이 연구는 OU-WB ISCRM, 오클랜드 대학과 미시간 머리와 척추 연구소에 의해 지원되었다. N 비라볼루와 C 맥키 오클랜드 대학에서 학장 대학원 연구 상을 수상했다. 우리는 원고를 검토하는 S 박시 주셔서 감사합니다.

시료 (N = 3)에 의한 동의 한 후, 버몬트 병원 바이오 뱅크, 로얄 오크, MI 및 병원 프로비던스 사우스 필드 통해 건강한 기증자 MI IRB # 820662- HIC- (HIC 번호 2012-101)와 IRB- (이하 3) 각각의 프로토콜을 승인 오클랜드 대학, 로체스터, MI의 IBC (# 2858)에 의해 승인 된 바와 같이 처리된다. 1. 인간 제대 가공 코드, 코드 - 태반 정션 태아 태반 세포 단리 <ol><li> CPJ 접속 6cm 3 - - FP의 4cm 무균는 UC 5 포함한 길이 약 10 ㎝의 샘플을 수집한다. 즉시 수거 컵 함유 배지에서 각각의 샘플을 배치 (DMEM 4,500 ㎎ / ㎖ 글루코스와 항생제 용액 (0.1 % 젠타 마이신 0.2 % 스트렙토 마이신 및 0.12 % 페니실린)으로) 39 ° C에서 저장 그것은하여 실험실로 운반 될 때까지 스티로폼 상자에 얼음에 배치. 콜렉션의 4 시간 - 2에서 4 ° C에서 샘플을 처리합니다. </li><li> 150 mm 배양 접시에 시료를 장소에 보관바이오 안전성 캐비닛에 얼음. 바늘과 주사기를 사용하여 혈전을 제거하기 위해 얼음처럼 차가운 PBS로 여러 번 씻어. 샘플을 처리하는 동안 PBS로 젖은 유지하고 건조하지 않도록합니다. , 불임을 유지 샘플 처리를 통해 멸균 PBS 및 수술 도구를 사용하여 샘플 무균 처리합니다. </li><li> 조심스럽게 다른 해부학 적 영역을 식별하기 위해 샘플을 검사 : UC, CPJ 및 FP를. 먼저 UC를 해부. 집게와 UC의 태아의 끝을 잡고 조심스럽게 바로 가위를 사용하여 CPJ의 상단에있는 첫 번째 컷을합니다. 나 PF에서 - (2.0 cm 1.5)을 CPJ 아래의 두 번째 컷은 CPJ을 분리합니다. 추가 처리를 위해 별도의 배양 접시에있는 분리 UC, CPJ 및 FP를 놓는다. </li><li> 완전히 혈관을 노출하고 상피를 방해하지 않고 WJ 주변, 가위와 집게의 도움으로 길이 방향으로 UC를 잘라. </li><li> 혈관과 subamnion의 내부 상피에서 떨어진 WJ을 다 쳤어요메스를 사용하고 혈관을 제거합니다. 아래 및 혈관 주위에 남아있는 혈관 주위의 WJ를 수집하고 별도의 배양 접시에서 수집 된 WJ를 배치해야합니다. </li><li> 별도의 배양 접시에 남아있는 조직 라이닝 코드 (CL)을 수집한다. </li><li> CL, WJ, CPJ 및 FP를 나타내는 조직을 분리 한 후, (3)으로 PBS를 교체 - 상업용 트립신 용액 5 ㎖와 별도로 가위를 사용하여 2 mm 조각으로 1-에 각 조직을 잘라. </li><li> 샘플의 부분 소화 5 % CO 2 인큐베이터에서 30 분 동안 37 ℃에서 상업용 트립신 용액에 조직 조각을 인큐베이션. 위상차 현미경을 이용한 세포의 분리를 시각화하여 부분 소화를 관찰한다. </li><li> 10 % 사람 혈청 / FBS와 항생제 용액 (0.1 % 젠타 마이신 0.2 % 스트렙토 마이신이 보충 된 4,500 ㎎ / ㎖ 글루코스, 2 mM의 L- 글루타민으로 DMEM 상기 부분적 절단 샘플을, 배양 배지 (CM 동량을 추가 그리고 0.12 %의 Penicillin)) 상용 트립신 용액을 중화한다. 50 mL의 원심 분리 튜브로 콘텐츠를 전송하고, 부분적으로 분해 된 조직 조각을 3 분 동안 정착하자. </li><li> 조심 단셀 (이들이 효과적으로 확장되지 않음)를 포함하는 상등액을 흡인하고, 플레이트 15 - 75 cm 2 조직 배양 플라스크에 20 부분적으로 분해 된 조직 조각과 CM 9 mL를 첨가. 37 ° C에서 품어 2의 배양 플라스크를 방해하지 않습니다 - 조직 조각의 준수 수 있도록 삼일. 주 : 부분적으로 분해 된 조직 샘플의 나머지 부분은 미래 셀 분리 용 냉동 보존 될 수있다. </li><li> 배양 3 일 후, CM을 변경하고 매일의 절편에서 세포의 부산물의 모습을 찾아; 사일 7 - - 십일, 11 - 각각 CPJ, CL / WJ 및 FP, 배양 14 일 세포 성장 3 후 접착 이식편으로부터 명백 할 것이다. 이후이 시점에서, 매 3 일 후 또는 형상을 변경필요했습니다. 참고 : - 열흘 절편에서 초기 셀 파생물 후 세포 성장 7 70 %의 합류에 도달합니다. 그들은 플라스틱을 준수 할 때까지 비 접착 조직 조각 셀 파생물을 초래하지 않습니다. 플라스크가 부착 조직 조각의 분리를 방지하기 위해 방해되지 않도록주의를 기울여야한다. 배양의 처음 3 일 후 부동 조각이있는 경우, 그들은 첨부 파일에 대한 새로운 플라스크로 전송에 의해 구출 될 수 있었다. 참고 : 조직 외식에서 세포 성장이 70 %의 합류에 도달하면, 그들은 계대 배양해야한다. 각각 24 일 - 14 일 14 - - 20일, 17 전술 한 바와 같이, CL / WJ, FP, CPJ에서 중간 엽 줄기 세포는 10에서 합류에 도달한다. </li><li> 외식 능가로부터 세포를 배양하기 위해 하나를 사용하여 세포를 해리 - 상업용 트립신 용액 / 75 cm-2 배양 플라스크 2 ㎖를 3 분 동안 37 ℃에서 배양한다. CM 2 mL의 원심 3 분 동안 1,500 XG 1 - 중화. 하다심지어 전반에 걸쳐 확산 트립신을 추가하는 동안 플라스크를 회전해야합니다. </li><li> 주 : 펠렛 세포 통로 0 (P0)으로 간주되고, CM에 현탁 계산되며, 증폭, 특성화하고, 동결 보존 된 1 × 10 4 / cm 2의 시딩 밀도 계대. 초과 세포는 P0에서 동결 보존 할 수 있습니다. </li></ol> 2. 분리 된 세포를 특성화 <ol><li> 콜로니 형성 효율 (CFE) 분석 <ol><li> 코트 37 ° C에서 CO 2 인큐베이터에서 100 mm 페트리 접시에서 30 분 동안 0.1 % 젤라틴 (2 60cm의 면적) 및 배치합니다. 참고 : 필요하지, 젤라틴 코팅이 세포 부착을 향상 있지만. </li><li> 과량의 젤라틴을 제거하고 / cm 2 1.63 세포의 농도 P0 세포 도장 판 시드. 3 ㎖ CM의 추가 37 ° C에서 CO 2 인큐베이터에서 배양한다. </li><li> 클론 성장을위한 시드 판을 모니터광 현미경 (LM)에 의해 3 일마다 배지를 변경. </li><li> 이후 10 - 세포 성장을 14 일간 실온에서 30 분 동안 4 % 파라 포름 알데히드로 세포를 PBS로 두 번 페트리 설거지 및 고정. 참고 : 파라 포름 알데히드는 독성이있다. 사용하는 동안 장갑과 안경을 착용하여주의를 실천하십시오. </li><li> 실온에서 1 시간 동안 0.1 % 크리스탈 바이올렛으로 세포를 고정 및 염색 바운드 푸른 기미가 없어까지 수돗물로 헹구어 플레이트. </li><li> LM을 이용하여 적어도 50 개 세포로 이루어지는 콜로니 수를 카운트. </li></ol></li><li> 세포 표면 마커의 발현 <ol><li> 배양은 70 % 합류로 분리 된 세포는 상업적 트립신 용액으로 해리, 3 분 동안 1,500 XG에서 원심 분리하여 세척하고 펠릿. (2 % FBS와 0.1 % 나트륨 아 지드와 1X PBS) FACS 완충액에 세포를 일시. 참고 : 아 지드 화 나트륨은 독성이있다. 사용하는 동안 장갑과 안경을 착용하여주의를 실천하십시오. </li><li30 분 동안 FACS 완충액&gt; (CD29, CD73 및 CD105 : 대 CD44 및 CD90 또는 APC 접합 된 항체에 대한 FITC - 접합 된 항체) FITC- 또는 APC 표지 MSC 특이 항체 세포 (~ 10 6) 얼룩 어둠 속에서 39 ° C. </li><li> 5 분 동안 670 XG에서 염색 된 세포를 원심 분리하여 상등액을 흡인하고, FACS 완충액 500 μL에 세포를 재현 탁. </li><li> 제조 업체의 프로토콜에 따라 FACS를 이용하여 항체 염색 된 세포를 분석 할 수 있습니다. </li></ol></li></ol> 3. 차별화 가능성 <ol><li> 지방 세포 분화 <ol><li> 배양은 70 % 합류로 분리 된 세포는 상업적 트립신 용액으로 해리, 3 분 동안 1,500 XG에서 원심 분리하여 세척하고 펠릿. </li><li> 37 ℃에서 CO2 인큐베이터에서 배양 10 개 세포의 농도로 세포 / 웰의 CM 2 mL를 함유하는 6- 웰 플레이트. </li><li> 24 시간 후, adipog와 CM 교체enic 분화 배지 (0.5 μM 이소 부틸 메틸 크, 1 μM 덱사메타손, 10 μM 인슐린, 200 μM 인도 메타 신)과 배양한다. 3 일마다 차별화 매체를 변경하거나 자주 필요에. </li><li> 배양 3 주 후 지방 세포 분화를 분석하기 위해 지질 소적의 생산을 검출하는 오일 레드 O 실온 얼룩에서 30 분 동안 웰당 4 % 파라 포름 알데히드 2 mL로 세포를 고정한다. 참고 : 파라 포름 알데히드는 독성이있다. 사용하는 동안 장갑과 안경을 착용하여주의를 실천하십시오. </li><li> 5 분 동안 60 % 이소프로판올 (6- 웰 플레이트에 2 ㎖ / 웰)와 함께 고정 된 세포를 취급한다. </li><li> 오일 레드 O 염색 2 ㎖ (필터 3 부를 오일 레드 O 염색과 2 부를 증류수)과 이소프로판올을 바꾸고, 실온에서 15-30 분 동안 배양하고, 3 워시 - 어떤 결합되지 않은 얼룩을 제거하는 수돗물로 4 회 . </li><li> , U를 지방 세포 세포의 혈통을 나타내는 빨간색 염색 지질 방울을 시각화LM 노래. </li></ol></li><li> 연골 분화 <ol><li> 70 % 합류에 절연 배양 세포는 상업적 트립신 용액으로 해리하고 PBS로 세척한다. </li><li> 8 분 동안 11,000 XG에서 연골 유도 원심 CM 2 mL를 15 mL의 원심 분리 튜브에서 250,000 세포 펠렛 세포. 밤새 37 ° C에서 펠릿을 인큐베이션. </li><li> 24 시간 후, 부드럽게 펠렛을 방해하지 않고 연골 세포 분화 배지 (TGFβ1 NG 20, 10 ng의 인슐린, 덱사메타손 100 나노 미터, 100 μM 아스코르브 산)과 CM을 대체하고 배양을 계속한다. 3 일마다 차별화 매체를 변경하거나 자주 필요에. </li><li> 배양 3 주 후, 실온에서 30 분 동안 웰당 4 % 파라 포름 알데히드 2 mL로 세포를 고정한다. 1 % 톨루이딘 블루 염색 동결 절단 (Cryosections)과 연골 세포의 분화를 확인하기 위해 세포 외 매트릭스의 존재 또는 생산을 검토한다. 참고 : 아빠raformaldehyde 독성이다. 사용하는 동안 장갑과 안경을 착용하여주의를 실천하십시오. </li><li> 냉동 절편 들어 부드럽게 PBS로 두 번 수확 된 세포 펠렛을 세척하고, 실온에서 30 분 동안 4 % 파라 포름 알데하이드 1 mL로 고정한다. 참고 : 파라 포름 알데히드는 독성이있다. 사용하는 동안 장갑과 보안경을 착용하여주의를 실천하십시오. </li><li> 파라 포름 알데히드를 제거하고, 수 크로스 / 간섭 단층 솔루션에 전송하는 PBS로 두 번 씻어 펠렛 (1 : 2, 20 % 자당 : 2009 년 10 월). 용액을 완전히 세포 펠렛으로 침투 할 수 있도록 24 시간 동안 실온에서 인큐베이션; 이 부드러운 절편을 수 있습니다. </li><li> OCT를 금형에 알약을 전송합니다. 6 시간 및 동결 절단 (Cryosections) 10 - - 톨루이딘 블루 염색을위한 저온 유지 장치를 이용하여 세포 펠렛을 12 미크론 두께의 섹션 4 -20 ° C에서 금형을 고정. </li><li> PBS로 부드럽게 저온부을 씻으십시오; 완전히 슬라이드 펠릿 부 피복 1 % 톨루이딘 블루 염색의 몇 방울을 추가; 및 INC실온에서 1 시간 동안 ubate. </li><li> destain하는 PBS 여러 번에 슬라이드를 씻으십시오. (95 % HCl을 알콜 + 0.5 mL)을 여러 번 결합되지 않은 청색이 멈출 때까지 염산 계 알콜 용액에 침지하여 슬라이드 과잉 스테인을 제거한다. 슬라이드의 장기 보존을위한 솔루션을 장착의 100 μL를 사용하여 스테인드 섹션을 탑재합니다. 참고 : 섹션의 파란색 염색은 글리코 사 미노 글리 칸과 당 단백질의 존재를 표시하고 LM을 사용하여 관찰 할 수있을 것입니다. </li></ol></li><li> 조골 세포의 분화 <ol><li> 또, 배양은 70 % 합류로 분리 된 세포는 상업적 트립신 용액으로 해리, 3 분 동안 1,500 XG에서 원심 분리하여 세척하고 펠릿. </li><li> 37 ℃에서 CO2 인큐베이터에서 CM 2 mL를 함유하는 세포의 농도 100,000 / 웰의 6- 웰 플레이트에서 세포를 배양. </li><li> 24 시간 후, (골아 세포 분화 배지에 0.1 μ를 CM 대체; M 덱사메타손, 10 μM의-β 글리세로 포스페이트, 50 μM 아스코르브 산 포스페이트) 및 인큐베이션을 계속한다. 3 일마다 차별화 매체를 변경하거나 자주 필요에. </li><li> 배양 3 주 후, 조골 세포 분화를 확인하기 위해 칼슘 침착의 존재를 검출하는 실내 온도 및 알리자린 레드 염색에서 30 분 동안 웰당 2ml의 4 % 파라 포름 알데히드로 세포를 고정한다. 참고 : 파라 포름 알데히드는 독성이있다. 사용하는 동안 장갑과 안경을 착용하여주의를 실천하십시오. </li><li> 부드럽게 증류수로 두 번 세포를 씻어 고정 2 % 알리자린 레드 염색으로 처리 (2 ㎖ / 웰, 6 웰 플레이트)에서 어둠 속에서 실온에서 1 시간 동안 교반 하였다. </li><li> 칼슘 예금이 꺼 내려하지 않도록 부드럽게 수돗물로 세척하여 여분의 얼룩을 제거합니다. </li><li> LM를 사용하여 붉은 염색 칼슘 침전물을 시각화합니다. </li></ol></li></ol> 4. 정량적 역전사 중합 효소 차반응 (QRT-PCR) 분석 <ol><li> 3 분 동안 1,500 XG에서 원심 분리하여 70 % 합류로 분리 된 세포는, 상용 트립신 용액으로 배양 해리 세정하고 펠릿을 총 세포 RNA를 분리한다. </li><li> PBS로 세포를 씻으 것은 FBS의 흔적을 제거하고 제조업체의 지침에 따라, 상업 RNA 정제 키트를 사용하여 RNA 분리를 진행합니다. </li><li> 열 순환기를 사용하여 30 분 동안 37 ° C에서 DNase를 처리하여 분리 된 총 RNA를 정제 하였다. cDNA를 제조업체의 지침에 따라 상업 키트를 사용하여 합성. </li><li> SYBR 그린 PCR 수퍼 믹스를 5 μL를 각각 포함하는 반응을 96 웰 플레이트에 10 μL 중으로 PCR 반응을 준비한다; 이중 증류수 3 μL; 각 프라이머의 0.5 μL, 순방향 및 역방향 희석 된 (1시 10분)의 cDNA 1 μL. </li><li> 다음과 같은 파라미터에 따라 PCR을 수행하여 (30)의 각각의 44주기 다음에 98 ° C에서 10 분, 98 ℃에서# 176; C, 60 ° C에서 20 초, 72 ℃에서 30 개 초. </li><li> 기준 유전자, GAPDH 및 β 액틴의 표적 유전자의 증폭을 정상화; 프라이머 서열은 표 1에 나열되어 있습니다. </li></ol> 5. 통계 분석 <ol><li> 통계 소프트웨어를 사용하여 모든 분석을 수행합니다. SEM ± 평균으로 데이터를 제시한다. p 형 값 결과 (P ≤ 0.05 ≤ 0.01 * (P)는 **) 통계적으로 유의 한 것으로 간주되었다. </li></ol>

<ol>
	<li>Upadhyay, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+regeneration+in+tissue+repairing+and+therapies.">Role of regeneration in tissue repairing and therapies.</a> J Regen Med Tissue Eng. 4 (1), 1 (2015).</li><li>English, K., Mahon, B. P., Wood, K. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+stromal+cells;+role+in+tissue+repair,+drug+discovery+and+immune+modulation.">Mesenchymal stromal cells; role in tissue repair, drug discovery and immune modulation.</a> Curr Drug Deliv. 11 (5), 561-571 (2014).</li><li>Pak, J., Lee, J. H., Lee, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regenerative+repair+of+damaged+meniscus+with+autologous+adipose+tissue-derived+stem+cells.">Regenerative repair of damaged meniscus with autologous adipose tissue-derived stem cells.</a> Biomed Res Int. 2014, 436029 (2014).</li><li>Hocking, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+Stem+Cell+Therapy+for+Cutaneous+Wounds.">Mesenchymal Stem Cell Therapy for Cutaneous Wounds.</a> Adv Wound Care. 1 (4), 166-171 (2012).</li><li>Anthony, D. F., Shiels, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+paracrine+mechanisms+of+tissue+regeneration+to+repair+damaged+organs.">Exploiting paracrine mechanisms of tissue regeneration to repair damaged organs.</a> Transplant Res. 2 (1), 10 (2013).</li><li>Teschendorff, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+variability+in+cells+of+normal+cytology+is+associated+with+the+risk+of+future+morphological+transformation.">Epigenetic variability in cells of normal cytology is associated with the risk of future morphological transformation.</a> Genome Med. 4 (3), 24 (2012).</li><li>Liu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifications+as+determinants+of+muscle+stem+cell+quiescence+and+chronological+aging.">Chromatin modifications as determinants of muscle stem cell quiescence and chronological aging.</a> Cell Rep. 4 (1), 189-204 (2013).</li><li>Bentivegna, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Methylation+Changes+during+In+Vitro+Propagation+of+Human+Mesenchymal+Stem+Cells:+Implications+for+Their+Genomic+Stability.">DNA Methylation Changes during In Vitro Propagation of Human Mesenchymal Stem Cells: Implications for Their Genomic Stability.</a> Stem Cells Int. 2013, 192425 (2013).</li><li>Bieback, K., Brinkmann, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+stromal+cells+from+human+perinatal+tissues:+From+biology+to+cell+therapy.">Mesenchymal stromal cells from human perinatal tissues: From biology to cell therapy.</a> World J Stem Cells. 2 (4), 81-92 (2010).</li><li>Tobita, M., Tajima, S., Mizuno, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipose+tissue-derived+mesenchymal+stem+cells+and+platelet-rich+plasma:+stem+cell+transplantation+methods+that+enhance+stemness.">Adipose tissue-derived mesenchymal stem cells and platelet-rich plasma: stem cell transplantation methods that enhance stemness.</a> Stem Cell Res Ther. 6, 215 (2015).</li><li>Kim, D. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wharton's+jelly-derived+mesenchymal+stem+cells:+phenotypic+characterization+and+optimizing+their+therapeutic+potential+for+clinical+applications.">Wharton's jelly-derived mesenchymal stem cells: phenotypic characterization and optimizing their therapeutic potential for clinical applications.</a> Int J Mol Sci. 14 (6), 11692-11712 (2013).</li><li>Baraniak, P. R., McDevitt, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell+paracrine+actions+and+tissue+regeneration.">Stem cell paracrine actions and tissue regeneration.</a> Regen Med. 5 (1), 121-143 (2010).</li><li>D&#237;az-Prado, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+amniotic+membrane+as+an+alternative+source+of+stem+cells.">Human amniotic membrane as an alternative source of stem cells.</a> Differentiation. 1, 162-171 (2011).</li><li>Puissant, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunomodulatory+effect+of+human+adipose+tissue-derived+adult+stem+cells:+comparison+with+bone+marrow+mesenchymal+stem+cells.">Immunomodulatory effect of human adipose tissue-derived adult stem cells: comparison with bone marrow mesenchymal stem cells.</a> Br J Haematol. 129 (1), 118-129 (2005).</li><li>Christodoulou, I., Kolisis, F. N., Papaevangeliou, D., Zoumpourlis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+Evaluation+of+Human+Mesenchymal+Stem+Cells+of+Fetal+(Wharton's+Jelly)+and+Adult+(Adipose+Tissue)+Origin+during+Prolonged+In+Vitro+Expansion:+Considerations+for+Cytotherapy.">Comparative Evaluation of Human Mesenchymal Stem Cells of Fetal (Wharton's Jelly) and Adult (Adipose Tissue) Origin during Prolonged In Vitro Expansion: Considerations for Cytotherapy.</a> Stem Cells Int. 2013, 246134 (2013).</li><li>Dalous, J., Larghero, J., Baud, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplantation+of+umbilical+cord-derived+mesenchymal+stem+cells+as+a+novel+strategy+to+protect+the+central+nervous+system:+technical+aspects,+preclinical+studies,+and+clinical+perspectives.">Transplantation of umbilical cord-derived mesenchymal stem cells as a novel strategy to protect the central nervous system: technical aspects, preclinical studies, and clinical perspectives.</a> Pediatr Res. 71 (4), 482-490 (2012).</li><li>Escacena, N., Quesada-Hernandez, E., Capilla-Gonzalez, V., Soria, B., Hmadcha, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bottlenecks+in+the+Efficient+Use+of+Advanced+Therapy+Medicinal+Products+Based+on+Mesenchymal+Stromal+Cells.">Bottlenecks in the Efficient Use of Advanced Therapy Medicinal Products Based on Mesenchymal Stromal Cells.</a> Stem Cells Int. 2015, (2015).</li><li>Law, S., Chaudhuri, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+stem+cell+and+regenerative+medicine:+regeneration+versus+immunomodulatory+challenges.">Mesenchymal stem cell and regenerative medicine: regeneration versus immunomodulatory challenges.</a> Am J Stem Cells. 2 (1), 22-38 (2013).</li><li>Brower, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+stem+cell+therapy+and+delivery+systems+in+nonhealing+wounds.">Mesenchymal stem cell therapy and delivery systems in nonhealing wounds.</a> Adv Skin Wound Care. 24 (11), 524-532 (2011).</li><li>Angelos, M. G., Kaufman, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pluripotent+stem+cell+applications+for+regenerative+medicine.">Pluripotent stem cell applications for regenerative medicine.</a> Curr Opin Organ Transplant. 20 (6), 663-670 (2015).</li><li>Pera, M. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scientific+considerations+relating+to+the+ethics+of+the+use+of+human+embryonic+stem+cells+in+research+and+medicine.">Scientific considerations relating to the ethics of the use of human embryonic stem cells in research and medicine.</a> Reprod Fertil Dev. 13 (1), 23-29 (2001).</li><li>Espinoza, N., Peterson, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+depolarise+the+ethical+debate+over+human+embryonic+stem+cell+research+(and+other+ethical+debates+too).">How to depolarise the ethical debate over human embryonic stem cell research (and other ethical debates too).</a> J Med Ethics. 38 (8), 496-500 (2012).</li><li>Barrilleaux, B., Knoepfler, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducing+iPSCs+to+escape+the+dish.">Inducing iPSCs to escape the dish.</a> Cell Stem Cell. 9 (2), 103-111 (2011).</li><li>Ding, D. C., Chang, Y. H., Shyu, W. C., Lin, S. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+umbilical+cord+mesenchymal+stem+cells:+a+new+era+for+stem+cell+therapy.">Human umbilical cord mesenchymal stem cells: a new era for stem cell therapy.</a> Cell Transplant. 24 (3), 339-347 (2015).</li><li>Jeschke, M. G., Gauglitz, G. G., Phan, T. T., Herndon, D. N., Kita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Umbilical+Cord+Lining+Membrane+and+Wharton's+Jelly-Derived+Mesenchymal+Stem+Cells:+the+Similarities+and+Differences.">Umbilical Cord Lining Membrane and Wharton's Jelly-Derived Mesenchymal Stem Cells: the Similarities and Differences.</a> J Tissue Eng Regen Med. 4, 21-27 (2011).</li><li>Oh, J., Lee, Y. D., Wagers, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell+aging:+mechanisms,+regulators+and+therapeutic+opportunities.">Stem cell aging: mechanisms, regulators and therapeutic opportunities.</a> Nat Med. 20 (8), 870-880 (2014).</li><li>Burkhalter, M. D., Rudolph, K. L., Sperka, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+instability+of+ageing+stem+cells-Induction+and+defence+mechanisms.">Genome instability of ageing stem cells-Induction and defence mechanisms.</a> Ageing Res Rev. 23, 29-36 (2015).</li><li>Adams, P. D., Jasper, H., Rudolph, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aging-Induced+Stem+Cell+Mutations+as+Drivers+for+Disease+and+Cancer.">Aging-Induced Stem Cell Mutations as Drivers for Disease and Cancer.</a> Cell Stem Cell. 16 (6), 601-612 (2015).</li><li>Seshareddy, K., Troyer, D., Weiss, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+to+isolate+mesenchymal-like+cells+from+Wharton's+Jelly+of+umbilical+cord.">Method to isolate mesenchymal-like cells from Wharton's Jelly of umbilical cord.</a> Methods Cell Biol. 86, 101-119 (2008).</li><li>Trivanovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+stem+cells+isolated+from+peripheral+blood+and+umbilical+cord+Wharton's+jelly.">Mesenchymal stem cells isolated from peripheral blood and umbilical cord Wharton's jelly.</a> Srp Arh Celok Lek. 141 (3-4), 178-186 (2013).</li><li>Yoon, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+explant-derived+and+enzymatic+digestion-derived+MSCs+and+the+growth+factors+from+Wharton's+jelly.">Comparison of explant-derived and enzymatic digestion-derived MSCs and the growth factors from Wharton's jelly.</a> Biomed Res Int. 2013, 428726 (2013).</li><li>Steigman, S. A., Fauza, D. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+mesenchymal+stem+cells+from+amniotic+fluid+and+placenta.">Isolation of mesenchymal stem cells from amniotic fluid and placenta.</a> Curr Protoc Stem Cell Biol. 1, (2007).</li><li>Mennan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterisation+of+mesenchymal+stem+cells+from+different+regions+of+the+human+umbilical+cord.">Isolation and characterisation of mesenchymal stem cells from different regions of the human umbilical cord.</a> Biomed Res Int. 2013, (2013).</li><li>Conconi, M. T., Di Liddo, R., Tommasini, M., Calore, C., Parnigotto, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phenotype+and+differentiation+potential+of+stem+populations+obtained+from+various+zones+of+human+umbilical+cord-an+overview.">Phenotype and differentiation potential of stem populations obtained from various zones of human umbilical cord-an overview.</a> J Tissue Eng Regen Med. 4, 6-20 (2011).</li><li>Dominici, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimal+criteria+for+defining+multipotent+mesenchymal+stromal+cells.+The+International+Society+for+Cellular+Therapy+position+statement.">Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement.</a> Cytotherapy. 8 (4), 315-317 (2006).</li><li>Weiss, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+umbilical+cord+matrix+stem+cells:+preliminary+characterization+and+effect+of+transplantation+in+a+rodent+model+of+Parkinson's+disease.">Human umbilical cord matrix stem cells: preliminary characterization and effect of transplantation in a rodent model of Parkinson's disease.</a> Stem Cells. 24 (3), 781-792 (2006).</li><li>Sarugaser, R., Lickorish, D., Baksh, D., Hosseini, M. M., Davies, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+umbilical+cord+perivascular+(HUCPV)+cells:+a+source+of+mesenchymal+progenitors.">Human umbilical cord perivascular (HUCPV) cells: a source of mesenchymal progenitors.</a> Stem Cells. 23 (2), 220-229 (2005).</li><li>Durnaoglu, S., Genc, S., Genc, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-specific+pluripotent+stem+cells+in+neurological+diseases.">Patient-specific pluripotent stem cells in neurological diseases.</a> Stem Cells Int. 2011, 212487 (2011).</li><li>Beeravolu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+comparative+analysis+of+potential+stem/progenitor+cells+from+different+regions+of+human+umbilical+cord.">Isolation and comparative analysis of potential stem/progenitor cells from different regions of human umbilical cord.</a> Stem Cell Res. 16 (3), 696-711 (2016).</li><li>Nekanti, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expansion+and+pluripotent+marker+array+analysis+of+Wharton's+jelly-derived+mesenchymal+stem+cells.">Long-term expansion and pluripotent marker array analysis of Wharton's jelly-derived mesenchymal stem cells.</a> Stem Cells Dev. 19 (1), 117-130 (2010).</li><li>Nagamura-Inoue, T., He, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Umbilical+cord-derived+mesenchymal+stem+cells:+Their+advantages+and+potential+clinical+utility.">Umbilical cord-derived mesenchymal stem cells: Their advantages and potential clinical utility.</a> World J Stem Cells. 6 (2), 195-202 (2014).</li></ol>

저자가 공개하는 게 없다.

줄기 세포 연구의 최근 발전은 기본 개발 프로세스에 대한 이해를 향상뿐만 아니라 생명 공학, 제약, 세포 치료, 재생 의학 및 조직 공학 응용 프로그램을 18, 19, 20에서 줄기 세포의 사용을 위해 유망한 기회를 제공뿐만 아닙니다. 초기 배아에서 분리 한 만능는 ESC가 가장 유망한 있지만, 그들은 기술적 인 문제와 윤리적 딜레마 21, 22, 23에 직면 해있다. 성인 세포에서 파생 된 유도 만능 줄기 세포 (iPSCs)의 대안을 제공하지만, 그들도 비슷한 기술 및 안전 문제 (23)에 직면 해있다. 또한, iPSCs 유 전적으로 안정되지 않거나, 따라서 그들의 치료 용도를 제한 후의 유전 적 변화를 가질 수있다. 줄기 세포는 출생 후 TIS의 다양한보고되었다고소 및 기관. 이들의 ASC의 가장 일반적인 소스는 골수, 지방 및 근육 조직이다. 그러나 출생 후 소스로부터의 ASC 성장과 분화 가능성 24, 25 제한됩니다. 또한 인한 노화 및 환경 스트레스에 노출 고통 때문에 항상 치료 응용 프로그램을 26, 27, 28에 대한 효능이 없습니다. 이것은의 ASC보다 더 순진 줄기 세포의 새로운 소스를 검색 할 우리와 다른 사람들을 주도하고있다. 우리의 ASC의 대안으로 원시 줄기 세포에 대한 주 산기 소스를 조사 하였다. 이 보고서에서 우리는 코드 / 태반 샘플에서 인간 중간 엽 줄기 세포를 분리 할 수있는, 신뢰할 수있는 강력하고 간단한 방법을 제공합니다. 의 ASC의 분리에 사용되는 다른 소스와 방법에 비해,이 방법은 HIG를 대량으로 분리하는 효율적이고 비 침습적 방법을 제공한다H-품질의 중간 엽 줄기 세포. 더 나아가 같은 BM 등 성인 소스에서 중간 엽 줄기 세포에 비해 주 산기 중간 엽 줄기 세포의 높은 성장과 분화 가능성을 강조한다. 태반 태아 부착 UC 두 동맥, 정맥, CL 포함한 독특한 해부학 적 영역으로 큰 장기이며, WJ (혈관 주위 조직). 여러 연구 변수 성장 전체 코드는 WJ, 또는 태반에서 중간 엽 줄기 세포의 분리를,보고 및 차별화, 29 (25)에서, 전위. 그럼에도 불구하고, 지금까지 어떤 연구는 효율적으로 조사하지 않고 코드 / 태반 샘플의 다른 해부학 적 영역에서 세포를 비교했다. 우리는 여기에 UC, CPJ의 해부에 대한 체계적이고 간단한 방법을 제공하고, 중간 엽 줄기 세포의 분리를 위해 FP를 연결. 우리는 또한 확산 capabil를 결정하여 특성과 분리 된 세포의 품질을 평가하는 종합적이고 간단한 프로토콜을 보여시달,뿐만 아니라자가 재생과 분화 잠재력. 이 방법은 재현성 및 우수한 품질의 중간 엽 줄기 세포를 대량 산출한다. 우리는 하나의 세포로 조직의 완전한 소화가 분리 된 세포의 가난한 수율을 가지고있는 반면 크기의 조직 조각 1-2mm의 부분 소화, 외식에서 상용 트립신 솔루션을 재현성있게 산출 세포를 사용하는 것을 발견했다. 그러나 한 연구는 UC의 큰 조직 절편은 대략 크기가 10mm 세포 분리 (30)에 대한 최적이라고보고했다. 반대로, 다른 연구는 조직 절편 방법은 효소 분해 방법 (31)에 비해 더 긴 문화주기 및 세포의 낮은 수율 결과 제안했다. 이전의보고에서, 코드의 처리 및 콜라게나 제 II 히알루로, 개별적으로 또는 트립신을 다음과 같이 조직 코드 셀들 (32, 33)를 분리하기 위해 수행 된 <sup&gt; 34. 뿐만 아니라 이전의 배양에 코드 조직의 소화 방법의 변화의 큰 거래는이뿐만 아니라 분리 된 세포는 이종 것으로 나타났다. 더 긴 시간 기간 동안 열악한 효소의 사용은 세포 부착 및 증식에 영향을 미치는, 세포막을 저하시킬 수있다. 이 방법의 결과는 부분적으로 분해 된 조직 이식편 산기 광범위한 세포 손상을 유발하지 않고 세포의 생장을 제공하는 것으로 밝혀 생존을 유지하고, 중간 엽 줄기 세포의 동종 개체군의보다 많은 양을 얻었다. 외식에서 세포의 해부 및 절연을위한 프로토콜은 간단하지만, 일부 단계는 쉬운 일이 있습니다. 먼저, 배양 플라스크의 표면에 그 부착시킴으로써 이식편 부착을 보장한다. 이것은 단지 배양의 처음 2 시간 동안 조직 조각을 피복하고 신중 나머지 매체 추가 매체 소량을 사용하여 용이하게 할 수있다. 에스econd, T75 플라스크 당 15 개 이하로 이식편의 수를 제한한다. 조각 또는 플라스크 당 너무 많은 조각 사이의 공간이 너무 작은 세포 생장 억제 용이다. 배양 3 일 후에 배양 플라스크의 표면에 충실하지 않는 셋째, 조직 조각 준수 및 배양을위한 새로운 플라스크에 전송해야합니다. 넷째, 조직 조각 부착을 억제 세포 파편, 없어야 배양한다. 다섯째, 큰 조각의 배양 배지가 더 필요하고 세포 생장 효율이 향상되지 않는다. 세포가 빠르게 합류되고 티슈 소스에 따라 구분할 수 있으므로 마지막으로, 특히 세포 생장의 출현 후에, 가깝게 이식편 배양 물을 모니터. 기술의 몇 가지 제한은 CL, WJ, CPJ 및 FP를 분리하는 샘플을 해부에 대한 전문 지식의 부족을 포함한다; WJ 낮은 수율로 생성 된 작은 샘플 크기; 지연 - 처리 샘플을 수집하는 아보 2-4 시간 내에 처리 할 필요ID 세포 복구의 손실. 중간 엽 줄기 세포의 특성 분석을위한 황금 표준은 플라스틱을 고수 섬유 모세포 표현형을 형성하고, 여러 계통으로 분화 할 수있는 능력이다. 이들은 또한 ISCT 35 바와 같이 중간 엽 줄기 세포를 정의하기위한 일반적으로 사용되는 기준이다. 본 연구에서는 네 개의 소스에서 분리 된 세포는 플라스틱을 부착했다 및 MSC 마커 (CD29, CD44, CD73, CD90, 및 CD105)하지만 조혈 마커 CD45에 대한 부정적인 표현을위한 긍정적 인 표현을했다. 또한, 그들은 인간 백혈구 항원 (HLA) 클래스 I을 발현하지만 HLA 클래스 II에 대한 음성이었다. BM-MSC들에 비해 WJ- CPJ 및 유래 세포는 높았다. 이러한 결과는 이전의보고와 일치하는 중간 엽 줄기 33, 36, 37, 38 UC 유래. 또한, 이러한 결과는 CL-가 WJ-가 CPJ-는 FP-엽 줄기 세포가 발현 pluri되었습니다이러한 OCT4, NANOG와 같은 효능 SOX2 유전자; 이전 39보고하지만, 그 표현은,는 ESC보다 낮았다. 이러한 결과는 주 산기 - 유래 세포 (40)의 만능 마커의 발현을보고 이전 연구와 일치도 있었다. 흥미롭게도,이 만능 마커의 발현이 다른 소스에서 분리 된 세포보다 CPJ-중간 엽 줄기 세포에서 더 높은 것을 관찰되었다. 또한 UC-중간 엽 줄기 세포는 BM-중간 엽 줄기 세포 (41)보다 더 큰 자기 갱신 잠재력을 전시 것을 발견했다. 흥미롭게도, 표현형 특성의 유사성에도 불구하고, 네 개의 소스에서 고립 된 세포는 변수 CFE 값을했다. 그러나, FP-MSC를 제외하고, 그들은 모두 BM-중간 엽 줄기 세포보다 더 CFE 값을했다. 다른 모든 중간 엽 줄기 세포에 비해 CPJ-중간 엽 줄기 세포는 증식의 가장 높은 CFE 값과 속도를 가지고 있었다. 또한 WJ- CPJ-및 중간 엽 줄기 세포는 BM-MSC들보다 분화 잠재력을 표시. CL-중간 엽 줄기 세포는 최소한의 차별화를 보여 주었다CPJ-중간 엽 줄기 세포 반면 세 계보 (즉, 지방 세포, 연골 및 골 형성)에 가능성이 가장 높은 trilineage 차별화 가능성이 있고 FP-중간 엽 줄기 세포는 적어도 지방 세포 분화 잠재력을 표시. 결론적으로, 우리의 결과는 고립 된 중간 엽 줄기 세포의 질과 양이 코드 / 태반 샘플의 4 개 소스 사이에 차이가 있음을 보여 주었다. CPJ-중간 엽 줄기 세포보다 증식 능력과 더 큰 자기 갱신 잠재력을했다. 그들은 또한 trilineage의 세포 유형으로 분화에서 강력한했다. 때문에 낮은 배가 시간에, CPJ-중간 엽 줄기 세포는 빠르게 수 1,000 배 확대 및 높은 처리량 약물이나 생체 재료 검사에 사용 할 수있다. 이 세포는 세포 치료와 재생 의학 응용 프로그램에 대한 더 유망한 원천이 될 수 있습니다.

줄기 세포는 여러 기관과 신체 조직에 존재한다. 그들은 재생 잠재력을 보유하고 인간의 삶 1, 2의 범위에 걸쳐 몸에 손상된 조직을 복구에 중요한 역할을한다. 이것은 특히 이후 성체 줄기 세포 (ASC를) 관심의 큰 거래를 생성 한 배아 줄기 세포 (는 ESC) 달리의 ASC의 사용은 도덕적, 윤리적 딜레마를 제기하지 않습니다. 몇몇 연구는 중간 엽 기질 세포 (중간 엽 줄기 세포) 등의 ASC의 고립을보고, 조혈 줄기 세포 (조혈 모세포); 및 지방 조직 (AT) 및 치과 펄프 3, 4, 5, 골수 (BM)에 이르기까지 다양한 성인 출처 등 다양한 조상. 그러나, 성인 틈새 시장의 대부분은 제한되고있어 존재의 ASC의 수는 자신의 분리는 일반적으로 가능한 기증자와 침략 고통스러운 과정을 포함한다사이트 이환율. 또한, 기증자의 나이와 환경 스트레스 또한 절연 세포 6, 7, 8의 품질과 생물학적 활성을 결정하는데 중요한 역할을 할 수있다. 의 ASC는 체외 배양시 증식 및 제한된 분화 잠재력을 표시. 현재의 ASC의 이러한 단점을 극복하기 위해 새로운 소스는 줄기 세포를 분리하기 위해 추진되고있다. 이러한 노력은 제대혈, 코드 조직, 태반, 유체 9 양수를 포함한 주 산기 소스로부터 줄기 세포의 분리로 이어졌다. 이 소스 때문에 쉽고 풍부한 가용성 10, 11, 12, 13의 관심을 얻고있다. 이들로부터 유도 된 또 산기 조직을 비 침습적으로 얻어진 줄기 세포 수는성인 소스 (14), (15)에서 분리의 ASC보다 더 원시적. 그들은 출생시 얻은 조직에서 분리되어 인해 노화 및 환경 스트레스 (16)에 게놈에 최소한의 변경을받은 것으로 간주됩니다. 그러나보고 된 주 산기 소스에서 줄기 세포의 특성과 그들의 잠재적 인 자기 갱신뿐만 아니라 차별화하는 17 널리 11 다릅니다. 이는 인간의 탯줄 (UC)는 복잡한 기관이다는 사실에 부분적으로있을 수 있습니다. 우리는 주 산기 조직의 분리 된 영역이 변화 및 비 산기 소스에서 파생 된의 ASC에 비해 이러한 줄기 세포의 원시적 특성에 대한 책임을 특정 틈새 시장을 만드는 것이 가설을 세웠다. UC, 코드 - 태반 접합부 (CPJ) 본 연구는 세 영역으로 이산 해부학 코드 / 태반 샘플의 박리를 설명태반 태아 D (FP). UC 추가로 두 개의 영역으로 해부했다 : 코드 라이닝 (CL)과 와튼의 젤리 (WJ). CL, WJ, CPJ 및 FP에서 분리 된 세포의 분석은 모든 fibroblastoid 형태를 전시하고 MSC 마커를 표현 시연,하지만 그들은 자신의자가 재생과 분화 가능성 달랐다. 이들 세포 치료, 재생 의학 및 조직 공학을위한 유망한 소스 만들기, UC-및 FP-유래 세포에 비해 CPJ-유래 세포는 증식과 자기 갱신 가능성의 높은 비율을 보였다.

<table border="0" cellpadding="0" cellspacing="0" width="821">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:329px;">DMEM with 4500 mg/ml glucose&#160;</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:125px;">11995065</td>
			<td style="width:157px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FBS</td>
			<td style="width:211px;">Aleken Biologicals</td>
			<td style="width:125px;">FBSS500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Isobutyl-methylxanthine</td>
			<td style="width:211px;">Sigma</td>
			<td style="width:125px;">I5879-250mg</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dexamethasone</td>
			<td style="width:211px;">Sigma</td>
			<td style="width:125px;">D4902-100mg</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Insulin</td>
			<td style="width:211px;">Prospec</td>
			<td style="width:125px;">CYT-270</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Indomethacin</td>
			<td style="width:211px;">Sigma</td>
			<td style="width:125px;">I7378-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TGF&#946;1</td>
			<td style="width:211px;">Prospec</td>
			<td style="width:125px;">CYT-716</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ascorbic acid</td>
			<td style="width:211px;">Sigma</td>
			<td style="width:125px;">A-7631</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ascorbate 2-phosphate</td>
			<td style="width:211px;">Sigma</td>
			<td style="width:125px;">A-8960</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">&#946;-glycerophosphate</td>
			<td style="width:211px;">Sigma</td>
			<td style="width:125px;">G-6251</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TrypLE</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:125px;">50591419</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GeneJET RNA purification kit</td>
			<td style="width:211px;">Thermo Scientific</td>
			<td style="width:125px;">K0732</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNase</td>
			<td style="width:211px;">Promega</td>
			<td style="width:125px;">M6101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iScript kit</td>
			<td style="width:211px;">Biorad</td>
			<td style="width:125px;">1708891</td>
			<td></td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">Sso-Advanced Universal SYBR Green Supermix Kit</td>
			<td style="width:211px;">Biorad</td>
			<td style="width:125px;">1725274</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:329px;">4% paraformaldehyde</td>
			<td style="width:211px;">Affymetrix</td>
			<td style="width:125px;">19943</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:329px;">OCT</td>
			<td style="width:211px;">Thermo Scientific</td>
			<td style="width:125px;">SH75-125D</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;">Oil Red O&#160;</td>
			<td style="width:211px;">American MasterTech Scientific</td>
			<td style="width:125px;">STORO100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Toluidine blue</td>
			<td style="width:211px;">Thermo Scientific</td>
			<td style="width:125px;">S71363</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">&#160;Crystal violet</td>
			<td style="width:211px;">Sigma</td>
			<td>C3886</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Alizarin red stain</td>
			<td style="width:211px;">Thermo Scientific</td>
			<td style="width:125px;">S25131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:329px;">APC Mouse anti-Human CD29</td>
			<td style="width:211px;">BD Biosciences&#160;</td>
			<td style="width:125px;">559883</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:329px;">APC Mouse anti-Human CD34</td>
			<td style="width:211px;">BD Biosciences&#160;</td>
			<td style="width:125px;">555824</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:329px;">FITC Mouse anti-Human CD44</td>
			<td style="width:211px;">BD Biosciences&#160;</td>
			<td style="width:125px;">555478</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:329px;">FITC Mouse anti-Human CD45</td>
			<td style="width:211px;">BD Biosciences&#160;</td>
			<td style="width:125px;">555482</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:329px;">APC Mouse anti-Human CD73</td>
			<td style="width:211px;">BD Biosciences&#160;</td>
			<td style="width:125px;">560847</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:329px;">FITC Mouse anti-Human CD90</td>
			<td style="width:211px;">BD Biosciences&#160;</td>
			<td style="width:125px;">561969</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:329px;">APC Mouse anti-Human CD105</td>
			<td style="width:211px;">BD Biosciences&#160;</td>
			<td style="width:125px;">562408</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge</td>
			<td style="width:211px;">IEC</td>
			<td style="width:125px;">93522M-2</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CO2 incubator</td>
			<td style="width:211px;">Thermo Scientific</td>
			<td style="width:125px;">Hera Cell 150i</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Light microscope (LM)</td>
			<td style="width:211px;">Nikon Instruments Inc.</td>
			<td style="width:125px;">Olympus</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:329px;">Hemacytometer</td>
			<td style="width:211px;">Thermo Scientific</td>
			<td style="width:125px;">0267151B</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cryostat</td>
			<td style="width:211px;">Leica</td>
			<td style="width:125px;">CM3050 S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FACS Canto II and Diva Software</td>
			<td style="width:211px;">BD Biosciences&#160;</td>
			<td style="width:125px;">Canto II&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Thermocycler</td>
			<td style="width:211px;">MJ Research Inc.</td>
			<td style="width:125px;">PTC-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real-Time PCR System&#160;</td>
			<td style="width:211px;">Bio-Rad</td>
			<td style="width:125px;">CFX96</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation and characterization of mesenchymal stromal cells from human umbilical cord and fetal placenta

인간의 탯줄 (UC) 및 태반은 어떤 윤리적이나 도덕적 문제를 제기하지 않기 때문에 점점 더 관심을 얻고있다 중간 엽 기질 세포 (중간 엽 줄기 세포)의 비 침습적 원시적이고 풍부한 소스입니다. UC에서 중간 엽 줄기 세포를 분리하기위한 현재의 방법은 가변 확산 전위와 소량의 세포를 얻었다. UC가 복잡한 해부학 기관이므로 MSC 특성의 차이는 분리 영역의 해부학 적 차이에 기인 할 수있다. UC, 코드 - 태반 접합부 (CPJ), 태반 및 태아 (FP) : 본 연구에서는 처음 세 이산 해부 영역에 코드 / 태반 샘플 해부. 둘째로, 두 개의 구별되는 영역이, 코드 라이닝 (CL)과 왓슨의 젤리 (WJ)를 분리 하였다. 체외 이식편 배양 기술은 다음 네 개의 소스로부터 세포를 분리하는 데 사용되었다. 체외 이식편의 세포의 일차 배양에 필요한 시간은 조직의 소스에 따라 변할. (4) 다 - 세포의 증생 (3) 내에서 발생한각각 CL / WJ 및 FP 이식편로부터 14 일 - 십일 11 - 7 성장 후에 관찰 된 반면 CPJ 외식 YS. 분리 된 세포를 플라스틱에 대한 접착 성이었고 마찬가지로 골수 유래 중간 엽 줄기 세포로, 예컨대 CD29, CD44, CD73, CD90 및 CD105과 같은 fibroblastoid 형태 및 표면 마커를 표시. 그러나 CPJ-엽 줄기 세포 및 중간 엽 줄기 세포와 WJ-변화 세포의 콜로니 형성 효율은 BM-MSC들보다 더 높은 효율을 나타내는. 네 개의 소스에서 중간 엽 줄기 세포들은 다 능성했다 나타내는, 지방 세포, 연골 및 골 형성 계보로 분화. CPJ-중간 엽 줄기 세포는 다른 MSC 소스에 비해보다 효율적으로 차별화. 이러한 결과는 CPJ 가장 유력한 해부학 영역이고, 시험 관내에서 더욱 증식 및자가 재생 능력을 가진 세포의 수를 높게 수율 제안. 결론적으로, 네 개의 소스로부터 중간 엽 줄기 세포의 비교 분석 CPJ 세포 요법 용 중간 엽 줄기 세포 regenerativ보다 유망한 소스 인 것으로 나타났다전자 의학 및 조직 공학.

해부와 인간의 탯줄, 코드 - 태반 접합 및 태아 태반에서 세포의 분리 주 산기 조직은 세 개의 분리 된 해부학 적 영역으로 구성되어 있습니다. CL (코드의 외측 내벽) 및 WJ (코드 안쪽 혈관 주변의 젤리 형상 재료) : 처음 두 동맥 및 하나 개의 정맥뿐만 아니라, 두 개의 별개의 영역을 포함하는 상기 UC이다. 둘째 CPJ (탯줄 및 태반의 접속)이고, 세 번째는 (코드가 모체의 자궁 벽에 부착 된 태반에 삽입)을 CPJ 직후 FP이다. 산기 조직으로부터 세포를 분리 프로토콜의 개략도는도 1에 도시되어있다. 네 소스-CL, WJ, CPJ하고 명확하게 식별은 FP-하고도 2에 도시 된 바와 같이, 체외 이식편에서 세포를 분리하기 위해 분리 하였다. 티절편 문화에서 세포 부산물의 그 모습은 정기적으로 모니터링하고 LM에 의해 기록되었다. 자기편 fibroblastoid 세포는 CPJ 외식을 배양 3-4 일 후에 관찰되었다. 비슷한 형태를 가진 세포는 각각 WJ, CL, 및 FP 외식를 배양 한 후 7 ~ 8, 9 ~ 10, 및 11-14일 나타났다. 다양한 소스 (CL, WJ, CPJ 및 FP)을 나타내는 이식편에서 세포의 생장은도 3a에 도시되어있다. 이 세포는 P0으로 간주되었다. P0 세포를 계대 배양했을 때, 그들은 BM-중간 엽 줄기 세포와 유사한 fibroblastoid 형태를 표시, 클론 적 성장을 보였다. 그러나,도 3b 및 C에 도시 한 바와 같이, 32 시간 내지 CPJ 및 FP 세포로부터 94 시간까지 다양한 집단 배가 시간의 변동을 나타내었다. WJ 및 CL의 세포가 유사한 두 배로 시간이 CPJ 및 FP에 내측했다. P0에서 세포의 추가의 분석은도 16에서 92에 이르는 콜로니의 CFE 변할 것으로 나타났다.FP 세포가 낮은 (16) CFE 있었다 동안 CPJ에서 세포는 가장 높은 (92)를 가졌다. CL 및 WJ에서 세포를 59 개, 80 콜로니를 각각 (도 4A-C)의 값을 CFE했다. CL에서 세포는 BM-중간 엽 줄기 세포와 유사한 CFE 값을했다. 이러한 결과는 CPJ-유래 세포가 이상 증식과 자기 갱신 능력을 가지고하는 것이 좋습니다. 분리 된 세포의 Immunoprofile CL, WJ, CPJ 및 FP에서 분리 된 세포는 세포 특이 마커의 발현을 조사 하였다. P3-5 세포는 CD29, CD44, CD73, CD90 및 CD105 (도 5A와 B) 등 중간 엽 줄기 세포 마커의 양성 발현을 표시. 이 세포는 내가, 마커 HLA-ABC, 계급에게 II 마커, HLA-DR (3)를 표현하지 않는 주요 조직 적합성 클래스를 표현하는 것으로 알려져있다. 제 양성 세포의 백분율네 소스에서 선택된 마커 표준 BM-MSC들에 의해 표현 된 것과 유사 하였다 ESE. 그러나, MFI 비율은 WJ- CPJ 및 유래 세포는 거의 유사하며 CL- FP 및 유래 세포 (도 5c)보다 더 높은 것을 나타낸다. 흥미롭게 CFE 값을 변화에도 불구하고, 다른 소스로부터의 모든 세포는 MSC 마커 비슷한 수준을 나타냈다. 세포 표면 마커의 결과를 바탕으로, 네 개의 소스에서 분리 된 세포가 중간 엽 줄기 세포로 간주되었다. 이러한 세포의 추가의 분석은도 5d에 도시 된 바와 같이, 그들은 또한, 다 능성 유전자, OCT4, NANOG, KLF4 및 SOX2 표현 것으로 나타났다. CPJ-중간 엽 줄기 세포는 WJ-, CL-와 FP-중간 엽 줄기 세포 다음 만능 마커의 가장 높은 표현을했다. 고립 된 중간 엽 줄기 세포의 분화 가능성 중간 엽 줄기 세포의 특성을위한 황금 표준은 diffe 할 수있는 능력이다여러 계통으로 rentiate. 우리의 결과는 주 산기 모든 소스로부터 고립 된 중간 엽 줄기 세포는 쉽게, 지방 세포 연골 및 골 형성 세포 유형으로 분화 된 것으로 나타났다. 지방 세포 유도체는도 6a에 도시 된 바와 같이, 양, 오일 레드 O로 염색 된 지방 방울을 일으켰다. 중간 엽 줄기 세포의 연골 유도체의 톨루이딘 블루 염색이 세포 외 기질 (도 6b)의 제조에 도움 프로테오글리칸 및 당 단백질의 존재를 보였다. 그림 6 (C)에 도시 된 바와 같이 긍정적 인 알리자린 레드 염색 중간 엽 줄기 세포의 골 형성 유도체는 뼈 광물에 포함 된 칼슘 침전물의 존재를 나타냅니다. 예상대로, 모든 소스로부터의 고립 된 중간 엽 줄기 세포의 전사 분석 trilineage 차별화 (그림 6D -F)을 보여 주었다. 그러나, 냄비분화 ential는 중간 엽 줄기 세포의 근원에 따라 다양. WJ-엽 줄기 세포의 지방 세포 유도체 CPJ-MSC들에 비해 선택된 지방 세포 유전자 (CEBPβ, FABP4 및 PPARγ)의 발현 수준보다 2 배이었다. CL- 및 FP-중간 엽 줄기 세포는 유전자의 가장 낮은 표현했다. 연골 분화의 경우 CPJ-MSC들 유도체는 WJ- 및 FP-MSC들 유도체보다 50 배 연골 유전자 (SOX9 및 COL2)를 선택 나타냈다. CL-중간 엽 줄기 세포의 가난한 지방 세포의 분화와 마찬가지로, 그들은 연골 유전자의 가장 낮은 발현에 의해 분명로서, 낮은 연골 잠재력을했다. 조골 선택된 유전자 (COL1, OPN과 OCN)의 2 배 이상 전사 수준으로 나타낸 바와 같이 CPJ-엽 줄기 세포는 가장 높은 골 세포 분화 잠재력을 보였다. 그러나, 전구 마커 RUNX2의 발현이 세포 분화 조건에 응답에 느린했다 나타내는, WJ-중간 엽 줄기 세포의 골 형성 파생 상품에서 가장 높았다. 다시, CL-중간 엽 줄기 세포는 가난한 보여 주었다골 형성 혈통으로 차별화. 이러한 결과는 CPJ-중간 엽 줄기 세포와 WJ-중간 엽 줄기 세포가 CL- 및 FP-중간 엽 줄기 세포보다 분화 잠재력을 표시하는 것이 좋습니다. CL-중간 엽 줄기 세포는 trilineage 유도체로 분화 할 수있는 가장 가능성이 있었다. <img alt="그림 1" class="xfigimg" src="/files/ftp_upload/55224/55224fig1.jpg" /> 도 1 : 인간 제대 코드, 코드 - 태반 정션 태아 태반 세포의 분리의 개략도. 수집 된 샘플을 검사하고 해부를 진행합니다. 1. 수동 해부 세 이산 영역에 코드 / 태반 샘플을 별도의 단계 : 탯줄 (UC), 코드 - 태반 접합부 (CPJ), 태반 및 태아 (FP). 코드 라이닝 (CL)과 왓슨의 젤리 (WJ) 가위 집게를 사용 UC로의 별개의 두 영역을 분리한다. 2 단계. 1- t에 별도로 해부 조직의 각 컷O 2 mm 조각 가위를 사용하여 부분적으로 소화 편. 3 단계 문화를 조직 조각. 단계 4. 트립신 처리하여 이식편에서 세포를 분리. 하위 문화와는 분리 된 세포를 특징. 5 단계 절연 및 특징 세포를 증폭 및 다양한 애플리케이션에 사용할 수 있습니다. <a href="http://ecsource.jove.com/files/ftp_upload/55224/55224fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" class="xfigimg" src="/files/ftp_upload/55224/55224fig2.jpg" /> 그림 2 : 인간 제대 코드, 코드 - 태반 접합 및 태아 태반에서 해부와의 Explants의 문화. UC (CL하게 분할하고 WJ로) CPJ 및 FP뿐만 아니라 연결된 동맥과 정맥의 세 가지 서로 다른 해부학 코드 / 태반 샘플의 영역은 제시된. CL, WJ, CPJ,및 FP는 이식편에서 세포를 분리하기 위해 수동 절개에 의해 분리 하였다. 해부 영역 각각 별도로 CM 9 mL로하여 2 판을 작은 조각으로 절단하고 75 cm 배양 하였다. <a href="http://ecsource.jove.com/files/ftp_upload/55224/55224fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" class="xfigimg" src="/files/ftp_upload/55224/55224fig3.jpg" /> 그림 3 : 인간 제대 코드, 코드 - 태반 접합 및 태아 태반에서 분리 된 세포의 형태학. LM 시각화 같이 CL, WJ, CPJ 및 FP의 이식편에서 (A) 세포 생장. CL, WJ, CPJ 및 FP 이식편으로부터 분리 된 세포의 (B) 계대 fibroblastoid 형태를 보였다. 스케일 바는 100 ㎛의 (: 4X의 배율)를 나타낸다. (C) 인구 t의 배가 시간그는 CL, WJ, CPJ 및 FP로부터 세포를 격리합니다. BM-중간 엽 줄기 세포는 표준으로 사용되었다. 오차 막대는 삼중 측정치의 평균의 표준 오차를 나타낸다 (** P ≤ 0.05 0.01 ≤ P *). <a href="http://ecsource.jove.com/files/ftp_upload/55224/55224fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" class="xfigimg" src="/files/ftp_upload/55224/55224fig4.jpg" /> 도 4 : 콜로니 형성 인간 제대 코드, 코드 - 태반 정션 태아 태반 세포의 효율. 1.63 세포 / ㎠의 밀도로 도금 클론 CL, WJ, CPJ 및 FP 분리 세포 (P0)의 (A)의 성장이, LM에 의해 가시화 하였다. (B) 크리스탈 바이올렛은 콜로니 형성 능력을 표시로 염색 된 세포의 현미경 사진. (C) 세포 염색 재치 단일 콜로니H 크리스탈 바이올렛. 스케일 바는 100 ㎛의 (: 4X의 배율)를 나타낸다. (D) CL, WJ, CPJ 및 FP 유래의 세포로부터 형성된 콜로니 수의 그래픽 표시. BM-중간 엽 줄기 세포는 표준으로 사용되었다. 오차 막대는 삼중 측정치의 평균의 표준 오차를 나타낸다 (** P ≤ 0.05 0.01 ≤ P *). <a href="http://ecsource.jove.com/files/ftp_upload/55224/55224fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" class="xfigimg" src="/files/ftp_upload/55224/55224fig5.jpg" /> 그림 5 : 인간 제대 코드, 코드 - 태반 접합 및 태아 태반에서 분리 한 세포에 의해 표현 MSC 마커의 분석. 제지 같은 (A) CL, WJ, CPJ 및 FP에서 세포에 의한 중간 엽 표면 마커 (CD29, CD44, CD73, CD90 및 CD105)의 발현유동 세포 계측법에 의해 채취. (B 및 C) 상기 선택된 중간 엽 표면 마커에 대한 양성 세포의 비율 및 평균 형광 강도 (MFI) 비율의 그래픽 표시. MFI 비율은 이소 타입의 MFI 값으로 (게이트 된 세포 집단의 형광 강도에 기초하여 상기 소프트웨어에 의해 생성 된) 상기 마커의 MFI 값을 나누어 계산 하였다. 오류 막대는 세중의 측정의 평균의 표준 오차를 나타냅니다. QRT-PCR에 의해 결정되는 바와 같이 CL, WJ, CPJ 및 FP에서 세포로 다 능성 유전자 (OCT4, NANOG, KLF4 및 SOX2)의 (D) 식. (** P ≤ 0.01 및 0.05 ≤ P *). 유전자 발현은 GAPDH와 β - 액틴에 정상화되었고, 오차 막대는 세중의 측정의 평균의 표준 오차를 나타냅니다. <a href="http://ecsource.jove.com/files/ftp_upload/55224/55224fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 그림 6 : 인간 탯줄, 코드 - 태반 접합 및 태아 태반에서 분리 한 중간 엽 줄기 세포의 Multilineage 차별화. (A) 세포 지질 방울의 존재를 나타내는 3 주 동안 지방 세포 분화 배지에서 배양 및 오일 레드 O로 염색 하였다. (B) 세포 펠렛을 3 주 동안 연골 분화 배지에서 배양 하였다. 펠렛 문화의 조직 학적 저온부는 글리코 사 미노 글리 칸의 존재를 표시, 톨루이딘 블루 염색 하였다. (C) 세포는 뼈 광물을 제안 칼슘 침전물의 생성을 표시하는 3 주 동안 골 형성 분화 배지에서 배양 및 알리자린 레드 염색 하였다. 모든 이미지는 LM에 의해 얻어졌다. 스케일 바는 100 ㎛의 (: 4X의 배율)를 나타낸다. BM-중간 엽 줄기 세포 우리표준으로 재사용. (DF) 선택된 유전자의 발현 (CEBPβ, FABP4 및 PPARγ; SOX9, ACAN 및 COL2 및 COL1, RUNX2는, 지방 세포, 연골 세포, 각각 조골 세포 계통으로 중간 엽 줄기 세포의 분화를 나타내는 OPN과 OCN)는 결정된 QRT-PCR 분석에 의해 (** P ≤ 0.05 0.01 ≤ P *). 유전자 발현은 GAPDH와 β - 액틴에 정상화되고, 오차 막대는 세중의 측정의 평균의 표준 오차를 나타냅니다. <a href="http://ecsource.jove.com/files/ftp_upload/55224/55224fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table fo:keep-together.within-page="1"><tbody><tr><td> 유전자 </td><td> 프라이머 시퀀스 </td><td> 제품 길이 </td></tr><tr><td> OCT4 </td><td> 앞으로-CCCCTGGTGCCGTGAA </td><td> 97 </td></tr><tr><td></td><td> 리버스 GCAAATTGCTCGAGTTCTTTCTG </td><td> &lt;/ TD&gt; </tr><tr><td> NANOG </td><td> 포워드 AAAGAATCTTCACCTATGCC </td><td> (110) </td></tr><tr><td></td><td> 리버스 GAAGGAAGAGGAGAGACAGT </td><td></td></tr><tr><td> KLF4 </td><td> 포워드 CGAACCCACACAGGTGAGAA </td><td> (94) </td></tr><tr><td></td><td> 리버스 TACGGTAGTGCCTGGTCAGTTC </td><td></td></tr><tr><td> SOX2 </td><td> 포워드 TTGCTGCCTCTTTAAGACTAGGA </td><td> (75) </td></tr><tr><td></td><td> 리버스 CTGGGGCTCAAACTTCTCTC </td><td></td></tr><tr><td> SOX9 </td><td> 포워드 AGCGAACGCACATCAAGAC </td><td> (85) </td></tr><tr><td></td><td> 리버스 CTGTAGGCGATCTGTTGGGG </td><td></td></tr><tr><td> COL2 </td><td> 포워드 CTCGTGGCAGAGATGGAGAA </td><td> (252) </td></tr><tr><td></td><td> 리버스 CACCAGGTTCACCAGGATTG </td><td></td></tr><tr><td> 수 </td><td> 포워드 AGCCTGCGCTCCAATGACT </td><td> (103) </td></tr><tr><td></td><tD&gt; 리버스 GGAACACGATGCCTTTCACC </td><td></td></tr><tr><td> COL1 </td><td> 포워드 AAGGTCATGCTGGTCTTGCT </td><td> (114) </td></tr><tr><td></td><td> 리버스 GACCCTGTTCACCTTTTCCA </td><td></td></tr><tr><td> RUNX2 </td><td> 포워드 TGCTTCATTCGCCTCACAAA </td><td> 111 </td></tr><tr><td></td><td> 리버스 AGTGACCTGCGGAGATTAAC </td><td></td></tr><tr><td> OPN </td><td> 포워드 CATACAAGGCCATCCCCGTT </td><td> (112) </td></tr><tr><td></td><td> 리버스 TGGGTTTCAGCACTCTGGTC </td><td></td></tr><tr><td> OCN </td><td> 포워드 TAAACAGTGCTGGAGGCTGG </td><td> (191) </td></tr><tr><td></td><td> 리버스 CTTGGACACAAAGGCTGCAC </td><td></td></tr><tr><td> CEBPβ </td><td> 포워드 TATAGGCTGGGCTTCCCCTT </td><td> (94) </td></tr><tr><td></td><td> 리버스 AGCTTTCTGGTGTGACTCGG </td><td></td></tr><tr><td> FABP4 </td><td> 포워드 TTAGATGGGGGTGTCCTGGT </td><td> (158) </td></tr><tr><td></td><td> 리버스 GGTCAACGTCCCTTGGCTTA </td><td></td></tr><tr><td> PPARγ </td><td> 포워드 GGCTTCATGACAAGGGAGTTTC </td><td> (74) </td></tr><tr><td></td><td> 리버스 ACTCAAACTTGGGCTCCATAAAG </td><td></td></tr><tr><td> GAPDH </td><td> 포워드 ACAACTTTGGTATCGTGGAAGG </td><td> (101) </td></tr><tr><td></td><td> 리버스 GCCATCACGCCACAGTTTC </td><td></td></tr><tr><td> 액틴 </td><td> 포워드 AATCTGGCACCACACCTTCTAC </td><td> (170) </td></tr><tr><td></td><td> 리버스 ATAGCACAGCCTGGATAGCAAC </td><td></td></tr></tbody></table> 표 1 : 본 연구에 사용 된 인간 프라이머 시퀀스의 목록.

Watch this Scientific Journal Video about Isolation and Characterization of Mesenchymal Stromal Cells from Human Umbilical Cord and Fetal Placenta at JoVE.com

Isolation and Characterization of Mesenchymal Stromal Cells from Human Umbilical Cord and Fetal Placenta

여기서, 우리는 인간 탯줄 (UC)와 코드에 태아 태반 샘플 분리 용 (CL), 왓슨의 젤리 (WJ), 코드 - 태반 접합부 (CPJ) 태아 태반 (FP) 라이닝 박리를위한 프로토콜을 제시 상기 이식편 배양 기술을 이용하여 중간 엽 간질 세포 (MSC들)의 특성화.

인간 제대혈 및 태아 태반에서 중간 엽 기질 세포의 분리 및 특성

The human umbilical cord (UC) and placenta are non-invasive, primitive and abundant sources of mesenchymal stromal cells (MSCs) that have increasingly ...

isolation-characterization-mesenchymal-stromal-cells-from-human

Research

JoVE Journal

Developmental Biology

46.2K 조회수.  Oakland University.  여기서, 우리는 인간 탯줄 (UC)와 코드에 태아 태반 샘플 분리 용 (CL), 왓슨의 젤리 (WJ), 코드 - 태반 접합부 (CPJ) 태아 태반 (FP) 라이닝 박리를위한 프로토콜을 제시 상기 이식편 배양 기술을 이용하여 중간 엽 간질 세포 (MSC들)의 특성화. 

비디오: Isolation and Characterization of Mesenchymal Stromal Cells from Human Umbilical Cord and Fetal Placenta

Isolation of Human Mesenchymal Stem Cells and their Cultivation on the Porous Bone Matrix

Mesenchymal stem cells (MSCs) have a differentiation potential towards osteoblastic lineage when they are stimulated with soluble factors or specific biomaterials. This work presents a novel option for the delivery of MSCs from human amniotic membrane (AM-hMSCs) that employs bovine bone matrix Nukbone (NKB) as a scaffold. Thus, the application of MSCs in repair and tissue regeneration processes depends principally on the efficient implementation of the techniques for placing these cells in a host tissue. For this reason, the design of biomaterials and cellular scaffolds has gained importance in recent years because the topographical characteristics of the selected scaffold must ensure adhesion, proliferation and differentiation into the desired cell lineage in the microenvironment of the injured tissue. This option for the delivery of MSCs from human amniotic membrane (AM-hMSCs) employs bovine bone matrix as a cellular scaffold and is an efficient culture technique because the cells respond to the topographic characteristics of the bovine bone matrix Nukbone (NKB), i.e., spreading on the surface, macroporous covering and colonizing the depth of the biomaterial, after the cell isolation process. We present the procedure for isolating and culturing MSCs on a bovine matrix.

Mesenchymal stem cells (MSCs) have a differentiation potential towards osteoblastic lineage when they are stimulated with soluble factors or specific biomaterials. This work presents a novel option for the delivery of MSCs from human amniotic membrane (AM-hMSCs) that employs the bovine bone matrix Nukbone (NKB) as a scaffold.

인간 중간 엽 줄기 세포의 분리 및 다공성 뼈 매트릭스에 자신의 재배

Mesenchymal stem cells (MSCs) have a differentiation potential towards osteoblastic lineage when they are stimulated with soluble factors or specific ...

연구

발생학

Isolation and Quantitative Immunocytochemical Characterization of Primary Myogenic Cells and Fibroblasts from Human Skeletal Muscle

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated from human muscle biopsy samples using enzymatic digestion and their myogenic properties studied in culture. Quantitatively, the two main adherent cell types obtained from enzymatic digestion are: (i) the satellite cells (termed myogenic cells or muscle precursor cells), identified initially as CD56+ and later as CD56+/desmin+ cells and (ii) muscle-derived fibroblasts, identified as CD56&#8211; and TE-7+. Fibroblasts proliferate very efficiently in culture and in mixed cell populations these cells may overrun myogenic cells to dominate the culture. The isolation and purification of different cell types from human muscle is thus an important methodological consideration when trying to investigate the innate behavior of either cell type in culture. Here we describe a system of sorting based on the gentle enzymatic digestion of cells using collagenase and dispase followed by magnetic activated cell sorting (MACS) which gives both a high purity (&#62;95% myogenic cells) and good yield (~2.8 x 106 &#177; 8.87 x 105 cells/g tissue after 7 days in vitro) for experiments in culture. This approach is based on incubating the mixed muscle-derived cell population with magnetic microbeads beads conjugated to an antibody against CD56 and then passing cells though a magnetic field. CD56+ cells bound to microbeads are retained by the field whereas CD56&#8211; cells pass unimpeded through the column. Cell suspensions from any stage of the sorting process can be plated and cultured. Following a given intervention, cell morphology, and the expression and localization of proteins including nuclear transcription factors can be quantified using immunofluorescent labeling with specific antibodies and an image processing and analysis package.

The main adherent cell types derived from human muscle are myogenic cells and fibroblasts. Here, cell populations are enriched using magnetic-activated cell sorting based on the CD56 antigen. Subsequent immunolabelling with specific antibodies and use of image analysis techniques allows quantification of cytoplasmic and nuclear characteristics in individual cells.

인간의 골격근에서 기본 근육 조직 세포와 섬유 아 세포의 분리 및 정량 면역 세포 화학 특성

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated ...

Isolation and Enrichment of Human Adipose-derived Stromal Cells for Enhanced Osteogenesis

Bone marrow-derived mesenchymal stromal cells (BM-MSCs) are considered the gold standard for stem cell-based tissue engineering applications. However, the process by which they must be harvested can be associated with significant donor site morbidity. In contrast, adipose-derived stromal cells (ASCs) are more readily abundant and more easily harvested, making them an appealing alternative to BM-MSCs. Like BM-MSCs, ASCs can differentiate into osteogenic lineage cells and can be used in tissue engineering applications, such as seeding onto scaffolds for use in craniofacial skeletal defects. ASCs are obtained from the stromal vascular fraction (SVF) of digested adipose tissue, which is a heterogeneous mixture of ASCs, vascular endothelial and mural cells, smooth muscle cells, pericytes, fibroblasts, and circulating cells. Flow cytometric analysis has shown that the surface marker profile for ASCs is similar to that for BM-MSCs. Despite several published reports establishing markers for the ASC phenotype, there is still a lack of consensus over profiles identifying osteoprogenitor cells in this heterogeneous population. This protocol describes how to isolate and use a subpopulation of ASCs with enhanced osteogenic capacity to repair critical-sized calvarial defects.

The transcriptional heterogeneity within human adipose-derived stromal cells can be defined on the single cell level using cell surface markers and osteogenic genes. We describe a protocol utilizing flow cytometry for the isolation of cell subpopulations with increased osteogenic potential, which may be used to enhance craniofacial skeletal reconstruction.

분리 및 인간의 농축 향상된 골 연장술에 대한 기질 세포를 지방이 유래

Bone marrow-derived mesenchymal stromal cells (BM-MSCs) are considered the gold standard for stem cell-based tissue engineering applications. However, the ...

Isolation of Neural Stem/Progenitor Cells from the Periventricular Region of the Adult Rat and Human Spinal Cord

Adult rat and human spinal cord neural stem/progenitor cells (NSPCs) cultured in growth factor-enriched medium allows for the proliferation of multipotent, self-renewing, and expandable neural stem cells. In serum conditions, these multipotent NSPCs will differentiate, generating neurons, astrocytes, and oligodendrocytes. The harvested tissue is enzymatically dissociated in a papain-EDTA solution and then mechanically dissociated and separated through a discontinuous density gradient to yield a single cell suspension which is plated in neurobasal medium supplemented with epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), and heparin. Adult rat spinal cord NSPCs are cultured as free-floating neurospheres and adult human spinal cord NSPCs are grown as adherent cultures. Under these conditions, adult spinal cord NSPCs proliferate, express markers of precursor cells, and can be continuously expanded upon passage. These cells can be studied in vitro in response to various stimuli, and exogenous factors may be used to promote lineage restriction to examine neural stem cell differentiation. Multipotent NSPCs or their progeny can also be transplanted into various animal models to assess regenerative repair.

The adult mammalian spinal cord contains neural stem/progenitor cells (NSPCs) that can be isolated and expanded in culture. This protocol describes the harvesting, isolation, culture, and passaging of NSPCs generated from the periventricular region of the adult spinal cord from the rat and from human organ transplant donors.

뇌실 주위 백질 성인 쥐의 지역 및 인간의 척수에서 신경 줄기 / 전구 세포의 분리

Adult rat and human spinal cord neural stem/progenitor cells (NSPCs) cultured in growth factor-enriched medium allows for the proliferation of ...

Isolation and Characterization of Satellite Cells from Rat Head Branchiomeric Muscles

Fibrosis and defective muscle regeneration can hamper the functional recovery of the soft palate muscles after cleft palate repair. This causes persistent problems in speech, swallowing, and sucking. In vitro culture systems that allow the study of satellite cells (myogenic stem cells) from head muscles are crucial to develop new therapies based on tissue engineering to promote muscle regeneration after surgery. These systems will offer new perspectives for the treatment of cleft palate patients. A protocol for the isolation, culture and differentiation of satellite cells from head muscles is presented. The isolation is based on enzymatic digestion and trituration to release the satellite cells. In addition, this protocol comprises an innovative method using extracellular matrix gel coatings of millimeter size, which requires only low numbers of satellite cells for differentiation assays.

This protocol describes the isolation of satellite cells from branchiomeric head muscles of a 9 week-old rat. The muscles originate from different branchial arches. Subsequently, the satellite cells are cultured on a spot coating of millimeter size to study their differentiation. This approach avoids the expansion and passaging of satellite cells.

쥐 머리 Branchiomeric 근육에서 분리 및 위성 세포의 특성

Fibrosis and defective muscle regeneration can hamper the functional recovery of the soft palate muscles after cleft palate repair. This causes persistent ...

Isolation and Characterization of Single Cells from Zebrafish Embryos

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been described at the morphological level, little is known about the molecular basis of cellular changes that occur as the organism develops. With recent advancements in microfluidics and multiplexing technologies, it is now possible to characterize gene expression in single cells. This allows for investigation of heterogeneity between individual cells of specific cell populations to identify and classify cell subtypes, characterize intermediate states that occur during cell differentiation, and explore differential cellular responses to stimuli. This study describes a protocol to isolate viable, single cells from zebrafish embryos for high throughput multiplexing assays. This method may be rapidly applied to any zebrafish embryonic cell type with fluorescent markers. An extension of this method may also be used in combination with high throughput sequencing technologies to fully characterize the transcriptome of single cells. As proof of principle, the relative abundance of cardiac differentiation markers was assessed in isolated, single cells derived from nkx2.5 positive cardiac progenitors. By evaluation of gene expression at the single cell level and at a single time point, the data support a model in which cardiac progenitors coexist with differentiating progeny. The method and work flow described here is broadly applicable to the zebrafish research community, requiring only a labeled transgenic fish line and access to microfluidics technologies.

This protocol describes a method for isolating single cells from zebrafish embryos, enriching for cells of interest, capturing zebrafish cells in microfluidic based single cell multiplex systems, and assessing gene expression from single cells.

분리 및 Zebrafish의 배아에서 단일 세포의 특성

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been ...

Isolation and Expansion of Mesenchymal Stem/Stromal Cells Derived from Human Placenta Tissue

Mesenchymal stem/stromal cells (MSC) are promising candidates for use in cell-based therapies. In most cases, therapeutic response appears to be cell-dose dependent. Human term placenta is rich in MSC and is a physically large tissue that is generally discarded following birth. Placenta is an ideal starting material for the large-scale manufacture of multiple cell doses of allogeneic MSC. The placenta is a fetomaternal organ from which either fetal or maternal tissue can be isolated. This article describes the placental anatomy and procedure to dissect apart the decidua (maternal), chorionic villi (fetal), and chorionic plate (fetal) tissue. The protocol then outlines how to isolate MSC from each dissected tissue region, and provides representative analysis of expanded MSC derived from the respective tissue types. These methods are intended for pre-clinical MSC isolation, but have also been adapted for clinical manufacture of placental MSC for human therapeutic use.

Herein we describe methods for the dissection of fetal and maternal tissues from human term placenta, followed by isolation and expansion of mesenchymal stem/stromal cells (MSC) from these tissues.

인간 태반 조직에서 추출 분리 및 중간 엽 줄기의 확장 / 기질 세포

Mesenchymal stem/stromal cells (MSC) are promising candidates for use in cell-based therapies. In most cases, therapeutic response appears to be cell-dose ...

Isolation of Endothelial Progenitor Cells from Human Umbilical Cord Blood

The existence of endothelial progenitor cells (EPCs) in peripheral blood and its involvement in vasculogenesis was first reported by Ashara and colleagues1. Later, others documented the existence of similar types of EPCs originating from bone marrow2,3. More recently, Yoder and Ingram showed that EPCs derived from umbilical cord blood had a higher proliferative potential compared to ones isolated from adult peripheral blood4,5,6. Apart from being involved in postnatal vasculogenesis, EPCs have also shown promise as a cell source for creating tissue-engineered vascular and heart valve constructs7,8. Various isolation protocols exist, some of which involve the cell sorting of mononuclear cells (MNCs) derived from the sources mentioned earlier with the help of endothelial and hematopoietic markers, or culturing these MNCs with specialized endothelial growth medium, or a combination of these techniques9. Here, we present a protocol for the isolation and culture of EPCs using specialized endothelial medium supplemented with growth factors, without the use of immunosorting, followed by the characterization of the isolated cells using Western blotting and immunostaining.

The goal of this protocol is to isolate endothelial progenitor cells from umbilical cord blood. Some of the applications include using these cells as a biomarker for identifying patients with cardiovascular risk, treating ischemic diseases, and creating tissue-engineered vascular and heart valve constructs.

인간 탯 줄 혈액에서 내 피 조상 세포의 고립

The existence of endothelial progenitor cells (EPCs) in peripheral blood and its involvement in vasculogenesis was first reported by Ashara and ...

Isolation, Culture, and Differentiation of Bone Marrow Stromal Cells and Osteoclast Progenitors from Mice

Bone marrow stromal cells (BMSCs) constitute a cell population routinely used as a representation of mesenchymal stem cells in vitro. They reside within the bone marrow cavity alongside hematopoietic stem cells (HSCs), which can give rise to red blood cells, immune progenitors, and osteoclasts. Thus, extractions of cell populations from the bone marrow results in a very heterogeneous mix of various cell populations, which can present challenges in experimental design and confound data interpretation. Several isolation and culture techniques have been developed in laboratories in order to obtain more or less homogeneous populations of BMSCs and HSCs invitro. Here, we present two methods for isolation of BMSCs and HSCs from mouse long bones: one method that yields a mixed population of BMSCs and HSCs and one method that attempts to separate the two cell populations based on adherence. Both methods provide cells suitable for osteogenic and adipogenic differentiation experiments as well as functional assays.

In this article, we present methods to isolate and differentiate bone marrow stromal cells and hematopoietic stem cells from mouse long bones. Two different protocols are presented yielding different cell populations suitable for expansion and differentiation into osteoblasts, adipocytes, and osteoclasts.

절연, 문화, 및 골 수 기질 세포와 생쥐에서 Osteoclast 창시자의 차별화

Bone marrow stromal cells (BMSCs) constitute a cell population routinely used as a representation of mesenchymal stem cells in vitro. They reside within ...

Isolation and Characterization of Cardiac Mesenchymal Stromal Cells from Endomyocardial Bioptic Samples of Arrhythmogenic Cardiomyopathy Patients

A normal adult heart is composed of several different cell types, among which cardiac mesenchymal stromal cells represent an abundant population. The isolation of these cells offers the possibility of studying their involvement in cardiac diseases, and, in addition, provides a useful primary cell model to investigate biological mechanisms.
Here, the method for the isolation of C-MSC from arrhythmogenic cardiomyopathy patients&#39; bioptic samples is described. The endomyocardial biopsy sampling is guided in the right ventricular areas adjacent to the scar visualized by electro-anatomical mapping. The digestion of the biopsies in collagenase and their plating on a plastic dish in culture medium to allow C-MSC growth is described. The isolated cells can be expanded in culture for several passages. To confirm their mesenchymal phenotype, the description of immuno-phenotypical characterization is provided. C-MSC are able to differentiate into several cell types like adipocytes, chondrocytes, and osteoblasts: in the context of ACM, characterized by adipocyte deposits in patients&#39; hearts, the protocols for the adipogenic differentiation of C-MSC and the characterization of lipid droplet accumulation are described.

In this article, a method to isolate cardiac mesenchymal stromal cells from endomyocardial bioptic samples of arrhythmogenic cardiomyopathy patients is provided. Their characterization and the protocol to boost their adipogenic differentiation are described.

절연 및 Endomyocardial Bioptic 샘플의 Arrhythmogenic 심장 근육 병 증 환자에서 심장 중간 엽 기질 세포의 특성

A normal adult heart is composed of several different cell types, among which cardiac mesenchymal stromal cells represent an abundant population. The ...