Name: generation of prostate cancer cell models of resistance to the anti-mitotic agent docetaxel
Uploaded: 2017-09-08T12:15:00.000+00:00
Duration: 6 min 44 s
Description: Watch this Scientific Journal Video about Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel at JoVE.com

V.R.-B. 건강의 미국 부 로부터 자금을 받습니다 &#38; 번호 1를 부여 하는 인간 서비스, 국립 보건원, 국립 암 연구소 K22 CA207458-01 '과 법학. 건강의 미국 부 로부터 자금을 받습니다 &#38; 번호 1를 부여 하는 인간 서비스, 국립 보건원, 국립 암 연구소 R01 CA207311-01.

1. 식민지 형성 능력 (IC50)에서 50%를 일으키는 Docetaxel 농도 감소 참고:이 프로토콜에서 Docetaxel IC50 농도 평가 식민지 형성을 사용 하 여 능력입니다. 조사에 따라 세포 생존 능력 (즉, MTS 분석 실험)를 평가 하는 데 사용 하는 대체 메서드를 사용할 수 있습니다 &#39; 환경 설정.
<ol><li>성장 DU145 또는 22Rv1 75 cm 2 플라스 크에 세포와 10mm Docetaxel 미래 실험에 사용 되는 DMSO에 희석의 충분 한 재고를 준비.</li>
	<li>IC50 Docetaxel의 결정에 대 한 셀을 접시, 플라스 크에서 미디어를 제거, 신중 하 게 씻어 5 mL PBS, 셀 및 2 mL 0.05% 품 어 세포를 플라스 크 표면에서 분리를 37 ° C에서 3-5 분에 대 한 트립 신-EDTA.</li>
	<li>신선한 미디어의 5 mL을 사용 하 여 플라스 크에서 trypsinized 셀 린스 하 고 15 mL 튜브에 세포 현 탁 액을 수집 합니다. 원심 (300 x g, 3 분, 실 온 (RT))에 의해 셀을 펠 렛.</li>
	<li>는 상쾌한 제거 하 고 신선한 미디어의 5 mL에 셀 펠 릿 resuspend는 셀. 2-2.5 x 10 5 셀/mL DU145 및 22Rv1에 대 한 10 5 셀/mL x 4-4.5 세포 현 탁 액을 희석 아래로 pipetting으로 잘 혼합 하 고 두 6 잘 플레이트의 각 음에 서 스 펜 션의 2 개 mL를 씨앗.</li>
	<li>후 24 h, 70-80% 합류에 셀 때 추가 복용량 고조 Docetaxel 농도 1 nM, 2.5 nM, 5 nM, 10 nM, 25 nM, 50 nM, 100 nM, 250 nM, 500 nM, 그리고 각 잘 1000 nM. DMSO와 잘 컨트롤 Docetaxel ( 그림 2A)에 사용 되는 높은 볼륨에서 취급.</li>
	<li>후 72 h 발음 마약 미디어를 포함 하 고 신선한 미디어의 2 개 mL를 추가 합니다. 약 4-5 일 이내 번호판 얼룩에 대 한 준비가 될 것입니다.</li>
	<li>식민지, 얼룩에 부드럽게 2-3 mL PBS로 세척 하 고 조직 문화 후드 또는 증기 두건 안쪽 20 분 동안 2-3 mL 크리스탈 바이올렛 솔루션 (0.1 w/v %10% 포 르 말린에) 그들을 품 어.</li>
	<li>H 2 O 2-3 mL에 대 한 솔루션 및 세척의 접시 얼룩 제거, H 2 O를 제거 하 고 접시 건조.</li>
	<li>어느 Docetaxel 농도 50% (IC50) 세포 생존 능력을 감소 하는 확인 하려면 우물을 시각화 하 여 결과 분석 합니다. 수동으로 ()을 피하기 위해 같은 식민지를 두 번 계산 마커 펜의 도움으로 식민지를 계산 하 고 그래프 ( 그림 2A)에서 세포 생존 능력의 비율을 나타냅니다. 마지막으로, ( 그림 3A에서 같이) 그림 표현에 대 한 번호판의 디지털 이미지를 받아.</li>
</ol> 2. Docetaxel 내성 전립선 암 세포의 생성 참고: 세포 치료 같은 Docetaxel 솔루션 주식 결심 IC50 약의 사용을 사용 하 여 수행 (사전에 충분 한 재고를 준비 실험 사용 하 여). 항상 뭔가 잘 작동 하지 않는 경우에 이전 단계에서 세포의 작은 술병을 유지. 부모의 셀을 전체 절차를 통해 작은 술병에 병렬로 성장 하 고 Docetaxel 취급 플라스 크에 사용 금액을 흉내 낸 해당 볼륨에서 차량 (DMSO)에 노출 한다.
<ol><li>미디어의 20 mL를 포함 하는 150 cm 2 플라스 크에 접시 DU145 또는 22Rv1 셀 (3.5 x 10 6 세포 플라스 크 당 DU145 및 6.5 * 10에 대 한 22Rv1에 대 한 플라스 크 당 6 셀). 10 ~ 20 셀의 플라스 크를 사용 하 여 프로토콜의 끝에 충분 한 세포를가지고 것이 좋습니다.</li>
	<li>후 24 h, 세포는 약 70-80%에서 합류 ( 그림 2B, Docetaxel 전에), 프로토콜의 1 단계에서 결정 IC50 농도에서 Docetaxel 추가 (5이이 프로토콜에서 설명 하는 셀에 대 한 nM).</li>
	<li>후 72 h 발음 마약 미디어를 포함 하 고 신선한, Docetaxel 무료 미디어 ( 그림 2B, Docetaxel 후 72 h)를 추가 합니다. 모든 3-4 일 미디어를 변경 합니다. 약 1-2 주 이내 저항 클론 ( 그림 2B, Docetaxel 후 7 ~ 14 일) 현미경 분명 나타납니다.</li>
	<li>미디어 발음, 신중 하 게 씻어 15 mL PBS와 셀 및 4 mL 0.05% 품 어 세포를 플라스 크 표면에서 분리를 37 ° C에서 3-5 분에 대 한 트립 신-EDTA.</li>
	<li>Resuspend 8 mL 신선한 매체를 사용 하 여 플라스 크에서 trypsinized 셀. 모든 치료 플라스 크에서 수영장 셀입니다. 원심 (300 x g, 3 분, RT)에 의해 셀을 펠 렛.</li>
	<li>제거는 상쾌한, 셀 펠 릿 20 ml 신선한 매체의 resuspend와 150 cm 2 플라스 크에 세포 격판덮개 (3.5 x 10 6 세포 플라스 크 당 DU145 및 6.5 * 10에 대 한 22Rv1에 대 한 플라스 크 당 6 셀).</li>
	<li>후 24 h, 세포는 약 70-80%에서 합류, 추가 5 nM Docetaxel (초기 IC50 농도) 다시.</li>
	<li>2.3 2.6에 하루 3 단계를 반복 합니다.</li>
	<li>후 24 h, 세포는 약 70-80%에서 합류, 2 X IC50 Docetaxel 농도와 치료 세포 (10 nM이이 프로토콜에서 설명 하는 셀에 대 한).</li>
	<li>반복 2.3을 2.8, Docetaxel 농도의 복용량 단계적 확대를 다음 단계 (25 nM, 50 nM, 100 nM와 250 nM), 최종 높은 농도에서 플라스 크에서 성장 하는 세포의 안정 되어 있는 인구를 생성. 최대 6 개월 1000 nM 농도 ( 그림 1A)를 도달할 때까지 높은 농도 대 한 복용량 에스컬레이션 프로토콜을 구현할 수 있습니다.</li>
</ol> 3. 기능 특성의 인수 Docetaxel 저항 식민지 대형 분석 결과 의해 참고:이 프로토콜 chemoresistance 평가 식민지 대형 분석 실험을 사용 하 여. 조사에 따라 세포 생존 능력 (즉, MTS 분석 실험)를 평가 하는 데 사용 하는 대체 메서드를 사용할 수 있습니다 &#39; 환경 설정.
<ol><li>접시 2000 셀 (DU145 또는 22Rv1, 보호자 및 Docetaxel 방지) 6-잘 접시에 잘, 당 사용 하 여 미디어의 2 mL 잘 당.</li>
	<li>후 24 h 추가 Docetaxel의 증가 농도 (부모의 셀: 0.25, 0.5, 1, 2.5 및 5 nM; 박사 셀: 50, 125, 250, 500 및 1000 nM). DU145 및 22Rv1 셀 라인에 대 한. 동일한 볼륨 높은 Docetaxel 복용량에 대 한 사용에서 컨트롤 한 잘에만 DMSO를 추가.</li>
	<li>72 h 후 미디어를 포함 하는 약물을 발음 하 고 신선한 Docetaxel 무료 미디어 추가.</li>
	<li>식민지 현미경 아래에서 표시 됩니다 때까지 1-2 주에 대 한 번호판을 품 어.</li>
	<li>식민지, 얼룩에 부드럽게 2-3 mL PBS로 세척 하 고 조직 문화 후드 또는 증기 두건 안쪽 20 분 동안 2-3 mL 크리스탈 바이올렛 솔루션 (0.1 w/v %10% 포 르 말린에) 그들을 품 어.</li>
	<li>H 2 O 2-3 mL에 대 한 솔루션 및 세척의 접시 얼룩 제거, H 2 O를 제거 하 고 접시 건조.</li>
	<li>우물을 시각화 하 고 수동으로 마커 펜 ()을 피하기 위해 같은 식민지를 두 번 계산의 도움으로 식민지를 계산 하 여 결과 분석 하 고 그래프에서 세포 생존 능력의 비율을 나타냅니다. 그림 표현 ( 그림 3A)에 대 한 번호판의 디지털 이미지.</li>
</ol> 4. Phenotypic 특성의 Docetaxel 저항 인수 형 qRT-PCR 분석 통해 참고: Docetaxel (DR) 내성 세포 전시 그들의 부모의 세포 라인에 비해 다른 식 프로필 28 , 29. 따라서 선택의 성공 qRT-PCR에 의해 확인할 수 있습니다 특정 표식에 대 한 프라이 머를 사용 하 여 (뇌관 시퀀스에 대 한 참조 자료 섹션; 대 한 자세한 내용은, 결과 섹션을 참조 하십시오). 이 세 번째 라운드 후 시작 선택의 각 라운드 후 할 수 있습니다. 또는, 서쪽 blotting에 의해 Docetaxel 저항 표현 형의 평가 또한 가능 하다.
<li>RNA 추출 키트를 사용 하 고 제조 업체에 따라 보호자와 Docetaxel 내성 세포에서 RNA 추출 <ol>&#39; s 지침 (테이블의 재료 및 시 약 대 한 자세한 내용은 참조). 최소를 사용 하 여 1-2 10 6 셀 x 좋습니다.</li>
	분 광 광도 계를 사용 하 여 <li>계량 RNA 260 nm absorbance 최고의 순도, 260 nm/280 nm 흡 광도 비율 2.0에 가까운 이어야 합니다.</li>
	<li>Perform 역방향 역방향 전송 키트를 사용 하 고 제조 업체에 따라 보완 DNA (cDNA)를 전사 &#39; s 지침 (참조 테이블의 자료와 정보에 대 한 시 약), 20 µ L에서 RNA의 1 µ g를 사용 하 여 반응 혼합 (cDNA의 높은 금액 필요한 경우, 그에 따라 반응 혼합 최대 규모).</li>
	<li>관심사의 각 유전자에 대 한 다음과 같은 3 중에서 정량 반응을 준비: -2 µ L 10 µ M 앞으로 뇌관의 -2 µ L 10 µ M 역 뇌관의 -10 µ L SYBR 녹색 PCR 마스터 믹스 -5 µ L H 2 O -1 µ L의 4.3 단계에서 새로 준비 된 cDNA. 
	주:이 프로토콜에 사용 되는 뇌관의 시퀀스에 대 한 테이블의 자료를 참조 하십시오.</li>
	<li>PCR 프로그램을 다음과 같이 설정: -15 분 동안 95 ° C -94 ° C 30에 대 한 s | 
	-40 56 ° C s | 40 번 -72 ° C 30에 대 한 s |</li>
	<li>정량 결과 분석 하 고 부모의 사이 유전자 발현에 변화를 확인 하 고 박사 샘플, 관심사의 각 유전자의 사이클 임계값 (Ct) 값 3 중에 결정 됩니다 평균 로드 제어 (말라 triplicate 평균으로 정규화 ) 박사 (박사 Ct) 및 부모의 셀 (부모의 Ct). 부모 셀에 대 한 값을 1로 정규화 됩니다. ΔCt (Ct 박사-부모의 Ct) 최종 mRNA 배 변화를 결정 하 고 그래프에 표시. 증가 &#62; 2 또는의 감소 &#60; 0.5 중요 하 게 고려 하 고는 Docetaxel의 설립의 좋은 유효성 검사 인수 저항 형 ( 그림 3B).</li>
</ol>

<ol>
	<li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144 (5), 646-674 (2011).</li><li>Lapenna, S., Giordano, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+kinases+as+therapeutic+targets+for+cancer.">Cell cycle kinases as therapeutic targets for cancer.</a> Nature reviews. Drug discovery. 8 (7), 547-566 (2009).</li><li>Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+anti-mitotic+therapies:+can+we+improve+on+tubulin+agents?.">Targeted anti-mitotic therapies: can we improve on tubulin agents?.</a> Nature reviews. Cancer. 7 (2), 107-117 (2007).</li><li>Dumontet, C., Jordan, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microtubule-binding+agents:+a+dynamic+field+of+cancer+therapeutics.">Microtubule-binding agents: a dynamic field of cancer therapeutics.</a> Nature reviews. Drug discovery. 9 (10), 790-803 (2010).</li><li>Schiff, P. B., Fant, J., Horwitz, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Promotion+of+microtubule+assembly+in+vitro+by+taxol.">Promotion of microtubule assembly in vitro by taxol.</a> Nature. 277 (5698), 665-667 (1979).</li><li>Schiff, P. B., Horwitz, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Taxol+stabilizes+microtubules+in+mouse+fibroblast+cells.">Taxol stabilizes microtubules in mouse fibroblast cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 77 (3), 1561-1565 (1980).</li><li>Musacchio, A., Salmon, E. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+spindle-assembly+checkpoint+in+space+and+time.">The spindle-assembly checkpoint in space and time.</a> Nature reviews. Molecular cell biology. 8 (5), 379-393 (2007).</li><li>Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+road+to+cancer:+aneuploidy+and+the+mitotic+checkpoint.">On the road to cancer: aneuploidy and the mitotic checkpoint.</a> Nature reviews. Cancer. 5 (10), 773-785 (2005).</li><li>Derry, W. B., Wilson, L., Jordan, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Substoichiometric+binding+of+taxol+suppresses+microtubule+dynamics.">Substoichiometric binding of taxol suppresses microtubule dynamics.</a> Biochemistry. 34 (7), 2203-2211 (1995).</li><li>Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitotic+block+induced+in+HeLa+cells+by+low+concentrations+of+paclitaxel+(Taxol)+results+in+abnormal+mitotic+exit+and+apoptotic+cell+death.">Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death.</a> Cancer research. 56 (4), 816-825 (1996).</li><li>Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+mitosis+and+antimitotic+drug+responses+in+tumors+by+in+vivo+microscopy+and+single-cell+pharmacodynamics.">Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics.</a> Cancer research. 71 (13), 4608-4616 (2011).</li><li>Zasadil, L. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytotoxicity+of+paclitaxel+in+breast+cancer+is+due+to+chromosome+missegregation+on+multipolar+spindles.">Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles.</a> Science translational medicine. 6 (229), (2014).</li><li>Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+Mitosis+in+Cancer:+Emerging+Strategies.">Targeting Mitosis in Cancer: Emerging Strategies.</a> Molecular cell. 60 (4), 524-536 (2015).</li><li>Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+cancer+statistics,+2012.">Global cancer statistics, 2012.</a> CA: a cancer journal for clinicians. 65 (2), 87-108 (2015).</li><li>Petrylak, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Docetaxel+and+estramustine+compared+with+mitoxantrone+and+prednisone+for+advanced+refractory+prostate+cancer.">Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer.</a> The New England journal of medicine. 351 (15), 1513-1520 (2004).</li><li>Tannock, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Docetaxel+plus+prednisone+or+mitoxantrone+plus+prednisone+for+advanced+prostate+cancer.">Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer.</a> The New England journal of medicine. 351 (15), 1502-1512 (2004).</li><li>Sweeney, C. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemohormonal+Therapy+in+Metastatic+Hormone-Sensitive+Prostate+Cancer.">Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer.</a> The New England journal of medicine. 373 (8), 737-746 (2015).</li><li>Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathways+of+chemotherapy+resistance+in+castration-resistant+prostate+cancer.">Pathways of chemotherapy resistance in castration-resistant prostate cancer.</a> Endocrine-related cancer. 18 (4), R103-R123 (2011).</li><li>Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+silico+identified+targeted+inhibitors+of+P-glycoprotein+overcome+multidrug+resistance+in+human+cancer+cells+in+culture.">In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture.</a> Pharmacology research &amp; perspectives. 3 (5), e00170 (2015).</li><li>Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+beta-tubulin+isotype+expression+in+paclitaxel-resistant+human+prostate+carcinoma+cells.">Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells.</a> British journal of cancer. 77 (4), 562-566 (1998).</li><li>Martello, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elevated+levels+of+microtubule+destabilizing+factors+in+a+Taxol-resistant/dependent+A549+cell+line+with+an+alpha-tubulin+mutation.">Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation.</a> Cancer research. 63 (6), 1207-1213 (2003).</li><li>Lee, A. J. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosomal+instability+confers+intrinsic+multidrug+resistance.">Chromosomal instability confers intrinsic multidrug resistance.</a> Cancer research. 71 (5), 1858-1870 (2011).</li><li>Sansregret, L., Swanton, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Role+of+Aneuploidy+in+Cancer+Evolution.">The Role of Aneuploidy in Cancer Evolution.</a> Cold Spring Harbor perspectives in medicine. 7 (1), (2017).</li><li>Grasso, C. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mutational+landscape+of+lethal+castration-resistant+prostate+cancer.">The mutational landscape of lethal castration-resistant prostate cancer.</a> Nature. 487 (7406), 239-243 (2012).</li><li>Taylor, B. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+profiling+of+human+prostate+cancer.">Integrative genomic profiling of human prostate cancer.</a> Cancer cell. 18 (1), 11-22 (2010).</li><li>Gao, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+cultures+derived+from+patients+with+advanced+prostate+cancer.">Organoid cultures derived from patients with advanced prostate cancer.</a> Cell. 159 (1), 176-187 (2014).</li><li>Drost, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+culture+systems+for+prostate+epithelial+and+cancer+tissue.">Organoid culture systems for prostate epithelial and cancer tissue.</a> Nature Protocols. 11 (2), 347-358 (2016).</li><li>Domingo-Domenech, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+acquired+docetaxel+resistance+in+prostate+cancer+through+depletion+of+notch-+and+hedgehog-dependent+tumor-initiating+cells.">Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells.</a> Cancer cell. 22 (3), 373-388 (2012).</li><li>Vidal, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+targetable+GATA2-IGF2+axis+confers+aggressiveness+in+lethal+prostate+cancer.">A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer.</a> Cancer cell. 27 (2), 223-239 (2015).</li><li>Mar&#237;n-Aguilera, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+docetaxel+resistance+genes+in+castration-resistant+prostate+cancer.">Identification of docetaxel resistance genes in castration-resistant prostate cancer.</a> Molecular cancer therapeutics. 11 (2), 329-339 (2012).</li><li>Zhao, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+candidate+biomarkers+of+therapeutic+response+to+docetaxel+by+proteomic+profiling.">Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling.</a> Cancer research. 69 (19), 7696-7703 (2009).</li><li>Lin, H. -. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs+are+associated+with+docetaxel+chemotherapy+outcome+in+castration-resistant+prostate+cancer.">Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer.</a> British journal of cancer. 110 (10), 2462-2471 (2014).</li><li>Puhr, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-to-mesenchymal+transition+leads+to+docetaxel+resistance+in+prostate+cancer+and+is+mediated+by+reduced+expression+of+miR-200c+and+miR-205.">Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205.</a> The American journal of pathology. 181 (6), 2188-2201 (2012).</li><li>Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+GATA2+in+lethal+prostate+cancer+aggressiveness.">The role of GATA2 in lethal prostate cancer aggressiveness.</a> Nature reviews. Urology. 14 (1), 38-48 (2017).</li></ol>

저자 들은 아무 경쟁 금융 관심사 선언 합니다.

이 원고에서는 우리 chemoresistance 표현 형의 획득에 기여 하는 메커니즘의 연구에 대 한 수 Docetaxel 내성 전립선 암 세포 모델 시스템을 생성 하는 방법 설명. 이 접근은 매우 안정적이 고 재현, 일부 잠재적인 제한 사항은 고려해 야 합니다. 이후만 셀의 대량 인구의 극히 chemoresistance28을 전시할 것 이다, 것이 좋습니다 세포의 큰 인구와 함께 시작 (우리가 일반적으로 약 1.2 x 10에 대 한 계정을 150 cm2, 20 플라스 크 플레이트8 셀)입니다. 프로토콜의 주요 단계는 절차의 성공을 보장 하기 위해 고려 되어야 한다. 첫째, 그것은 매우 사용 같은 Docetaxel 갓 긴 기간 사용 (10 m m 재고-80 ° C에서에 제대로 저장 될 때 년에 aliquots를 사용할 수 있습니다)에 대 한 재고를 준비 하는 것이 중요. Aliquot Docetaxel에 약간의 변화 IC50, 셀 라인 타이밍의 세대의 결과 식민지 형성 결과 영향을 미칠 수 있습니다. 둘째, 그것은 유사 세포의 새로운 배치를 사용 하는 경우 발생할 수 있으므로 각 개별 셀 라인, IC50를 결정 하는 프로토콜을 시작 하는 중요 한. 셋째, 오류 수 있습니다 신속 하 게 감지 하 고 수정 현미경 세포를 자주 확인 하 여 약물 치료는 효과적인 모니터링에 필수적 이다. 마지막으로, 오염 또는 프로토콜 가운데 세포의 생존 능력에 영향을 미칠 수 있는 예기치 않은 문제 중간 단계의 재고를 항상 유지 하 고 좋습니다. 중요 한 것은, 우리의 프로토콜 72 h 뒤에 약의 더 낮은 일정 농도 보다는 긴 회복 기간, 최고의 모방 하려고 Docetaxel의 고용량을 전립선 암 세포를 노출 하 여 약물 내성의 모델을 생성 하는 것을 목표로 임상 시나리오가 taxane 에이전트15,16전립선 암 치료에 대 한 보고.
또한, 약물 내성 세포 전시 시간이 지남에 인수 저항 속성의 진보적인 손실로 이어질 수 있는 높은 소성을 주목 한다. 따라서 문화에 2-3 개월 이상에 대 한 이러한 세포를 사용 하 여 확장는 권장 하지 않습니다. 영구적인 공급 필요 하다 면 그것은 지속적으로 저항 세포의 새 일괄 처리를 생성 하는 것이 좋습니다. 그러나, 만약 셀의 일괄 처리 오랜된 시간 동안 경작 되는, 식민지 대형 분석 실험 및 정량 그들의 저항을 재평가 하 사용할 수 있습니다. 또 다른 대안은 72 h (500-1000 nM) Docetaxel의 높은 복용량으로 세포를 치료 하 여 말기 저항을 높일 것 이다. 1 ~ 2 주간의 회복 기간 후 phenotype 시험 될 수 있다 다시 정량 및 식민지 형성에 의해 분석 실험. 그것도 가능, 치료 세포의 aliquots (FBS, 10 %DMSO)에서 액체 질소에 저장을 권장 되지는 않지만. 그 후 동결-해 동 주기 chemoresistance 형 항상 다시 평가 해야 상기 방법으로 note 하시기 바랍니다.
이러한 경고에도 불구 하 고 우리28,29 등30,31,,3233 키 소설 세포를 식별 하기 위해 이러한 모델 시스템을 성공적으로 수 있었다 고 분자 메커니즘을 선도 높은 종양을 시작, 세포 생존, 용량과 Docetaxel 내성 세포에 공격. 이러한 암 세포 모델 시스템을 사용 하 여, 우리는 세포가 상피 및 전립선 관련 분화 마커의 부재와 대상의 overexpression 발달 특징 undifferentiated 형 전시 발견 (노치 및 고슴도치) 신호 경로, 화학요법 노출28살. 두 번째 연구에서 공개적으로 사용 가능한 환자 유전자 데이터 세트24,25, 함께이 모델을 사용 하 여 우리가 발견 그 초기 전사 요소 GATA2는 높은 overexpressed 전이성에 거세 저항 화학 요법에 저항력이 전립선 암 세포입니다. GATA2 신호 네트워크29IGF2 종속 다운스트림 키를 직접 활성화 하 여 세포의 생존을 증가 시킵니다. 특히, 이러한 연구 고급 전이성 전립선 암 공격34GATA2의 소설 키 역할을 식별 하는 데 도움이.
그것은 많은 다른 유형의 다양 한 화학요법 약물으로 치료 하는 암 중 널리 퍼진 약물 저항의 개발 Docetaxel과 전립선 암에 국한 되지 않습니다 하는 문제입니다. 실제로, 실험 모델의 가용성에 유사한 제한이 적용, 그리고 그것은 우리의 프로토콜 다른 암 종류 및 그들의 각각 chemoresistance 메커니즘 연구에 적용할 수 있습니다.
이 프로토콜에서 설명 된 대로 Docetaxel 저항 세포의 생성 chemoresistance의 소설 관련 분자 및 세포 메커니즘을 식별 하는 기능적 도구로 사용할 수 있습니다. 이는 높은 악성 전립선 암에 대 한 새로운 치료법의 개발 수 똑, 우리가이 질병에 대해 무엇을 알고 하 고 우리는 환자를 치료 하는 방법의 경계를 한 번 더 밀고 새로운 목표를 찾아내기에 문을 엽니다.

세포 주기 통제의 손실에 의해 발생 하는 확산의 증가 속도 암1의 특징입니다. 이 기능 속성 렌더링 암 세포 고유 셀 사이클의 주요 프로세스의 충실도에 따라 동안 S-및 M-단계는 다양 한 세포 주기 perturbing DNA 손상 또는 mitotic 결함을 유발 하는 약물의 개발을 주도하 고 있다. 비록 mitotic kinases 또는 모터 단백질의 억제제 같은 수많은 안티 mitotic 에이전트는 현재 개발 되 고 임상 시험된에서 레거시 microtubule 대상 에이전트 (Mta) 계속를 위한 유일한 임상 승인 된 접근 암2,,34유사 분열을 대상으로. Mta 중 불안정 (Vinblastine Vincristine, Vinorelbine) 또는 (taxane 파생 에이전트 Paclitaxel, Docetaxel 또는 Cabazitaxel) microtubules 안정화 및 그로 인하여 작동 mitotic 스핀 들5,6의 형성을 방지. 이 트리거는 스핀 들 어셈블리 검사점7,8, 장기간된 mitotic 체포와 배양된 세포9,10 에 최후 세포 죽음 및 종양11에에서 mitotic 결함에 결과 ,12 고 따라서 전립선 암13큰 다양 한 그들의 사이에서 암 치료에 유용.
전립선 암은 가장 자주 진단 암과 암의 주요 원인이 남자14죽음 관련. Antimitotic 에이전트 Docetaxel 등 전립선 암 환자의 생존 향상 되며이 질병15,,1617의 처리에서 주류. 불행히도, 초기 종양 수축 량에도 불구 하 고 종양 세포 치료 중 약물 저항 자주 개발. 몇 가지 세포 메커니즘 chemoresistance, apoptotic와 염증 경로, 규제 완화 등 활성화/overexpression ATP 묶는 카세트 운송업 자 같은 마약 경과 펌프의 개발 원인에 연루 되어 P-당단백질 (P-gp/ABCB1), 후자는 결과 셀18,19에서 화학요법 에이전트의 수출. Taxanes 저항 또한 tubulin isotypes 또는 tubulin 돌연변이, 약물 및 그 대상 20,21사이의 상호 작용을 방지 하는 식의 변화와 같은 다른 원인으로 연결 되었습니다. 또한, 저항 게놈 불안정성 축적 및 종양이22,23관련 되어 있다. 그러나, taxane 저항에 기여 하는 메커니즘은 완전히 이해 되지,는 분명 모양을 방지 하는 치료 전략의 부재. 따라서, 이러한 메커니즘의 해 부에 지원 실험 모델을 생성 하 고 이러한 약물 저항의 개발을 방지 하는 새로운 치료 접근을 식별 하는 긴급 한 필요가 있다.
이 문서에서 우리는 전립선 암 세포 Docetaxel 저항 (DR)의 생성을 허용 하는 방법을 설명 합니다. 추가 저항 상태 식민지 대형 분석 실험 및 양적 RT-PCR를 사용 하 여 이러한 셀의 유효성을 검사 하는 방법을 설명 합니다. 이 메서드에 의해 생성 세포 분자 기능을 통해 다양 한 실험적인 분석 실험을 수행 하는 융통성을 제공 하는 추가 혜택으로 공개적으로 사용 가능한 인간 종양 샘플 데이터베이스에서 발견의 많은 업과의 이점을 종양 샘플에서 허용 하는 것 보다 시간의 긴 기간 치료 저항의 이러한 암 모델 수 많은 주 조직 문화, 그리고 다른 접근 들에 대 한 확장, 유전자 조작, 현미경 검사 법 방법으로 시각 고 유전자 발현에 대 한 분석. 또한, 추가로 종양 형성 및 성장 vivo에서 효과 분석 하는 쥐에 xenotrasplanted 수 있습니다. 현재, 전립선 암의 맥락에서 약물 내성 연구를 주요 대체 방법 종양 샘플의 직접 분석 이다. 이러한 샘플 유전자 발현 및 주어진된 종양의 mutational 상태에 대 한 정보를 수집 하는 매우 강력한 시스템을 제시 하는 동안 그들에 게 액세스 매우 제한 될 수 있습니다 그리고 그들은 더 조작 및 실험 분석에 대 한 유지 하기 어려운이 이 프로토콜24,25생성 된 셀 라인으로 쉽게 할 수 있습니다. 중요 한 것은, 미래에 대안 같은 환자에서 인간의 파생된 organoids의 생성 될 것 이라고 매우 강력한 도구 현재 메서드26,27대안 접근 한다. 이후 그들은 어떤 종양은 그것의 원래 환경에서 3D 컨텍스트에서 정리 것 이다, organoids 세포와 인간 종양 사이의 완벽 한 모델 될 것입니다. 그러나,이 프로토콜에서 설명 하는 실험 셀 모델은 여전히 더 많은 유지 저렴 하 고 빠른 분석에 적합. 이러한 세포 선을 공부 하 여 얻은 결과를 추정 하 고 인간의 샘플 및 3 차원 문화에서 확인 수 있습니다. 따라서,이 프로토콜은 우리의 프로토콜은 다른 약물과 암 종류의 연구에 적용할 수 있습니다 이후 어떤 셀 라인 chemoresistance 메커니즘 연구를 셀 모델을 추구 하는 연구원에 대 한 관심의 수 있습니다. 여기에 설명 된 메서드는 어떤 실험실, 저렴 한 가격에 적용 하 고 약물 내성의 분자 및 세포 메커니즘의 예비 연구를 허용 쉽습니다.

<table><tbody><tr><td>DU145 cells</td><td>ATCC</td><td>HTB-81</td><td></td></tr><tr><td>22Rv1 cells</td><td>ATCC</td><td>CRL-2505</td><td></td></tr><tr><td>Docetaxel</td><td>Selleck Chemicals</td><td>S1148</td><td>in DMSO (10mM)</td></tr><tr><td>Tissue culture flask 150cm&lt;sup&gt;2&lt;/sup&gt;</td><td>Falcon</td><td>355001</td><td></td></tr><tr><td>6-well tissue culture plates</td><td>Falcon</td><td>353046</td><td></td></tr><tr><td>RPMI 1640 Medium</td><td>Gibco</td><td>11875093</td><td>Supplemented with 10% FBS and 1% Penicilin/Streptomycin</td></tr><tr><td>Foundation B Fetal Bovine Serum</td><td>Gemini</td><td>900208</td><td></td></tr><tr><td>1X Phosphate-Buffered Saline (PBS)</td><td>Corning</td><td>21-040-CM</td><td></td></tr><tr><td>0.05%Trypsin-EDTA</td><td>Gibco</td><td>25300-062</td><td></td></tr><tr><td>Penicillin-Streptomycin</td><td>Gibco</td><td>15140122</td><td></td></tr><tr><td>RNeasy Mini Kit</td><td>Qiagen</td><td>74106</td><td></td></tr><tr><td>SuperScript III first strand synthesis system for RT-PCR</td><td>Invitrogen</td><td>18080051</td><td></td></tr><tr><td>Power SYBR Green PCR Master Mix</td><td>Invitrogen</td><td>4367659</td><td></td></tr><tr><td>Crystal Violet</td><td>Sigma-Aldrich</td><td>C0775</td><td></td></tr><tr><td>10% Formalin Solution</td><td>Sigma-Aldrich</td><td>HT501128</td><td></td></tr><tr><td>Primers for qRT-PCR:</td><td>Life technologies</td><td></td><td></td></tr><tr><td>CK19 F: CTGCGGGACAAGATTCTTGGT</td><td></td><td></td><td></td></tr><tr><td>CK19 R: CCAGACGGGCATTGTCGAT</td><td></td><td></td><td></td></tr><tr><td>CDH1 F: GGAAGTCAGTTCAGACTCCAGCC</td><td></td><td></td><td></td></tr><tr><td>CDH1 R: AGGCCTTTTGACTGTAATCACACC</td><td></td><td></td><td></td></tr><tr><td>ABCB1 F: TGTTCAAACTTCTGCTCCTGA</td><td></td><td></td><td></td></tr><tr><td>ABCB1 R: CCCATCATTGCAATAGCAGG</td><td></td><td></td><td></td></tr><tr><td>GATA2 F: CATCAAGCCCAAGCGAAGA</td><td></td><td></td><td></td></tr><tr><td>GATA2 R: TTTGACAGCTCCTCGAAGCA</td><td></td><td></td><td></td></tr><tr><td>ACTIN F: CATGTACGTTGCTATCCAGGC</td><td></td><td></td><td></td></tr><tr><td>ACTIN R: CTCCTTAATGTCACGCACGAT</td><td></td><td></td><td></td></tr></tbody></table>

generation of prostate cancer cell models of resistance to the anti-mitotic agent docetaxel

Microtubule 대상 에이전트 (Mta)는 다양 한 종양의 치료에 주류. 그러나, 화학요법 약물에 저항을 획득된 질병 진행의 공통 메커니즘 및 악성 종양의 전조 결정 기능 이다. 전립선 암 (PC), taxane Docetaxel 같은 Mta에 저항 치료 실패 뿐만 아니라 빈약한 예 지 및 높은 사망 율에 의해 정의 된 질병의 치명적인 단계 향해 진행을 지시 한다. 수십 년 동안 공부, 인수 저항에 기여 하는 메커니즘의 배열 완전히 이해 되지 않는다 고 따라서 이러한 고급 단계에 있는 환자를 유익할 수 있던 새로운 치료 전략의 개발에 상당한 제한이 포즈 질병입니다. 이 프로토콜에서 설명 하는 단계의 전립선 암의 치명적인 기능을 모방 하는 메커니즘을 연구 하는 데 사용할 수 있습니다 Docetaxel 내성 전립선 암 세포 라인의 세대는 인수 chemoresistance에 의해 발생. 잠재적인 제한 시간이 지남에, 저항 속성의 손실 등 셀 기반 모델에 내장에 불구 하 고이 메서드에 의해 생성 Docetaxel 저항 셀 라인 성공적으로 최근 연구에서 사용 된 및 발전 기회를 제공 우리의 치명적인 전립선 암에 인수 chemoresistance의 분자 이해.

이 의정서는 Docetaxel 저항 (DR) 전립선 암 세포의 생성으로 이어질 것입니다. 완료에 대 한 타임 라인 프로토콜의 단계 그림 1A 와 그림 1B의 도식 표현에 요약 된 대로 7 개월 4에서 범위 수 있습니다. 시간 투자 수 선택의 셀 라인 및 프로토콜에 설명 된 대로 사용 하는 약물 농도의 범위에 따라 달라 집니다. 중요 한 것은, 각 셀 라인 Docetaxel IC50 농도의 결정 선택 (그림 2A)의 셀에 대 한 프로토콜에서 사용 하 여 농도 범위를 확대 하는 약물의 디자인 수 있습니다. 프로토콜이 시작 되 면 모니터링 프로토콜 제대로 작동 하는 경우를 현미경 아래 다른 시간 지점에서 DU145 및 22Rv1 세포에 초기 Docetaxel 효과 관찰할 수 있습니다. 시간 포인트 Docetaxel 처리 과정을 모니터링 하는 제안: 72 h, 7 일 및 14 일에 대 한 Docetaxel 노출 후 Docetaxel 노출 (초기), 전에. 종양 세포의 단지 소수 민족 Docetaxel 노출 생존과 생성 (그림 2B) 현미경 관찰 될 수 있는 클론 note.
대표적인 식민지 대형 분석 실험 및 보호자의 부 량 그래프와 새로 생성 된 Docetaxel (DR) 내성 세포 그림 3A에서 표시 됩니다. Note 생성된 Docetaxel 내성 세포 약물 농도 부모의 셀 보다 더 높은 최대 1,000-fold 살아남을 수 있습니다.
마지막으로, Docetaxel 저항 표현 형 qRT-PCR (그림 3B)에 의해 유효성 수 있습니다. Note Docetaxel 내성 세포, 부모 세포에 비해 특성 최대-ABCB1 GATA2의 규정과 다운 레 귤 레이 션 CK19 및 CDH1의 표시. 때문에 우리는 이미 실험적으로 우리의 이전 게시 작업 GATA2 upregulation에 두 박사 셀 모델,2829CDH1 함께 CK19의 downregulation이이 유전자는 유효성 검사에 대 한 선정 됐다. ABCB1 유전자 약물 내성 세포18,19upregulated 일관 되도록 다른 사람에 의해 표시 되었습니다 주식 유전자로도 선정 되었다. 그러나, 그것은 문학에 따르면 고 셀 모델와 연구원에 의해 저항 세포 생성을 위해 선택 하는 약물에 따라 다른 유전자를 선택할 수 있습니다 주의 하는 것이 중요.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56327/56327fig1.jpg"> 
그림 1: Docetaxel 내성 전립선 암 세포 모델의 생성에 대 한 타임 라인. (A) Docetaxel 저항 셀 모델의 생성에 대 한 프로토콜 타임 라인의 대표 다이어그램. 그림 묘사 Docetaxel 처리, 유효성 검사 단계 및 각 부분에 필요한 시간. 보호자 및 Docetaxel 방지 셀 (빨간색)에서 72 h에 대 한 표시 Docetaxel 농도와 치료의 기능 식민지 대형 분석 실험을 포함 하는 프로토콜의 유효성 검사 단계 (B) 회로도 표현을 대표 식민지 비율과 qRT-PCR phenotypic 유효성 검사에 대 한 그래프. <a href="//ecsource.jove.com/files/ftp_upload/56327/56327fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56327/56327fig2.jpg"> 
그림 2: Docetaxel 내성 전립선 암 세포 모델 시스템의 생성. (A) 다이어그램 부모의 전립선 암 세포 선 DU145 및 22Rv1에서에서 Docetaxel IC50의 묘사 (프로토콜의 1 단계). 세포 생존 능력 및 복용량 고조 농도 필요 Docetaxel의 예상된 비율 포함 되어 있습니다. 대표 DU145 및 22Rv1 세포 생존 그래프 5를 나타내는 IC50 Docetaxel 노출의 72 h 포함 후로 nM. 실험은 triplicates 및 데이터 DU145의 평균 ± sd (B). 대표적인 밝은 분야 현미경 이미지 나타내고 22Rv1 세포에서 Docetaxel 저항 (프로토콜의 2 단계)의 생성 하는 동안 시간 표시. 빨간색 화살표 프로토콜 완료 Docetaxel 저항 복제를 나타냅니다. 스케일 바 = 50 nm. <a href="//ecsource.jove.com/files/ftp_upload/56327/56327fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56327/56327fig3.jpg"> 
그림 3: Docetaxel 저항 셀 모델의 기능 및 phenotypic 특성. (A) 보호자 및 Docetaxel 방지 셀 표시 Docetaxel 농도 72 h. 식민지의 비율에 대 한 모든 치료 농도 포함된 그래프에 표시 됩니다에 대 한 치료의 대표적인 식민지 대형 분석. 실험은 triplicates 및 데이터가 나타내는 sd. 스케일 바 평균 ± 5 mm. (B) 박사/부모의 상대 mRNA 배 증가 = ABCB1의 qRT-PCR에 의해 계량 GATA2, CK19 및 CDH1 표시 됩니다. 말라에 모든 정량 원시 데이터 정규화 (자세한 내용은 프로토콜 참조). 실험은 triplicates 및 데이터 대표 평균 ± sd. * p &#60; 0.05. <a href="//ecsource.jove.com/files/ftp_upload/56327/56327fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel at JoVE.com

Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel

반대로 mitotic 에이전트 Docetaxel에 전립선 암 세포 모델의 생성

암 치료에 저항을 질병의 진행 및 죽음에 기여 한다. 저항의 기계 론 적인 토대를 결정 하는 것입니다 치료 응답을 개선 하기 위한 중요 한. 이 원고 전립선 암 경로 해 부 하기 (PC)의 taxane 저항 셀 모델을 생성 하는 프로토콜 PC 환자에서 Docetaxel 저항 진행에 관련 된 세부 사항.

Microtubule targeting agents (MTAs) are a mainstay in the treatment of a wide range of tumors. However, acquired resistance to chemotherapeutic drugs is a ...

generation-prostate-cancer-cell-models-resistance-to-anti-mitotic

Research

JoVE Journal

Cancer Research

13.2K 조회수.  Icahn School of Medicine at Mount Sinai. 암 치료에 저항을 질병의 진행 및 죽음에 기여 한다. 저항의 기계 론 적인 토대를 결정 하는 것입니다 치료 응답을 개선 하기 위한 중요 한. 이 원고 전립선 암 경로 해 부 하기 (PC)의 taxane 저항 셀 모델을 생성 하는 프로토콜 PC 환자에서 Docetaxel 저항 진행에 관련 된 세부 사항.

비디오: Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel

A Bioluminescent and Fluorescent Orthotopic Syngeneic Murine Model of Androgen-dependent and Castration-resistant Prostate Cancer

Orthotopic tumor modeling is a valuable tool for pre-clinical prostate cancer research, as it has multiple advantages over both subcutaneous and transgenic genetically engineered mouse models. Unlike subcutaneous tumors, orthotopic tumors contain more clinically accurate vasculature, tumor microenvironment, and responses to multiple therapies. In contrast to genetically engineered mouse models, orthotopic models can be performed with lower cost and in less time, involve the use of highly complex and heterogeneous mouse or human cancer cell lines, rather that single genetic alterations, and these cell lines can be genetically modified, such as to express imaging agents. Here, we present a protocol to surgically injecting a luciferase- and mCherry-expressing murine prostate cancer cell line into the anterior prostate lobe of mice. These mice developed orthotopic tumors that were non-invasively monitored in vivo and further analyzed for tumor volume, weight, mouse survival, and immune infiltration. Further, orthotopic tumor-bearing mice were surgically castrated, leading to immediate tumor regression and subsequent recurrence, representing castration-resistant prostate cancer. Although technical skill is required to carry out this procedure, this syngeneic orthotopic model of both androgen-dependent and castration-resistant prostate cancer is of great use to all investigators in the field.

The goal of this protocol is to demonstrate the intra-prostatic injection of prostate cancer cells, with subsequent castration. Orthotopic pre-clinical models of androgen-dependent and castration-resistant prostate cancer are critical to study the disease in the context of a clinically relevant tumor microenvironment and an immunocompetent host.

발광 및 형광 Orthotopic Syngeneic Murine 모델 Androgen 종속 및 거세 내성 전립선 암

Orthotopic tumor modeling is a valuable tool for pre-clinical prostate cancer research, as it has multiple advantages over both subcutaneous and ...

연구

암 연구학

Generation of Tumor Organoids from Genetically Engineered Mouse Models of Prostate Cancer

Methods based on homologous recombination to modify genes have significantly furthered biological research. Genetically engineered mouse models (GEMMs) are a rigorous method for studying mammalian development and disease. Our laboratory has developed several GEMMs of prostate cancer (PCa) that lack expression of one or multiple tumor suppressor genes using the site-specific Cre-loxP recombinase system and a prostate-specific promoter. In this article, we describe our method for necropsy of these PCa GEMMs, primarily focusing on dissection of mouse prostate tumors. New methods developed over the last decade have facilitated the culture of epithelial-derived cells to model organ systems in vitro in three dimensions. We also detail a 3D cell culture method to generate tumor organoids from mouse PCa GEMMs. Pre-clinical cancer research has been dominated by 2D cell culture and cell line-derived or patient-derived xenograft models. These methods lack tumor microenvironment, a limitation of using these techniques in pre-clinical studies. GEMMs are more physiologically-relevant for understanding tumorigenesis and cancer progression. Tumor organoid culture is an in vitro model system that recapitulates tumor architecture and cell lineage characteristics. In addition, 3D cell culture methods allow for growth of normal cells for comparison to tumor cell cultures, rarely possible using 2D cell culture techniques. In combination, use of GEMMs and 3D cell culture in pre-clinical studies has the potential to improve our understanding of cancer biology.&#160;

We show a method for necropsy and dissection of mouse prostate cancer models, focusing on prostate tumor dissection. A step-by-step protocol for generation of mouse prostate tumor organoids is also presented.

전립선암의 유전자 조작 마우스 모델에서 종양 오르가노이드의 생성

Methods based on homologous recombination to modify genes have significantly furthered biological research. Genetically engineered mouse models (GEMMs) ...

유전학

Prostate Organoid Cultures as Tools to Translate Genotypes and Mutational Profiles to Pharmacological Responses

Presented here is a protocol to study pharmacodynamics, stem cell potential, and cancer differentiation in prostate epithelial organoids. Prostate organoids are androgen responsive, three-dimensional (3D) cultures grown in a defined medium that resembles the prostatic epithelium. Prostate organoids can be established from wild-type and genetically engineered mouse models, benign human tissue, and advanced prostate cancer. Importantly, patient derived organoids closely resemble tumors in genetics and in vivo tumor biology. Moreover, organoids can be genetically manipulated using CRISPR/Cas9 and shRNA systems. These controlled genetics make the organoid culture attractive as a platform for rapidly testing the effects of genotypes and mutational profiles on pharmacological responses. However, experimental protocols must be specifically adapted to the 3D nature of organoid cultures to obtain reproducible results. Described here are detailed protocols for performing seeding assays to determine organoid formation capacity. Subsequently, this report shows how to perform drug treatments and analyze pharmacological response via viability measurements, protein isolation, and RNA isolation. Finally, the protocol describes how to prepare organoids for xenografting and subsequent in vivo growth assays using subcutaneous grafting. These protocols yield highly reproducible data and are widely applicable to 3D culture systems.

Presented here is a protocol to study pharmacological responses in prostate epithelial organoids. Organoids closely resemble in vivo biology and recapitulate patient genetics, making them attractive model systems. Prostate organoids can be established from wildtype prostates, genetically engineered mouse models, benign human tissue, and advanced prostate cancer.

약리학적 반응에 유전형과 돌연변이 단면도를 번역하는 공구로 전립선 오르가노이드 문화

Presented here is a protocol to study pharmacodynamics, stem cell potential, and cancer differentiation in prostate epithelial organoids. Prostate ...

An Orthotopic Murine Model of Human Prostate Cancer Metastasis

Our laboratory has developed a novel orthotopic implantation model of human prostate cancer (PCa). As PCa death is not due to the primary tumor, but rather the formation of distinct metastasis, the ability to effectively model this progression pre-clinically is of high value. In this model, cells are directly implanted into the ventral lobe of the prostate in Balb/c athymic mice, and allowed to progress for 4-6 weeks. At experiment termination, several distinct endpoints can be measured, such as size and molecular characterization of the primary tumor, the presence and quantification of circulating tumor cells in the blood and bone marrow, and formation of metastasis to the lung. In addition to a variety of endpoints, this model provides a picture of a cells ability to invade and escape the primary organ, enter and survive in the circulatory system, and implant and grow in a secondary site. This model has been used effectively to measure metastatic response to both changes in protein expression as well as to response to small molecule therapeutics, in a short turnaround time.

This orthotopic model of human prostate cancer allows for quantification of tumor size, circulating tumor cells, and formation of distinct metastasis to the lung. As cells must escape the primary organ, enter the blood stream, and implant into a secondary site, this model effectively recapitulates the scenario in humans.

인간의 전립선 암 전이의 동소 쥐과 모델

Our laboratory has developed a novel orthotopic implantation model of  human prostate cancer (PCa). As PCa death is not due to the primary tumor, but  ...

의학

Isolation of Cancer Stem Cells From Human Prostate Cancer Samples

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly isolated from human tissues and serially propagated in immunodeficient mice, typically through antibody labeling of subpopulations of cells and fractionation by flow cytometry. However, the unique clinical features of prostate cancer have considerably limited the study of prostate CSCs from fresh human tumor samples. We recently reported the isolation of prostate CSCs directly from human tissues by virtue of their HLA class I (HLAI)-negative phenotype. Prostate cancer cells are harvested from surgical specimens and mechanically dissociated. A cell suspension is generated and labeled with fluorescently conjugated HLAI and stromal antibodies. Subpopulations of HLAI-negative cells are finally isolated using a flow cytometer. The principal limitation of this protocol is the frequently microscopic and multifocal nature of primary cancer in prostatectomy specimens. Nonetheless, isolated live prostate CSCs are suitable for molecular characterization and functional validation by transplantation in immunodeficient mice.

The isolation of cancer stem cells (CSCs) directly from human tissues is requisite for their biological characterization. This manuscript describes a methodology for the isolation of prostate CSCs from human tissues, while also providing tips on troubleshooting difficult steps.

인간의 전립선 암 샘플에서 암 줄기 세포의 분리

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly ...

Generation of Prostate Cancer Patient Derived Xenograft Models from Circulating Tumor Cells

Patient derived xenograft (PDX) models are gaining popularity in cancer research and are used for preclinical drug evaluation, biomarker identification, biologic studies, and personalized medicine strategies. Circulating tumor cells (CTC) play a critical role in tumor metastasis and have been isolated from patients with several tumor types. Recently, CTCs have been used to generate PDX experimental models of breast and prostate cancer. This manuscript details the method for the generation of prostate cancer PDX models from CTCs developed by our group. Advantages of this method over conventional PDX models include independence from surgical sample collection and generating experimental models at various disease stages. Density gradient centrifugation followed by red blood cell lysis and flow cytometry depletion of CD45 positive mononuclear cells is used to enrich CTCs from peripheral blood samples collected from patients with metastatic disease. The CTCs are then injected into immunocompromised mice; subsequently generated xenografts can be used for functional studies or harvested for molecular characterization. The primary limitation of this method is the negative selection method used for CTC enrichment. Despite this limitation, the generation of PDX models from CTCs provides a novel experimental model to be applied to prostate cancer research.

This manuscript details a method used to generate prostate cancer patient derived xenografts (PDXs) from circulating tumor cells (CTCs). The generation of PDX models from CTCs provides an alternative experimental model to study prostate cancer; the most commonly diagnosed tumor and a frequent cause of death from cancer in men.

전립선 암 환자의 발생은 종양 세포를 순환에서 이종 이식 모델을 파생

Patient derived xenograft (PDX) models are gaining popularity in cancer research and are used for preclinical drug evaluation, biomarker identification, ...

Murine Prostate Micro-dissection and Surgical Castration

Mouse models are used extensively to study prostate cancer and other diseases. The mouse is an excellent model with which to study the prostate and has been used as a surrogate for discoveries in human prostate development and disease. Prostate micro-dissection allows consistent study of lobe-specific prostate anatomy, histology, and cellular characteristics in the absence of contamination of other tissues. Testosterone affects prostate development and disease. Androgen deprivation therapy is a common treatment for prostate cancer patients, but many prostate tumors become castration-resistant. Surgical castration of mouse models allows for the study of castration resistance and other facets of hormonal biology on the prostate. This procedure can be coupled with testosterone reintroduction, or hormonal regeneration of the prostate, a powerful method to study stem cell lineages in the prostate. Together, prostate micro-dissection and surgical castration opens up a multitude of opportunities for robust and consistent research of prostate development and disease. This manuscript describes the protocols for prostate micro-dissection and surgical castration in the laboratory mouse.

This manuscript describes the protocols for prostate micro-dissection and surgical castration in the laboratory mouse. We also depict representative results produced by these protocols. Finally, we discuss the advantages and utilization of these protocols.

쥐의 전립선 마이크로 해부 및 수술 거세

Mouse models are used extensively to study prostate cancer and other diseases. The mouse is an excellent model with which to study the prostate and has ...

Pre-clinical Orthotopic Murine Model of Human Prostate Cancer

To study the multifaceted biology of prostate cancer, pre-clinical in vivo models offer a range of options to uncover critical biological information about this disease. The human orthotopic prostate cancer xenograft mouse model provides a useful alternative approach for understanding the specific interactions between genetically and molecularly altered tumor cells, their organ microenvironment, and for evaluation of efficacy of therapeutic regimens. This is a well characterized model designed to study the molecular events of primary tumor development and it recapitulates the early events in the metastatic cascade prior to embolism and entry of tumor cells into the circulation. Thus it allows elucidation of molecular mechanisms underlying the initial phase of metastatic disease. In addition, this model can annotate drug targets of clinical relevance and is a valuable tool to study prostate cancer progression. In this manuscript we describe a detailed procedure to establish a human orthotopic prostate cancer xenograft mouse model.

Prostate cancer is the second most common cause of cancer-related deaths in the United States. An orthotopic cancer model provides a useful approach to understand the biology of prostate cancer and to evaluate the efficacy of therapeutic regimens. This protocol describes detailed steps necessary to establish an orthotopic prostate cancer mouse model.

인간의 전립선 암의 전 임상 동소 이식 쥐 모델

To study the multifaceted biology of prostate cancer, pre-clinical in vivo models offer a range of options to uncover critical biological information ...

Crystal Violet Staining: A Technique to Visualize Drug-Resistant Cancer Cells Using Colony Formation Assays

Source: Mohr, L. et al., <a href="https://www.jove.com/v/56327">Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel.</a> J. Vis. Exp. (2017)
In this video, we demonstrate a cell viability assay using a crystal violet staining procedure for chemotherapeutic drug-resistant cancer cells.

Crystal Violet Staining: Colony Formation Assay를 사용하여 약물 내성 암세포를 시각화하는 기법

Source: Mohr, L. et al., Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (2017)
In this video, ...

JoVE Encyclopedia of Experiments

Biological Techniques

Staining Techniques

Cell staining

Generating Chemoresistant Prostate Cancer Cells: A Procedure for Obtaining Drug-resistant Cancer Cells In Vitro

Source: Mohr, L. et al. <a href="https://www.jove.com/video/56327" target="_blank">Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel.</a> J. Vis. Exp. (2017)
This video describes a protocol for generating taxane-resistant cell models of prostate cancer. These models can help study the pathways involved in progression to Docetaxel resistance in prostate cancer patients.

화학저항성 전립선암세포 생성: 약물 저항성 암세포를 체외에서 획득하는 절차

Source: Mohr, L. et al. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (2017)
This video ...