 마우스 (그림 1)의 약 분기에 부갑상선의 mislocalization. 등 Thyro-부갑상선 반대로, 우리의 기술은 갑상선 호르몬 대체 및 칼시토닌을 생산하는 갑상선 C 세포의 제거 미지 효과 이후 필요에 갑상선의 제거를 방지한다. 형광 표지 된 부갑상선은 부갑상선의 절연을 필요로하는 다른 연구에 사용될 수 있습니다. 이 모델의 한계는 수술에 대한 요구 사항이 포함되어 있습니다. 기본 미세 기술과 형광 광원과 해부 현미경이 필요합니다. 수술 않아도 hypoparathyroid 마우스를 생성하는 제 2 기술이 설명된다. 디프테리아 PTHcre - IDTR 마우스는 온화한 부갑상선 기능 저하증의 표현형을 전시, 단순히 마우스에 복강 DT 주입이 필요 독소 처리. 중요한 부분 FOR 용량의 최적화는이 모델을했다 생성하고식이 요법을 투여. DT의 과다 복용은 독성 주도하지만 낮은 복용량은 접근의 효능을 감소. 우리는 관리 5 μg의 / kg,에서 2 주사의 용량 연대 3 일 간격, 아니 / 최소한의 사망률 신뢰할 수 있고 안정적인 저 칼슘 혈증의 결과 것으로 판단. 궁극적으로, 우리는이 두 가지 방법은 인수 부갑상선 기능 저하증에 대한 유용한 마우스 모델을 제공 할 수 있기를 바랍니다. 새로운 지속성 PTH를 사용하여, 우리는 부갑상선 기능 저하증 (17)에 대한 새로운 약물의 효능을 결정하는 이러한 모델 모두의 첫 번째 사용을보고했다.

인간의 생리 및 질병이 작은 내분비 기관의 중요성을 이해 1880 (1) 인간과 Sandström에 의해 여러 다른 종의 부갑상선의 첫 번째 체계적인 설명, 이후 지속적으로 개선되었다. 부갑상선은 부갑상선 호르몬 (PTH), 칼슘 대사의 주요 레귤레이터를 분비한다. PTH는 인산 항상성 및 골대사 1,2 중요한 호르몬이다. 목 수술 중 부갑상선의 사고 제거 또는 손상 부갑상선 기능 저하증의 가장 흔한 원인, 낮은 혈중 칼슘, 낮은 PTH 및 고가 인 1을 특징으로하는 질환이다. 더 나은 연구에 안전하고 쉽게 접근 할 수 마우스 모델이 필요 부갑상선 기능 저하증 및 테스트 새로운 치료를 인수했다. 유전 다양한 도구가이기 때문에 마우스는 널리 연구에서 사용생체 내에서 정교한 기계적인 연구를 허용하는이 종로만 제공. 수술 부갑상선 (PTX)은 래트 2, 3, 4, 5, 더 큰 포유 동물 6, 7, 8에서 사용할 수 있지만 그러나, 기술적으로 인해 동맥의 작은 크기와 그 변수 해부학 적 분포의 마우스에서 매우 도전 9. 따라서, 등 Thyro-부갑상선 (복강 내 투여)는 일반적 갑상선 부갑상선과 함께 열이 제거 된 쥐에서 수행된다. 그러나, 낮은 갑상선 호르몬이 모델을 복잡 실험 잠재적 교란 요인이된다. 또한, 칼시토닌, 설치류 칼슘 항상성에 중요한 호르몬을 생산하는 갑상선 내에서 C 세포는 또한 제의 제거시 손실yroids 11. 부갑상선 기능 저하증의 몇몇 유전자 마우스 모델은 PTH 널 마우스 (12), GCM2 널 마우스 (13)와, 칼슘 감지 수용체 (CASR) 14 (15), 활성화 돌연변이와 NUF 마우스를 포함하는 존재한다. 그러나, 이들 유전 적 결함은 이미 배아 발달 동안 존재하고, 부갑상선 기능 따라서 이미 배아 발생 동안 손상된다. 이는 골격으로 장기의 발달에 영향을 미칠 수있다. 이것은 나중에 인생에서 질병을 획득 수술 후 부갑상선 기능 저하증 환자와 대조. 또한,이 마우스 모델의 일부는 상기의 사용 12, 13, 14을 복잡 조기 치사 감소 불임을 나타낸다. 우리는 두 개의 새로운 마우스 m를 개발인수 부갑상선 기능 저하증에 대한 odels. 갑상선을 제거하지 않고 부갑상선 쉽게 제거 수술을 위해 식별 할 수 있습니다, 특히 부갑상선에서 GFP를 발현 유전자 조작 마우스를 사용. 이 마우스는 ROSA mTmG 마우스로 5.5 킬로바이트의 PTH 프로모터 (16)의 제어하에 Cre 호텔의 재조합 효소를 표현하는 PTH-Cre 호텔 마우스를 교차에 의해 생성되었습니다. 그 결과 PTHcre, mTmG 마우스는 부갑상선 세포에서 구체적으로 녹색 형광 단백질을 발현. 두번째 마우스 모델은 동일한 PTH-Cre 호텔, 부갑상선에 특히 디프테리아 독소의 수용체 발현의 결과로 유도 DTR 마우스에서 STOP 카세트를 제거하는이 시간을 사용한다. DT의 전신 투여는 동물이 수술없이 hypoparathyroid 렌더링, 부갑상선 세포를 파괴한다. 본 연구에 제시된 두 마우스 모델은 3 개월 관찰 요정 위에 안정한 hypocalcemic 표현형을 입증OD. 절차가 수행하기 쉬운, 표현형이 재현하고 hypoparathyroid 마우스는 높은 생존율 (17)을 나타낸다.

<table border="0" cellpadding="0" cellspacing="0" width="676">
	<tbody>
		<tr height="26">
			<td height="26" style="height:26px;width:188px;">ROSAmT/mG mice</td>
			<td style="width:183px;">The Jackson Laboratory</td>
			<td align="right" style="width:108px;">7676</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">PTH-Cre mice</td>
			<td style="width:183px;">The Jackson Laboratory</td>
			<td align="right" style="width:108px;">5989</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">iDTRmice</td>
			<td style="width:183px;">The Jackson Laboratory</td>
			<td align="right" style="width:108px;">7900</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">6-0 polyglactin 910 suture with needle</td>
			<td style="width:183px;">Ethicon, Inc</td>
			<td style="width:108px;">J510G</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">Safety Single Edge Razor Blades</td>
			<td style="width:183px;">American Safety Razor Company</td>
			<td style="width:108px;">66-0089</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">Disposable Scalpel</td>
			<td style="width:183px;">Feather Safety Razor Co., LTD</td>
			<td style="width:108px;">72042-11</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">Povidone-Iodine Prep Pads</td>
			<td style="width:183px;">Dynarex Corporation</td>
			<td align="right" style="width:108px;">1108</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">Ply gauze</td>
			<td style="width:183px;">Busse. Inc</td>
			<td style="width:108px;">BHD707</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">0.9% Sodium Chloride Solution</td>
			<td style="width:183px;">HOSPIRA Worldwide, Inc</td>
			<td style="width:108px;">07983-09</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">1mL 29G Insulin Syringe</td>
			<td style="width:183px;">BECTON DICKINSON</td>
			<td align="right" style="width:108px;">329622</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">Surgical Incise Drapes</td>
			<td style="width:183px;">3M</td>
			<td style="width:108px;">6640EZ</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">Dumstar Biology forceps</td>
			<td style="width:183px;">Roboz Surgical Instrument Co., Inc</td>
			<td style="width:108px;">RS-4984</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">Micro Dissecting Spring Scissors</td>
			<td style="width:183px;">Roboz Surgical Instrument Co., Inc</td>
			<td style="width:108px;">RS-5605</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">Needle Holder</td>
			<td style="width:183px;">MILTEX.,Inc</td>
			<td style="width:108px;">V98-42</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">2,2,2-Tribromethanol</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:108px;">T48402</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">2-Methyl-2-Butanol</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td align="right" style="width:108px;">152463</td>
			<td style="width:197px;">For dissolve the 2,2,2-Tribromethanol</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:188px;">Diphtheria Toxin Powder</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:108px;">D0564</td>
			<td style="width:197px;">Dissolve in 0.9% sodium chloride solution at 1mg/mL as the stock solution in -80C</td>
		</tr>
		<tr height="72">
			<td height="72" style="height:72px;width:188px;">Multicap Blood Collection Capillary tubes</td>
			<td style="width:183px;">Siemens Healthcare Diagnostics Ltd</td>
			<td align="right" style="width:108px;">855578</td>
			<td style="width:197px;">For collecting blood in iCa2+ analysis using RapidLab 348 Ca2+/pH analyzer</td>
		</tr>
		<tr height="47">
			<td height="47" style="height:47px;width:188px;">RapidLab 348 Ca2+/pH analyzer</td>
			<td style="width:183px;">Siemens Healthcare</td>
			<td style="width:108px;"></td>
			<td style="width:197px;">For iCa2+ analysis</td>
		</tr>
	</tbody>
</table>

two techniques to create hypoparathyroid mice: parathyroidectomy using gfp glands and diphtheria-toxin-mediated parathyroid ablation

Hypoparathyroidism (HP) is a disorder characterized by low levels of PTH which lead to hypocalcemia, hyperphosphatemia, and low bone turnover. The most common cause of the disease is accidental removal of the parathyroid glands during thyroid surgery. Novel therapies for HP are needed, but testing them requires reliable animal models of acquired HP. 
Here, we demonstrate the generation of two mouse models of acquired HP. In the GFP-PTX model, mice with green fluorescent protein (GFP) expressed specifically in the parathyroids (PTHcre-mTmG) were created by crossing PTHcre+ mice with Rosa-mTmGfl/fl mice. Green fluorescing parathyroid glands are easily identified under a fluorescence dissecting microscope and parathyroidectomy is performed in less than 20 min. After fluorescence-guided surgery, mice are profoundly hypocalcemic. Contrary to the traditional thyro-parathyroidectomy, this precise surgical approach leaves thyroid glands and thyroid function intact. The second model, which does not require surgery, is based on a diphtheria-toxin approach. PTHcre-iDTR mice, which express the diphtheria toxin (DT) receptor specifically in the parathyroids, were generated by crossing the inducible DTR mouse with the PTHcre mouse. Parathyroid cells are thus rendered sensitive to diphtheria toxin (DT) and can be selectively destroyed by systemically injecting mice with DT. The resulting hypocalcemic phenotype is stable.

부갑상선의 위치 형광 해부 현미경으로 관찰 첫째, 우리는 54 PTHcre-mTmG 마우스의 부갑상선의 분포를 기록했다. 74 %는 (54분의 40) 마우스는 26 % (54분의 14) 쥐가 추가로 세 번째 부갑상선 (그림 1B, D, F)을 가지고 두 개의 녹색 부갑상선 (그림 1A, C, E)를했다. 단일 선 또는 세 개 이상의 땀 샘을 더 마우스는 관찰되지 않았다. 일반적으로, 부갑상선은 갑상선 (58 %, 122분의 71의 우수한 국경 근처에 위치하고도 1A (1,2), B (1,2), C (2), D (1,2), E를 (2), F (3)). 27 % (122분의 33) 분비가 갑상선의 열등한 국경 근처에 위치했다 (그림 1C (1), D (3), F (1)), 13 % (1백22분의 16)를 멀리 t에서 위치했다hyroid 선 (도 1B (3) E (1), F (2)). 우리의 연구 결과와 일치하고 부갑상선 (20)의 위치를 변화의 이전 연구 결과를 확장 할 수 있습니다. GFP-PTX 마우스 피부 절개를 폐쇄에 마취에서 전체 수술은 마우스 당 약 20 분 걸렸다. 3 개월의 관찰 기간 동안 수술 후 마우스의 생존율은 96.3 % (55분의 53)이었다. 92.4 % (53분의 49) GFP-PTX 마우스는이 SD 허위 작동 대조군 이하의 평균 하회 이온화 칼슘 농도를 나타내었다. GFP의-PTX 마우스 (저 칼슘 혈증, 낮은 PTH 및 혈청 인산)의 hypoparathyroid 표현형 3 개월의 전체 관측 시간 동안 안정 하였다. 중요한 것은, 갑상선 기능은 42 ± 24 대 = 3개월 수술 (TSH 후 가짜 운영 동물에서 차이가 없었다 (30) ± 15를 mU / L, P = 0.171; T4 = 30.0 ± 0.6 대 3.1 ± 0.9 μg의 / dL로, P = 0.707 (그림 2). PTH-CRE-IDTR 마우스 DT는 PTH-Cre 호텔 - IDTR 마우스를 개발 부갑상선 기능 저하증 (낮은 혈중 이온화 칼슘, 혈중 인, 그리고 부적절하게 낮은 정상 PTH 수준)을 주입. 우리는 이전에 측정 순환 PTH 이러한 마우스 (17)의 때문에 다소 온화한 표현형을 설명하는 몇 PTH 양성 세포는 디프테리아 독소에 의해 절제를 피할 것으로보고있다. GFP-PTX 마우스와 PTH-CRE-IDTR 마우스에서 부갑상선 기능 저하증 중요한 혈액의 Ca ++ 감소 및 혈청 PTH 수준은 모의 - 조작 된 마우스에서 발견 레벨 중 (Ca ++ = 1.05 ± 0.40 대에 비해 3 일 수술 후 GFP-PTX 마우스에서 관찰 </em&gt; 1.30 ± 0.03 밀리몰 / L, P &lt;0.05; PTH = 32 ± 22 대 580 ± 137 PG / ㎖, p &lt;0.05). 부갑상선 기능 저하증의 표현형은 3 개월의 관찰 기간 동안 안정 하였다 (그림 3A, 허가 (참조 # 17 재 인쇄)). 삼일 간격 최대 hypoparathyroid 표현형을 수득 DT의 최소량을 사용하여 최적 투여 량 및 요법에서 5 μg의 / kg DT 2 주사 후, DT는 PTH-CRE-IDTR의 마우스에 비해 유의 한 저 칼슘 혈증 및 감소 PTH 하였다 주입 90 일의 관찰 기간 내내 지속 차량 제어 마우스 중 (Ca ++ = 1.10 ± 0.07 밀리몰 / L 대 1.26 ± 0.05 밀리몰 / L, p &lt;0.05 = 218 ± 156 pg / ml 인 대 572 ± 164 PG PTH / mL로, P &lt;0.05) (그림 (b), (참조 번호 (17)로부터 허가 재판)). <img alt="그림 1" src="/files/ftp_upload/55010/55010fig1.jpg" /> 그림 1 : <st룽&gt; 형광 해부 현미경 하에서 54 PTHcre-mTmG 마우스의 부갑상선의 다양한 위치의 대표 이미지. 마우스 중 하나를 두 개 (A, C, E) 또는 세 (B, D, F) 녹색 부갑상선했다. 대부분의 부갑상선이 우수한 국경 근처에 위치했다 (A (1,2), B (1,2), C (2), D (1,2), E (2), F (3) 또는 가까운 하부 경계 갑상선의 (C는 (1), D는 (3), F는 (1)). 드문 경우에, 일부는 ectopically에 있었다 (B (3), E (1), F (2)). <a href="http://ecsource.jove.com/files/ftp_upload/55010/55010fig1large.jpg" target="_blank">여기를 클릭하십시오 이 그림의 더 큰 버전을 볼 수 있습니다.</a> <img alt="그림 2" src="/files/ftp_upload/55010/55010fig2.jpg" /> 그림 2 : TSH 및 GFP-PTX 마우스의 T4 수준. 3개월 GFP-PTX 후, 혈청 TSH와 T4의 measurem에 대한 얻었다<html> 엔트. GFP-PTX는 마우스 TSH 농도 (42 ± 24를 mU / L) (A)와 T4 농도를 보였다 (3.0 ± 0.6 μg의 / dL 이상) 제어 마우스 (TSH = 30 ± 15를 mU / L, P 차이가 없었다 (B) = 0.171, N = 11, T4 = 3.1 ± 0.9, P = 0.707, N = 11). <a href="http://ecsource.jove.com/files/ftp_upload/55010/55010fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/55010/55010fig3.jpg" /> 그림 3 : GFP - PTX 마우스의 혈액 칼슘 ++ 및 PTH 수준 및 DT는 PTH-CRE-IDTR 마우스를 주조. (재 인쇄 - (*** p &lt;0.001, 8 N = 6)은 모두 GFP-PTX 마우스 (A) 및 DT는 PTH--IDTR CRE 안정한 저 칼슘 혈증을 나타내 마우스 (B)을 주입 3 개월간 관찰 기간 PTH의 수준을 저하 참조 # 17)에서 권한.에스 / ftp_upload / 55010 / 55010fig3large.jpg &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Watch this Scientific Journal Video about Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation at JoVE.com

Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation

Mice with acquired hypoparathyroidism would be useful for studying novel drug therapies for hypoparathyroidism. Two procedures to create such mice are demonstrated. The GFP-PTX mouse is generated by surgical parathyroidectomy guided by green fluorescing parathyroid glands. A second, non-surgical approach is based on parathyroid-specific expression of the diphtheria toxin receptor.

Hypoparathyroid 마우스를 만드는 두 기술 : 부갑상선 GFP 땀샘과 디프테리아 독소 매개 부갑상선 절제술을 사용하여

Hypoparathyroidism (HP) is a disorder characterized by low levels of PTH which lead to hypocalcemia, hyperphosphatemia, and low bone turnover. The most ...

two-techniques-to-create-hypoparathyroid-mice-parathyroidectomy-using

Research

JoVE Journal

Medicine

14.4K 조회수.  Harvard Medical School. Mice with acquired hypoparathyroidism would be useful for studying novel drug therapies for hypoparathyroidism. Two procedures to create such mice are demonstrated. The GFP-PTX mouse is generated by surgical parathyroidectomy guided by green fluorescing parathyroid glands. A second, non-surgical approach is based on parathyroid-specific expression of the diphtheria toxin receptor.

비디오: Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation

Inducing Myointimal Hyperplasia Versus Atherosclerosis in Mice: An Introduction of Two Valid Models

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque formation and stenosis, as observed for example in ischemic heart disease. Two highly reproducible mouse models&#160;&#8211;&#160;both resulting in artery stenosis but each underlying a different pathway of development&#160;&#8211; are introduced here. The models represent the two most common causes of artery stenosis; namely one mouse model for each myointimal hyperplasia, and atherosclerosis are shown. To induce myointimal hyperplasia, a balloon catheter injury of the abdominal aorta is performed. For the development of atherosclerotic plaque, the ApoE -/- mouse model in combination with western fatty diet is used. Different model-adapted options for the measurement and evaluation of the results are named and described in this manuscript. The introduction and comparison of these two models provides information for scientists to choose the appropriate artery stenosis model in accordance to the scientific question asked.

This video shows two models of intimal plaque development in murine arteries and emphasizes the differences in myointimal hyperplasia and atherosclerosis.

쥐에서 동맥 경화 수스 Myointimal 증식을 유도 : 두 개의 유효한 모델의 소개

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque ...

연구

의학

Acute Brain Trauma in Mice Followed By Longitudinal Two-photon Imaging

Although acute brain trauma often results from head damage in different accidents and affects a substantial fraction of the population, there is no effective treatment for it yet. Limitations of currently used animal models impede understanding of the pathology mechanism. Multiphoton microscopy allows studying cells and tissues within intact animal brains longitudinally under physiological and pathological conditions. Here, we describe two models of acute brain injury studied by means of two-photon imaging of brain cell behavior under posttraumatic conditions. A selected brain region is injured with a sharp needle to produce a trauma of a controlled width and depth in the brain parenchyma. Our method uses stereotaxic prick with a syringe needle, which can be combined with simultaneous drug application. We propose that this method can be used as an advanced tool to study cellular mechanisms of pathophysiological consequences of acute trauma in mammalian brain in vivo. In this video, we combine acute brain injury with two preparations: cranial window and skull thinning. We also discuss advantages and limitations of both preparations for multisession imaging of brain regeneration after trauma.

Acute brain trauma is a severe injury that has no adequate treatment to date. Multiphoton microscopy allows studying longitudinally the process of acute brain trauma development and probing therapeutical strategies in rodents. Two models of acute brain trauma studied with in vivo two-photon imaging of brain are demonstrated in this protocol.

세로 두 광자 이미징 다음 마우스의 급성 뇌 외상

Although acute brain trauma often results from head damage in different accidents and affects a substantial fraction of the population, there is no ...

Robotic Ablation of Atrial Fibrillation

Background: Pulmonary vein isolation (PVI) is an established treatment for atrial fibrillation (AF). During PVI an electrical conduction block between pulmonary vein (PV) and left atrium (LA) is created. This conduction block prevents AF, which is triggered by irregular electric activity originating from the PV. However, transmural atrial lesions are required which can be challenging. Re-conduction and AF recurrence occur in 20 - 40% of the cases. Robotic catheter systems aim to improve catheter steerability. Here, a procedure with a new remote catheter system (RCS), is presented. Objective of this article is to show feasibility of robotic AF ablation with a novel system. Materials and Methods: After interatrial trans-septal puncture is performed using a long sheath and needle under fluoroscopic guidance. The needle is removed and a guide wire is placed in the left superior PV. Then an ablation catheter is positioned in the LA, using the sheath and wire as guide to the LA. LA angiography is performed over the sheath. A circular mapping catheter is positioned via the long sheath into the LA and a three-dimensional (3-D) anatomical reconstruction of the LA is performed. The handle of the ablation catheter is positioned in the robotic arm of the Amigo system and the ablation procedure begins. During the ablation procedure, the operator manipulates the ablation catheter via the robotic arm with the use of a remote control. The ablation is performed by creating point-by-point lesions around the left and right PV ostia. Contact force is measured at the catheter tip to provide feedback of catheter-tissue contact. Conduction block is confirmed by recording the PV potentials on the circular mapping catheter and by pacing maneuvers. The operator stays out of the radiationfield during ablation. Conclusion: The novel catheter system allows ablation with high stability on low operator fluoroscopy exposure.

Pulmonary vein isolation (PVI) with an ablation catheter is a curative treatment for atrial fibrillation (AF). Robotic catheter systems aim to improve catheter steerability. Here, a procedure with a new robotic catheter system is presented. The goal of the procedure is electrical block between pulmonary vein and left atrium.

심방 세동의 로봇 절제

Background: Pulmonary vein isolation (PVI) is an established treatment for atrial fibrillation (AF). During PVI an electrical conduction block between ...

A Simple Mechanical Procedure to Create Limbal Stem Cell Deficiency in Mouse

Limbal stem cell deficiency (LSCD) is a state of malfunction or loss of limbal epithelial stem cells, after which the corneal epithelium is replaced with conjunctiva. Patients suffer from recurrent corneal defects, pain, inflammation, and loss of vision.
Previously, a murine model of LSCD was described and compared to two other models. The goal was to produce a consistent mouse model of LSCD that both mimics the phenotype in humans and lasts long enough to make it possible to study the disease pathophysiology and to evaluate new treatments. Here, the technique is described in more detail.
A motorized tool with a rotating burr has been designed to remove the rust rings from the corneal surface or to smooth the pterygium bed in patients. It is a suitable device to create the desired LSCD model. It is a readily available, easy-to-use tool with a fine tip that makes it appropriate for working on small eyes, as in mice. Its application prevents unnecessary trauma to the eye and it does not result in unwanted injuries, as often is the case with chemical injury models. As opposed to a blunt scraper, it removes the epithelium with the basement membrane. In this protocol, the limbal area was abraded two times, and then the whole corneal epithelium was shaved from limbus to limbus. To avoid stroma injury, care was taken not to brush the corneal surface once the epithelium was already removed.

The following article provides an easy, reproducible technique to effectively create a sustainable mouse model of limbal stem cell deficiency (LSCD). This animal model is useful in testing and comparing the efficacy of treatments for limbal stem cell diseases.

간단한 기계 절차 마우스에서 윤부 줄기 세포 결핍을 만드는 방법

Limbal stem cell deficiency (LSCD) is a state of malfunction or loss of limbal epithelial stem cells, after which the corneal epithelium is replaced with ...

Techniques of Sleeve Gastrectomy and Modified Roux-en-Y Gastric Bypass in Mice

Obesity is a major public health issue, with a prevalence of 4 to 28% for men and 6.2 to 36.5% for women in Europe (from 2003 to 2008). Morbid obesity is frequently associated with metabolic complications, such as type 2 diabetes, hypertension, and dyslipidemia, reducing life expectancy and quality. In the absence of any effective noninvasive treatments, bariatric surgery is a valuable therapeutic option for patients with morbid obesity (body mass index (BMI) &#62;40 kg/m2), leading to long-term, sustained weight loss and improvements in metabolic complications. However, the underlying cellular and molecular mechanisms sustaining the beneficial effects of bariatric surgery are not yet fully understood. Due to the numerous genetically-modified strains available, the mouse model is the most convenient animal model to explore the molecular mechanisms behind the pleiotropic beneficial effects of bariatric surgeries. Here, we detailed the optimized healthcare methods and surgical protocols in mice for the two most widely-used bariatric surgeries: the sleeve gastrectomy and the modified Roux-en-Y gastric bypass. Deciphering the molecular mechanisms underlying the therapeutic effects of bariatric surgeries offers the promise of identifying new therapeutics targets.

Bariatric surgery is the most efficient way to reduce body weight and the deadly metabolic complications (diabetes, obesity, and dyslipidemia) frequently associated with morbid obesity. Mouse models of bariatric surgery represent a unique asset for deciphering molecular mechanisms behind the beneficial effects of these surgeries on diabetes, hypertension, and dyslipidemia.

소매 절제술의 기술 및 쥐에서 Roux-EN-Y 위장 바이 패스를 수정

Obesity is a major public health issue, with a prevalence of 4 to 28% for men and 6.2 to 36.5% for women in Europe (from 2003 to 2008). Morbid obesity is ...

In Vivo Imaging of Cx3cr1gfp/gfp Reporter Mice with Spectral-domain Optical Coherence Tomography and Scanning Laser Ophthalmoscopy

Spectral domain optical coherence tomography (SD-OCT) and scanning laser ophthalmoscopy (SLO) are extensively used in experimental ophthalmology. In the present protocol, mice expressing green fluorescent protein (gfp) under the promoter of Cx3cr1 (BALB/c-Cx3cr1gfp/gfp) were used to image microglia cells in vivo in the retina. Microglia are resident macrophages of the retina and have been implicated in several retinal diseases1,2,3,4,5,6. This protocol provides a detailed approach for generation of retinal B-scans, with SD-OCT, and imaging of microglia cell distribution in Cx3cr1gfp/gfp mice with SLO in vivo, using an ophthalmic imaging platform system. The protocol can be used in several reporter mouse lines. However, there are some limitations to the protocol presented here. First, both SLO and SD-OCT, when used in the high-resolution mode, collect data with high axial resolution but the lateral resolution is lower (3.5 &#181;m and 6 &#181;m, respectively). Moreover, the focus and saturation level in SLO is highly dependent on parameter selection and correct alignment of the eye. Additionally, using devices designed for human patients in mice is challenging due to the higher total optical power of the mouse eye compared to the human eye; this can lead to lateral magnification inaccuracies7, which are also dependent on the magnification by the mouse lens among others. However, despite that the axial scan position is dependent upon lateral magnification, the axial SD-OCT measurements are accurate8.

In Vivo Imaging of Cx3cr1gfp/gfp Reporter Mice with Spectral-domain Optical Coherence Tomography and Scanning Laser Ophthalmoscopy

This protocol describes how high-resolution imaging techniques such as spectral domain optical coherence tomography and scanning laser ophthalmoscopy can be utilized in small rodents, using an ophthalmic imaging platform system, to obtain information on retinal thickness and microglial cell distribution, respectively.

Vivo에서 스펙트럼-도메인 광학 일관성 단층 촬영 스캐닝 레이저 Ophthalmoscopy와 Cx3cr1gfp/gfp 기자 쥐의 이미징

Spectral domain optical coherence tomography (SD-OCT) and scanning laser ophthalmoscopy (SLO) are extensively used in experimental ophthalmology. In the ...

Ablation of Ischemic Ventricular Tachycardia Using a Multipolar Catheter and 3-dimensional Mapping System for High-density Electro-anatomical Reconstruction

Ventricular tachycardia (VT) in patients with ischemic cardiomyopathy mainly results from endocardial scars after myocardial infarction; those scars represent zones of slow conduction that allow the occurrence and maintenance of reentrant circuits. Catheter ablation enables substrate modification of those low voltage areas and thus can help to alter the scar tissue in such a way that arrhythmias cannot appear anymore. Hospitalizations of concerned patients decrease, quality of life and outcome rise. Consequently, VT ablation represents a growing field in electrophysiology, especially for patients with endocardial scars in ischemic heart disease after myocardial infarction. However, ablation of ventricular tachycardia remains one of the most challenging procedures in the electrophysiology lab. Precise scar definition and localization of abnormal potentials are critical for ablation success. The following manuscript describes the use of a multipolar mapping catheter and 3-dimensional (3D) mapping system to create a high density electro-anatomical map of the left ventricle including a precise scar representation as well as mapping of fractionated and late potentials in order to allow a highly accurate substrate modification.

With the following protocol, we provide an approach to Ventricular Tachycardia (VT) ablation using high density mapping with a multipolar catheter and 3D mapping system enhancing the success of the procedure.

Ventricular tachycardia (VT) in patients with ischemic cardiomyopathy mainly results from endocardial scars after myocardial infarction; those scars ...

Protocol to Create Chronic Wounds in Diabetic Mice

Chronic wounds develop as a result of defective regulation in one or more complex cellular and molecular processes involved in proper healing. They impact ~6.5M people and cost ~$40B/year in the US alone. Although a significant effort has been invested in understanding how chronic wounds develop in humans, fundamental questions remain unanswered. Recently, we developed a novel mouse model for diabetic chronic wounds that have many characteristics of human chronic wounds. Using db/db-/- mice, we can generate chronic wounds by inducing high levels of oxidative stress (OS) in the wound tissue immediately after wounding, using a one-time treatment with inhibitors specific to the antioxidant enzymes catalase and glutathione peroxidase. These wounds have high levels of OS, develop biofilm naturally, become fully chronic within 20 days after treatment and can remain open more for more than 60 days. This novel model has many features of diabetic chronic wounds in humans and therefore can contribute significantly to advancing fundamental understanding of how wounds become chronic. This is a major breakthrough because chronic wounds in humans cause significant pain and distress to patients and result in amputation if unresolved. Moreover, these wounds are very expensive and time-consuming to treat, and lead to significant loss of personal income to patients. Advancements in this field of study through the use of our chronic wound model can significantly improve health care for millions who suffer under this debilitating condition. In this protocol, we describe in great detail the procedure to cause acute wounds to become chronic, which has not been done before.

Chronic wounds are developed from acute wounds on a diabetic mouse model by inducing high levels of oxidative stress after a full-thickness cutaneous wound. The wound is treated with inhibitors for catalase and glutathione peroxidase, resulting in impaired healing and biofilm development by bacteria present in the skin microbiome.

당뇨병 마우스에서 만성 상처를 만드는 프로토콜

Chronic wounds develop as a result of defective regulation in one or more complex cellular and molecular processes involved in proper healing. They impact ...

Two-Dimensional X-Ray Angiography to Examine Fine Vascular Structure Using a Silicone Rubber Injection Compound

Angiography is an essential tool for the study of vascular structures in various research fields. The aim of this study is to introduce a simple angiographic method for examining the fine vascular structure of unfixed, fresh tissue using a silicone rubber injection compound and soft tissue X-ray system. This study is especially focused on flap territories used in reconstructive surgery. This study employs angiography with a silicone rubber injection compound in various experimental conditions using Sprague-Dawley rats. First, 15 mL of MV compound and 15 mL of diluent is mixed. Then, 1.5 mL of the curing agent is prepared, and a 24G catheter is cannulated in the common carotid artery of the rat. A three-way stopcock is then connected to a catheter, and the radiopaque agent, after being mixed with the prepared curing agent, is injected immediately without spillage. Finally, as the agent solidifies, the specimen is harvested, and an angiographic image is obtained using a soft tissue X-ray system. This method indicates that high-quality angiography showing fine vascular structures can be easily and simply obtained within in a short period of time.

This study presents a simple two-dimensional angiographic method to examine fine vascular structures using a silicone rubber injection compound and soft tissue X-ray system.

2 차원 x-선 혈관 실리콘 고무 사출 화합물을 사용 하 여 미세 혈관 구조를 검사 하

Angiography is an essential tool for the study of vascular structures in various research fields. The aim of this study is to introduce a simple ...

Sleeve Gastrectomy in Mice using Surgical Clips

The number of people who are overweight and obese is continually increasing both in the adult and adolescent populations. This coincides with the increased universal phenomenon of type 2 diabetes (T2D) and other metabolic problems. Bariatric surgery, such as SG, is currently one of the most effective and commonly used long-term treatment for obesity and T2D, but the association between them is not completely explored yet. The mechanisms underlying the outcomes seen after bariatric surgery in humans can be investigated based on preclinical animal studies. The SG reduces body weight, glucose levels and many metabolic parameters, and is easy to perform with a low incidence of complications. The goal of this work is to provide a simple method and an uncomplicated preclinical model of bariatric surgery in animals for researchers.

The prevalence of diabetes and obesity is continuously increasing worldwide. The mechanisms between diabetes, obesity and their associated mortality and co-morbidities need to be further investigated. Here, we present a protocol for sleeve gastrectomy (SG) in animals as an uncomplicated preclinical model of bariatric surgery.