이 연구는 경제와 경쟁력 (MINECO) SAF2016-78898-c 2-2-R. 스페인 정부에서 교부 금에 의해 지원 되었다

이 연구 모두 스페인어 규정 (로얄 법령 53/2013-법 32/2007)에 따라에서 실시 했다 및 유럽 연합 지침 (지침 2010/63/EU) 관리 및 생물 의학 연구에 있는 동물의 사용에.
 1. 쥐의 준비 참고: 우리는 어떤 호르몬 변화를 피하기 위해 남자 쥐에 실험 수행.
<ol><li>Anesthetize 케 타 민 염 산 염 (30 mg/kg) 및 xylazine 염 산 염 (5 mg/kg) 피하 주사,이 복용량 혼합을 사용 하 여 동물 쥐 해야 될 깊이 취 약 1 헤에 대 한</li>
	<li>꼬집어 쥐 &#39; s 발가락; 부재는 철수의 반사 동물 완전히 의식 하지 않음을 나타냅니다. 쥐 꼬 집 음에 응답, 초기 복용량의 1/3에서 보조 마 취를 줄.</li>
	<li>두 피를 면도 하 고 외과 영역 povidone-요오드 소독.</li>
	<li>38 ° C의 온도 유지 하 고 동물을 안정화 하는 생리대에 동물을 배치 &#39; stereotaxic 프레임 두 귀 바, 물린 막대를 사용 하 여 s 머리. 주의 사용 하 여 피어 싱 귀 바 봐서 고 막 방지.</li>
	<li>각 눈 안과 젤 또는 염 분 혈 청 한 방울을 적용 하 여 눈을 보호.</li>
</ol> 2. 쥐의 측 뼈에 AC의 위치 <ol><li>두개골을 노출 하 고 두개골의 표면을 덮고과 철회 중간 따라 절 개 하 게 한 메스를 사용 하 여.</li>
	<li>Bregma, 람다, 및 쥐 두뇌 22 Paxinos와 왓슨 아틀라스에 따르면 interaural 0 시각화를 두개골의 표면을 덮고 있는 혈액을 부드럽게 제거 하는 살 균 면 팁을 사용.</li>
	<li>메스와 두개골에는 등 삽입 근처 일시적인 근육에서 절 개를 확인합니다. 바늘 및 봉합 사 물자를 사용 하 여 근육을 당겨 하 고 정위 적 프레임; 봉합 사 물자를 수정 이 측 뼈를 노출 합니다. 출혈이 발생 하는 경우 냉 멸 균 식 염 수로 씻어.</li>
	<li>확인을 그것은 완벽 하 게 확보 하는 정위 적 micromanipulator 살 균 스트레이트 바늘 장소.</li>
	<li>바늘의 팁 interaural 0으로 설정 되어 있도록, 두개골의 표면 위에 바로 때까지 바늘을 천천히 낮은. 이 0으로 설정 하 고이 시점에서 좌표를 결정.</li>
	<li>관심 뇌 영역에 따라 정위 적 좌표 다. 쥐 뇌 22 Paxinos와 왓슨 아틀라스를 이용 하 여이 좌표를 결정 합니다. 일단 좌표 결정 됩니다 이동 그 좌표에 맞게 바늘.</li>
	<li>대상 다음과 같은 4 포인트의 좌표를 사용 하 여 AC: a: A / P =-5.8 m m, M/L = + 6.4 m m; B: A/P =-2.7 m m, M/L = + 6.4 m m; C: A/P =-2.7 m m, M/L = + 8.67 m m; D: A/P =-5.8 m m, M/L = + 8.67 m m. 낮은 각이 4 포인트의 시각화 하 측 뼈 위에 오른쪽 바늘. 마커 펜을 사용 하 여, 측 뼈에 포인트를 표시 하 고 사각형; 그리기 위하여 그들을 연결합니다 사각형 창 뼈 ( 그림 1)에 열을 가이드로 될 것입니다.</li>
</ol> 3. AC의 외과 노출 <ol><li>오픈 전기 드릴 및 작은 드릴을 사용 하 여 창 비트 (0.6 m m Ø). 때까지 뼈 떨어져 8000 rpm에서 사각형의 경계를 드릴. Subcortical 구조에 손상을 방지 하기 위해 찬 메 마른 염 분으로 rinsing 하 여 드릴링 표면을 냉각 한다. 무너진 뼈 때 저항에 한 방울을 감지할 수 있습니다. 뇌를 훈련 하지 않도록 주의 하십시오.</li>
	<li>경계가 느슨한, 정밀한 집게와 덮 음 뼈를 올려 고 차가운 멸 균 식 염 수에 보관.</li>
</ol> 4. AC의 절제 <ol><li>수술 현미경 (10 배)를 사용 하 여 부드럽게 meninges microsurgical 칼으로 잘라내어 두 잘 지적 집게를 사용 하 여 그들을 제거. 출혈이 발생 하는 경우 냉 멸 균 식 염 수로 씻어.</li>
	<li>부드럽게 살 균 20 G 무딘 팁 바늘에 결합 된 외과 흡입 장치 (압력-0.24 바)를 사용 하 여 AC 발음. 이 이때 중요 하 고 매우 신중 하 게 수행 되어야 할: 발음만 6 대뇌 피 질의 레이어 및 기본 백색 질.</li>
	<li>꿰 뚫는 동맥 출혈이 멈출 때까지 발음.</li>
	<li>포부 완료 되 면 추출 된 뼈 부상된 영역을 커버 하 고 흡수 hemostatic 거 즈 적용.</li>
	<li>일시적인 근육 그것의 원래 위치에 복구할 및 다음 상처 클립 (9 mm)를 사용 하 여 피부를 봉합 하 게. 항생제 연 고를 적용 (재료의 표 참조). 계속 3 일 동안 매일 두 번 상처에 연 고를 적용. 
	참고: 각 응용 프로그램 이루어져 상처에 적용 얇은 층.</li>
	<li>수술 후 진통 1 시간 및 다음 모든 8 h 72 h. 동안 쥐 (0.05 mg/kg)의 뒤에 피하 주사 buprenorphine</li>
	<li>깨어나면 때까지 난방 패드에 동물을 유지 하 고 복구 하는 주택 케이지 돌아갑니다.</li>
	<li>감동 sutured 지역에서 감 금 소 동료를 방지 하기 위해 개별적으로 동물을 집 고 농축 항목 몇 가지를 제공 합니다. 톱 밥을 매일 감염을 방지 하기 위해 신중 하 게 확인 하는 동물 제대로 복구 불편의 어떤 표시 든 지 보여주지 않는다 변경.</li>
</ol> 5. 조직 컬렉션 주의: paraformaldehyde (PFA), 고체 및 수 처리, 개인 보호 장비 (PPE)를 착용 하 고 안전 캐비닛을 사용.
 참고: 4% (w/v) PFA 인산 염 버퍼 솔루션 (PBS) 열 (55 ℃)를 사용 하 여 x 1으로 용 해 하 여 750 mL 포름알데히드 해결책을 준비. 필터링 필터 종이 포름알데히드 해결책. 벨소리를 준비 &#39; 8.5 g의 NaCl, KCl, 물 1000 mL에 0.2 g NaHCO 3의 0.25 g을 용 해 하 여 s 솔루션 (해결책 pH = 6.9).
<ol><li>동물 연구를 위해 필요한 만큼 생존 하자. AC 연기나 쥐와 함께 수행 하는 연구를 완료 될 때 나트륨 pentobarbital (60 mg/kg)의 0.1 mL의 복 막 내 주입 하 여 그것를 anaesthetize 말기 발가락 핀치와 철수 반사의 부재에 의해 마 취의 깊이 평가.</li>
	<li>동물 취 깊이 때 수행 intracardiac 관류 23 벨의 125 mL의 &#39; s 솔루션 포름알데히드 솔루션의 750 mL의 1.8 m m의 바늘 게이지를 사용 하 여 다음 내경.</li>
	<li>는 관류 완료 되 면, 첫 번째 자 궁 경부 척추에 쥐 목을 벨.</li>
	<li>가 위를 사용 하 여 피부를 제거 하 고 머리에서 근육을 하 고 두개골을 노출. 가 위 컷 및 구멍 매그넘 열고 두개골의 뒤로 제거를 사용 하 여.</li>
	<li>통과 스펜서가 위를 사용 하 여 궤도 뼈를 잘라 하 고 뇌를 노출 하는 두개골의 상단 가장자리를 따라 잘라 rongeurs 사용을 확인 합니다. 두뇌를 손상 하지 않도록 주의 하십시오.</li>
	<li>일단 뇌 노출 조심 스럽게 dura mater 벌금 지적 집게를 사용 하 여 제거. 손가락을 사용 하 여 부드럽게 아래 푸 하 고 두뇌를 상승. 두뇌를 올리고 신경 unt 잘라il 무료입니다. 담가 포름알데히드 솔루션에 두뇌 그리고 24 h. 4 ° C에서 저장</li>
</ol> 6. AC 변의 지역화 <ol><li>후 고정 후 신중 하 게 두뇌의 측면 표면을 노출 화살 쥐 뇌 매트릭스로 두뇌를 배치.</li>
	<li>21 cm 위의 카메라 카메라 홀더를 사용 하 여 피 질 표면, 선택은 &#34; 슈퍼 매크로 촬영 &#34; 모드, 그리고 뇌 표면 사진.</li>
	<li>두뇌 코로나 쥐 뇌 매트릭스 노출은 뇌의 등 쪽 표면에 배치 하 고 다른 사진의 찍을.</li>
	<li>이미지 편집기 프로그램을 사용 하 여 이미지 열고 쉽게 작업할 수 있도록 50% 규모. bregma, 람다, 및 Paxinos와 왓슨 좌표 19에 따라 그림에 interaural 0 참조를 식별 하 고 그림 ( 그림 2)에서 그들의 위치를 표시. 두뇌의 측면 사진을 통해는 절제의 윤곽선을 그립니다. 경계 계산.</li>
	<li>가져오기는 좌표 기본 (A1)와 AC의 보조 영역 (지 및 복 부 외피가) 위치 위치 18 어디 사용 하는 사진 편집기 프로그램의 파일을 매핑합니다. 지도에서 클릭 하 고 끌어 연기나 두뇌의 측면 사진에 첨가를.
	<ol><li>는 bregma 만들고 측면 뇌의 그림에서 확인 된 bregma 및 람다 참조 맞춰 좌표 지도의 람다 참조.</li>
		<li>참조로 rhinal 균열을 사용 하 여 지도, 뇌의 그림을 조정 하 고 ( 그림 2B)에 맞춰 그들.</li>
	</ol></li> <li>계산는 AC.에 의해 점유 하는 영역을 기준으로 병 변의 비율</li></ol>

<ol>
	<li>Talwar, S. K., Gerstein, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auditory+frequency+discrimination+in+the+white+rat.">Auditory frequency discrimination in the white rat.</a> Hear Res. 126 (1-2), 135-150 (1999).</li><li>Heffner, H. E., Heffner, R. S., Contos, C., Ott, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Audiogram+of+the+hooded+Norway+rat.">Audiogram of the hooded Norway rat.</a> Hear Res. 73 (2), 244-247 (1994).</li><li>Malmierca, M. S., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auditory+System.">Auditory System.</a> The Rat Nervous System. , 995-1080 (2004).</li><li>Delano, P. H., Elgoyhen, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editorial:+Auditory+Efferent+System:+New+Insights+from+Cortex+to+Cochlea.">Editorial: Auditory Efferent System: New Insights from Cortex to Cochlea.</a> Front Syst Neurosci. 10, 1-2 (2016).</li><li>Dinse, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sound+Case+for+Enrichment.+Focus+on+"Environmental+Enrichment+Improves+Response+Strength,+Threshold,+Selectivity,+and+Latency+of+auditory+cortex+Neurons.".">Sound Case for Enrichment. Focus on "Environmental Enrichment Improves Response Strength, Threshold, Selectivity, and Latency of auditory cortex Neurons.".</a> J Neurophysiol. 92 (1), 36-37 (2004).</li><li>Polley, D. B., Heiser, M. A., Blake, D. T., Schreiner, C. E., Merzenich, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Associative+learning+shapes+the+neural+code+for+stimulus+magnitude+in+primary+auditory+cortex.">Associative learning shapes the neural code for stimulus magnitude in primary auditory cortex.</a> Proc Natl Acad Sci U S A. 101 (46), 16351-16356 (2004).</li><li>Kaur, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracortical+Pathways+Determine+Breadth+of+Subthreshold+Frequency+Receptive+Fields+in+Primary+auditory+cortex.">Intracortical Pathways Determine Breadth of Subthreshold Frequency Receptive Fields in Primary auditory cortex.</a> J Neurophysiol. 91 (6), 2551-2567 (2004).</li><li>Talwar, S. K., Musial, P. G., Gerstein, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+mammalian+auditory+cortex+in+the+perception+of+elementary+sound+properties.">Role of mammalian auditory cortex in the perception of elementary sound properties.</a> J Neurophysiol. 85 (6), 2350-2358 (2001).</li><li>Tan, A. Y. Y., Atencio, C. A., Polley, D. B., Merzenich, M. M., Schreiner, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unbalanced+synaptic+inhibition+can+create+intensity-tuned+auditory+cortex+neurons.">Unbalanced synaptic inhibition can create intensity-tuned auditory cortex neurons.</a> Neuroscience. 146 (1), 449-462 (2007).</li><li>Le&#243;n, A., Elgueda, D., Silva, M. A., Hamam&#233;, C. M., Delano, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auditory+cortex+basal+activity+modulates+cochlear+responses+in+chinchillas.">Auditory cortex basal activity modulates cochlear responses in chinchillas.</a> PLOS ONE. 7 (4), e36203 (2012).</li><li>Jager, K., Kossl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Corticofugal+Modulation+of+DPOAEs+in+Gerbils.">Corticofugal Modulation of DPOAEs in Gerbils.</a> Hear Res. 332, 61-72 (2016).</li><li>Dragicevic, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Olivocochlear+Reflex+Strength+and+Cochlear+Sensitivity+are+Independently+Modulated+by+auditory+cortex+Microstimulation.">The Olivocochlear Reflex Strength and Cochlear Sensitivity are Independently Modulated by auditory cortex Microstimulation.</a> J Assoc Res Otolaryngol. 16 (2), 223-240 (2015).</li><li>Clarkson, C., Herrero-Turri&#243;n, M. J., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cortical+Auditory+Deafferentation+Induces+Long-Term+Plasticity+in+the+Inferior+Colliculus+of+Adult+Rats:+Microarray+and+qPCR+Analysis.">Cortical Auditory Deafferentation Induces Long-Term Plasticity in the Inferior Colliculus of Adult Rats: Microarray and qPCR Analysis.</a> Front Neural Circuits. 6, 86 (2012).</li><li>Clarkson, C., Ju&#237;z, J. M., Merch&#769;an, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+regulation+in+calretinin+staining+in+the+rat+inferior+colliculus+after+unilateral+auditory+cortical+ablation.">Long-term regulation in calretinin staining in the rat inferior colliculus after unilateral auditory cortical ablation.</a> J Comp Neurol. 518, 4261-4276 (2010).</li><li>Clarkson, C., Ju&#237;z, J. M., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+down-regulation+of+sound-induced+c-Fos+protein+expression+in+the+inferior+colliculus+after+ablation+of+the+auditory+cortex.">Transient down-regulation of sound-induced c-Fos protein expression in the inferior colliculus after ablation of the auditory cortex.</a> Front Neuroanat. 4, 141 (2010).</li><li>Hunter, K. P., Willott, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+bilateral+lesions+of+auditory+cortex+in+mice+on+the+acoustic+startle+response.">Effects of bilateral lesions of auditory cortex in mice on the acoustic startle response.</a> Physiol Behav. 54 (6), 1133-1139 (1993).</li><li>Lamas, V., Arevalo, J. C., Juiz, J. M., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acoustic+input+and+efferent+activity+regulate+the+expression+of+molecules+involved+in+cochlear+micromechanics.">Acoustic input and efferent activity regulate the expression of molecules involved in cochlear micromechanics.</a> Front Syst Neurosci. 8, 253 (2014).</li><li>Lamas, V., Alvarado, J. C., Carro, J., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+evolution+of+brainstem+electrical+evoked+responses+to+sound+after+restricted+ablation+of+the+auditory+cortex.">Long-term evolution of brainstem electrical evoked responses to sound after restricted ablation of the auditory cortex.</a> PLOS ONE. 8 (9), e73585 (2013).</li><li>Lamas, V., Juiz, J. M., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ablation+of+the+auditory+cortex+results+in+changes+in+the+expression+of+neurotransmission-related+mRNAs+in+the+cochlea.">Ablation of the auditory cortex results in changes in the expression of neurotransmission-related mRNAs in the cochlea.</a> Hear Res. 346, 71-80 (2017).</li><li>Doron, N. N., Ledoux, J. E., Semple, M. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redefining+the+tonotopic+core+of+rat+auditory+cortex:+physiological+evidence+for+a+posterior+field.">Redefining the tonotopic core of rat auditory cortex: physiological evidence for a posterior field.</a> J Comp Neurol. 453 (4), 345-360 (2002).</li><li>Polley, D. B., Read, H. L., Storace, D. a., Merzenich, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiparametric+auditory+receptive+field+organization+across+five+cortical+fields+in+the+albino+rat.">Multiparametric auditory receptive field organization across five cortical fields in the albino rat.</a> J Neurophysiol. 97 (5), 3621-3638 (2007).</li><li>Paxinos, G., Watson, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Rat Brain in Stereotaxic Coordinates. , (2005).</li><li>Gage, G. J., Kipke, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole+Animal+Perfusion+Fixation+for+Rodents.">Whole Animal Perfusion Fixation for Rodents.</a> J Vis Exp. (65), e3564 (2012).</li></ol>

저자는 연구 잠재적인 상충으로 해석 될 수 있는 어떤 상업적 또는 금융 관계의 부재에서 실시 되었다 선언 합니다.

성공적인 뇌 수술 두 가지 요인에 따라 경첩: 동안 및 절차 후 동물을 살아있는 유지 하 고 정확 하 게 관심의 영역을 찾기. 쥐 (철수 반사 테스트), 수술 중 마 취 깊이 주고받는 적절 한 진통제 및 비 ototoxic 항생제는 생존 도움이 될 보장 합니다. 또한, 쥐 저체온증을 피하기 위해 마 취에서 깰 때까지 열 패드에 유지 되어야 한다. 감염, 민감성 줄어 봉합 및 적절 한 기술을 중요 하다: 동물 그래서 그들은 충분히 꽉 상처에 너무 많은 긴장을 삽입 하지 않고 제거를 방지 하기 위해 이식 한다 그들의 상처 클립에서 선택 합니다.
정확 하 게 찾을 AC (또는 다른 대뇌 피 질의 영역), bregma, 람다, 및 대상 영역의 한계를 계산 참조로 사용 하는 interaural 0의 위치를 결정 하는 것이 중요 하다. 어떤 실수 좌표 계산에 AC의 부분 절제 또는 다른 주변 지역의 원치 않는 열망에 발생 합니다. 따라서, 바늘 팁만 interaural 0에서 뼈를 터치 하 고이 프로토콜에서 설명에 따라 antero 후부 및 평점 옆 좌표를 번역 해야 합니다.
이 원고에 우리는 또한 수술 노출 하 고 AC ablate 방법을 설명 했습니다. 3 중요 한 단계는: 드릴링 과정, 열고 meninges, 및 포부에 의해 제거의 제거. 드릴링 수행 되어야 한다 최소 압력, 낮은 속도에서 높은 드릴링 속도 생성 열 subcortical 구조 근처에 영향을 미칠 수 있습니다. 그러나, 낮은 속도 유지 하 고 냉각 냉 멸 균 식 염 수와 드릴링 지역 손해를 방지 해야 합니다. 또한, 최소 압력의 두개골과 기본 피 질 이후 부상 갑자기 휴식을 피하기 위해 필수적입니다. 커버는 AC meninges의 제거와 혈관을 깨는 피하기 위해 신중 하 게 수행 되어야 한다. 출혈이 발생 하는 경우 초기와 후반 예 후는 일반적으로 호의 베푸는 고 등 동물 신뢰할 수 있는 연구에 대 한 포함 기준을 충족 하는 여부는. 안락사를이 경우에 좋습니다. 마지막으로, 포부 (아마 가장 어려운 측면에 효과적인 병 변), 회색 문제에 제한 되어야 합니다. 백색 물질의 존재를 감지 하는 것을 도울 수 있는 두 가지 지표: (1) 백색 질으로 색상 대비에 변화는 회색 문제; 보다 밝은 (2) 꿰 뚫는 동맥에서 출혈의 정지.
조작 하는 두뇌에서 수행 된 후 현지화, 크기, 및 절차 이후 분석 및 동물에서 얻은 데이터의 유효성 검사에 대 한 피 질에서의 확장을 평가할 필요가 있다. 이 원고에서 우리는 우리의 그룹18에 의해 설명한 좌표 지도 사용 하 여 피 질에서 수행 하는 절제를 지역화 하는 방법 선발. 이 지도 쥐 두뇌22Paxinos와 왓슨 아틀라스와 상관 조직학 섹션의 직렬 섹션 복원에서 얻은 해 부 참조를 사용 하 여 건설 되었다. 따라서, 지도 기본 (A1)와 AC의 보조 외피가 (지 및 복 부) 구분. 이 좌표 지도의 주요 장점은 좋군요 화살 두뇌 매트릭스에 배치 하는 두뇌의 측면 표면에서의 촬영으로 병 변의 신속한 지역화 수 있다는. 또 다른 장점은 실험실 해부학에 더 적은 경험을 가진 그들의 동물 모델에 적응 하 여 지도 사용할 수 있습니다. 그것은 단지 끼얹는다 제어 뇌에서 bregma, 람다, 및 interaural 0 참조 사이의 거리를 설정 하 고 지도 확장 하는 데 필요한 또는 그에 따라 아래로. 참고로 Rhinal 균열을 사용 하 여 지도 하는 두뇌의 그림을 조정. 두뇌 조직학 단면도에서 결정 되어야 합니다 그래서이 좌표 지도에 절제의 깊이 확인할 수 없습니다.
AC의 외과 노출 정위 적 방법의 조합은 누가 쥐에 AC 대상 하고자 조사에 의해 쉽게 적응 될 수 있는 기본 방법이 있습니다. 이것은 급성 실험 또는 영구 장치 주입에 필요한 수 있습니다. 또한, AC의 외과 제거는 이전 사용 되었습니다 모델 심리에 만성 대뇌 피 질의 부족의 효과 공부 하. AC 제거 또한 공부 효과 일방적인 AC 제거 다른 대뇌 피 질의 영역에서 발휘 또는 뇌졸중의 모델 역할을 사용할 수 있습니다. 따라서, 여기에 설명 된 실험 디자인 개별적으로 또는 실험 디자인의 다양 한 조합에 적용할 수 있는 유용한 방법이 있습니다.

쥐 청각 신경 과학에서 가장 일반적으로 사용 되는 동물 모델 중 하나입니다. 동작의 견고성은 재판 하루 수백 위해 일할 수 있습니다. 그것의 감도 및 청각1,2및3의 다른 포유류 비해 그것의 중앙 시스템의 해 부와 기능 조직에 대 한 스펙트럼 시력 만들 쥐의 넓은 범위를 분석 하기 위한 적절 한 동물 모델 청각 신경 과학에서 연구 주제입니다. 쥐 청각 피 질 (AC), 특히, 그것의 구조, 조직, 및 사운드 처리3역할 이해 하려고 여러 해 부와 생리 적인 연구의 대상이 되었습니다. 요즘, AC는 경험 의존 소성, 청각 지 각, 시 냅 스 수용 분야 조직, 기초 청각에 바꾸어 사운드 처리의 대뇌 피 질의 제어에 관심이 신경 과학자 들에 게 인기가 되고있다 핵4,,56,7,,89. 이러한 새로운 접근 포즈 하는 문제를 해결 하려면 절차를 정확 하 게 찾을 수 있는 수술로 AC를 노출 연구 노력 신속 하 게 됩니다. 정위 적 기법을 쉽게 생리 테스트 없이 뇌 내에서 특정 지역을 지역화할 수 있습니다. 비록 뇌 크기는 동물 사이 약간 다릅니다, 모든 뇌 영역의 위치 쥐 뇌의 두개골에 랜드마크에서 설정 하는 정위 적 좌표를 사용 하 여 확인할 수 있습니다.
AC의 제한 제거 가장 직접적 심리와 관련 된 피 질 감각 영역의 외과 제거 이다. 달리 AC, 냉각 또는 로컬 lidocaine 주사10,11,12, 기능의 만성 손실에 AC 결과의 외과 제거 등의 활동을 차단 하는 데 사용 되는 다른 방법. 따라서, AC 제거 병 변 소성의 후속 현상 뿐만 아니라 대뇌 피 질의 부족의 장기적인 효과 공부 하 고 위해 더 적당 하다. AC의 외과 제거와 정위 적 방법의 조합은 대뇌 피 질의 제어 부족13,14,15의 생리, 행동, 및 분자 효과 연구를 성공적으로 사용 되었습니다. ,,1617,,1819. 예를 들어 양자 AC 제거와 쥐 모델 청각 놀라게 반사 및 청각 brainstem 응답 (ABR)16피 질 절제술의 효과 연구 사용 되었습니다. 최근에, 우리는 부상18후 ABR 임계값, 진폭, 및 다른 시간 지점에서 대기 시간에 쥐 AC 생산의 양자 제거 대 그 일방적인 효과 비교 했습니다. 또한, 제한적인 AC 절제의 쥐 모델도 열 등 한 collicus13,,1415 에 내가17 corticofugal 통로 변성의 효과 연구에 사용 되었습니다. 19. 이러한 조작 두뇌에서 수행 된 후 지역화, 크기, 병 변이 피 질에서의 확장을 평가할 필요가 있다. 매우 유용 하지만 tonotopic 지도 기반 신경 응답20,21 의 주요 한계는 쥐 두뇌에서 청각 필드를 찾습니다 하는 데 필요한 electrophysiological 기술이 있습니다. 모든 실험실 필요한 장비 및 전문성 등 녹음을 때문에, 우리 뇌의 표면18의 이미지에는 AC의 cytoarchitectural 한계의 전송에 따라 좌표 지도 건설 한다. 이 지도 생리학 시험 없이 AC를 찾을 매우 유용할 수 있습니다.
현재 프로토콜 stereotactically 가이드 위치, 외과, 노출과 쥐에 AC의 절제 하는 방법을 설명합니다. 그것은 또한 우리의 좌표 지도18 를 사용 하 여 쉽게 녹지 두뇌의 표면 사진을 통해 병 변의 확장을 지역화 하는 방법을 설명 합니다.

<table><tbody><tr><td>Stereotaxic frame</td><td>David Kopf Ins.</td><td>900</td><td></td></tr><tr><td>Surgical microscope</td><td>WILD M650 Heerbrugg</td><td></td><td></td></tr><tr><td>Heating pad</td><td>DAGA</td><td></td><td></td></tr><tr><td>Dental micromotor</td><td>W&amp;amp;H elco</td><td>5118</td><td></td></tr><tr><td>Diamond burr</td><td>B Braun</td><td>GD021R</td><td>0.6 mm</td></tr><tr><td>Surgical suction device</td><td>Atmos</td><td>Atmoforte E2</td><td></td></tr><tr><td>Ketamine</td><td>Merial</td><td></td><td>30 mg/kg</td></tr><tr><td>Xylazine</td><td>Bayer</td><td></td><td>5 mg/kg</td></tr><tr><td>Micromanipulator</td><td>Narishige</td><td>SM-11</td><td></td></tr><tr><td>Scalpel</td><td>Lawton</td><td></td><td></td></tr><tr><td>Povidone iodine</td><td>Meda</td><td>Betadine</td><td></td></tr><tr><td>sterile saline serum</td><td>B.Braun</td><td></td><td></td></tr><tr><td>20G sterile needle</td><td>Terumo Neolus</td><td></td><td></td></tr><tr><td>Cotton tips</td><td></td><td></td><td></td></tr><tr><td>Suture material</td><td>B.Braun</td><td></td><td></td></tr><tr><td>Antibiotic Ointment</td><td>Quadriderm (Betametasona, Gentamicina, Clotrimazol) - Schering-Plough</td><td></td><td></td></tr><tr><td>Forceps</td><td>dimeda</td><td>10.331.12</td><td></td></tr><tr><td>Surgical needles</td><td>World Precision Instruments</td><td>501940</td><td></td></tr><tr><td>Buprenorphine</td><td>Indivior UK</td><td>Buprex</td><td>0.05 mg/kg</td></tr><tr><td>Scissor</td><td>dimeda</td><td>08.120.15</td><td></td></tr><tr><td>Spencer scissor</td><td>dimeda</td><td>08.804.14</td><td></td></tr><tr><td>Rongeurs</td><td>Lawton</td><td></td><td></td></tr><tr><td>Microsurgical knife</td><td>MSP</td><td>7503</td><td></td></tr><tr><td>Absorbable hemostatic gauze</td><td>Surgicel</td><td></td><td></td></tr><tr><td>Saggital rat Brain Matrix</td><td>Activational systems Inc.</td><td>RBM-1000DV / RBM 4000C</td><td></td></tr><tr><td>Sodium pentobarbital</td><td>Vetoquinol</td><td></td><td>60 mg/kg</td></tr><tr><td>Camera</td><td>Olympus 5.1 MP</td><td>C-5060 wide zoom</td><td>lens F2.8-4.8</td></tr><tr><td>Wound clips</td><td>Reflex 9</td><td></td><td>9 mm</td></tr><tr><td>Canvas 12</td><td>ACD Systems</td><td></td><td></td></tr><tr><td>needle gauge</td><td></td><td></td><td>diameter 1.8 mm</td></tr><tr><td>Separatory funnel</td><td>labbox</td><td>11409</td><td>500 mL</td></tr><tr><td>GluA2 primer Forward</td><td>GeneBank</td><td>NM_017261</td><td>CGGCAGCTCAGCTAAAAACT</td></tr><tr><td>GluA2 primer Reverse</td><td>GeneBank</td><td>NM_017261</td><td>TTGTAGCTGGTGGCTGTTGA</td></tr><tr><td>GluA3 primer Forward</td><td>GeneBank</td><td>NM_032990</td><td>ATTGCTGATGGTGCAATGAC</td></tr><tr><td>GluA3 primer Reverse</td><td>GeneBank</td><td>NM_032990</td><td>TTTGCATTGTCGCAAGTCTC</td></tr></tbody></table>

stereotactically-guided ablation of the rat auditory cortex, and localization of the lesion in the brain

쥐의 피 질 (AC) 청각 경험 의존 소성, 청각 지 각 과정, 및 소리 바꾸어 청각 핵 처리의 대뇌 피 질의 제어에 관심이 청각 신경 과학 수 사관 들에 게 인기가 되고있다. 새로운 주소를 도전, 정확 하 게 찾을 절차 그리고 수술 노출 청각 피 질 것이 연구 노력을 신속 하 게. 정위 적 신경외과 정기적으로 바늘 또는 청각 피 질 내의 미리 정의 된 위치에서 전극 engraft 동물 모델에서 전 임상 연구에 사용 됩니다. 다음 프로토콜을 사용 하 여 정위 적 방법을 새로운 방식. 우리 정의 창이 열리면, 정확 하 게 모두 주 (A1)를 노출 하는 쥐의 temporal bone 및 AC. 사용 하 여이 방법을 보조 (지 및 복 부) 외피가 표면 4 개의 좌표 지점을 식별, 우리는 수술 수행 AC의 제거입니다. 이러한 조작 수행 된 후 지역화, 크기, 병 변이 피 질에서의 확장을 평가할 필요가 있다. 따라서, 우리는 또한 두뇌의 표면에는 AC의 cytoarchitectural 한계를 전송 하 여 건설 좌표 지도 사용 하 여 AC 절제 사후를 쉽게 찾을 수 있는 방법을 설명 합니다. Stereotactically 기반 위치와 좌표 지도 사후에 부상 영역의 지역화와 AC의 절제의 조합 동물에서 얻은 정보의 유효성 검사를 용이 하 게 하 고 더 나은 분석을 리드 하 고 데이터 이해

우리 3 Wistar 쥐에 stereotactically 가이드 위치, 외과 노출 및 AC의 일방적인 제거를 수행합니다. 병 변의 지역화 제거 3에서 수행 확인 쥐 침식 AC (기본, 등, 그리고 복 부 외피가)의 주요 세분 그리고 총 AC 영역 (그림 2B)의 80 ~ 100%의 범위.
제한적인 AC 제거를 수행 하려면 여기에 설명 된 프로토콜 이전 바꾸어 청각 핵에서 대뇌 피 질의 제어 부족의 장기 효과 뿐만 아니라 소성의 후속 현상 연구를 우리의 실험실에서 사용 되었습니다. 이러한 연구에서 AC 제거의 프로토콜은 생리 (ABR)를 적용 하 여 검증 행동 (응답을 놀라게, prepulse 금지; PPI), 그리고 분자 (DNA microarrays, 정량, 그리고 서쪽 오 점) 방법13,14,15,,1617,18,19. 여기, 우리의 프로토콜의 효능을 보여 우리 3 AC 연기나 쥐 1 주일 동안 생존 시키고 수집 조직 수집 하는 동안 cochleae 단계 성인 달팽이 관에 가장 관련성이 높은 AMPA subunits의 표현에 변화를 공부 GluA2 및 GluA3, 정량에 의해. AC에서 사본 사이 비교 연기나 쥐 그리고 모든 수술 과정만 아니라 대뇌 피 질의 제거 수행 했다 가짜 제어 동물 다운 레 귤 레이 션 GluA2, 및 최대 규정 GluA3에 대 한 두 cochleae (그림 3)에 이 우리의 이전 계약 연구19.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56429/56429fig1.jpg"> 
그림 1: 세 가지 다른 수술 단계에서 쥐 측 뼈의 이미지. (A) 측 뼈를 ac stereotaxic 좌표의 이동. 4 개의 포인트 좌표는: a: A/P =-5.8 m m, M/L = + 6.4 m m; B: A/P =-2.7 m m, M/L = + 6.4 m m; C: A/P =-2.7 m m, M/L = + 8.67 m m; D: A/P =-5.8 m m, M/L = + 8.67 m m. (B) 좌표 창 개통을 안내할 것 입 측 뼈의 표면에 사각형을 그리는 데 참조로 사용 됩니다. 드릴링 후 뼈에 창 열 (C) 표시 합니다. 혈관 meninges 두뇌의 표면에 관찰 될 수 있다. R: rostral, d: 등입니다. <a href="http://ecsource.jove.com/files/ftp_upload/56429/56429fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56429/56429fig2.jpg"> 
그림 2: 쥐 뇌에 병 변을 찾기 위한 절차. (A) 사진 (Paxinos와 왓슨 좌표19)에 따르면 람다와 Bregma stereotactically 이식된 바늘으로 AC 연기나 뇌의 등 쪽 표면. 점선은 뇌의 등 쪽 표면에서 Bregma 및 Interaural 0 뿐만 아니라 9 cm x 9 cm 눈금에서의 위치를 표시합니다. (B)는 AC의 좌표 지도에 겹쳐 연기나 두뇌의 측면 표면의 사진. 병 변의 경계는 그림에서 빨간색으로 표시 됩니다. AC 영역의 경계는 지도에서 검정색으로 표시 됩니다. 이 예제에서는 총 면적 AC에 의해 점령에 관하여 AC 제거의 비율은 84.79%입니다. AC: 청각 피 질, IA: 청각, 인테르 FR: Rhinal 균열. <a href="http://ecsource.jove.com/files/ftp_upload/56429/56429fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56429/56429fig3.jpg"> 
그림 3: AMPA 수용 체 소 단위 GluA2 및 GluA3 일방적인 AC 제거 7 일 후 병 변 후의 mRNA 수준에서 변경. 결과 배 변경의 평균 ± 표준 편차로 표시 됩니다. GluA2 성적표에 대 한 변경 내용은 파란색으로 표시 됩니다. GluA3 성적표에 대 한 변경 내용 빨간색으로 표시 됩니다. GluA2에 있는 상당한 감소와 GluA3의 증가 두 cochleae에서 관찰 (ipsi-contralateral는 절제 하 고); 수술 후 7 일 없이 대뇌 피 질의 제거와 가짜 컨트롤을 기준으로 이것은 우리의 이전 결과19일치 하 여 이다. <a href="http://ecsource.jove.com/files/ftp_upload/56429/56429fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain at JoVE.com

Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain

쥐 청각 피 질 및 뇌에서 병 변의 지역화의 stereotactically 인도 제거

Stereotactically 기반 위치, 노출, 및 쥐에서 청각 피 질 제거 하는 방법을 설명합니다. 절제의 지역화 좌표 지도 사후를 사용 하 여 평가 됩니다.

The rat auditory cortex (AC) is becoming popular among auditory neuroscience investigators who are interested in experience-dependence plasticity, ...

stereotactically-guided-ablation-rat-auditory-cortex-localization

Research

JoVE Journal

Behavior

11.5K 조회수.  University of Salamanca. Stereotactically 기반 위치, 노출, 및 쥐에서 청각 피 질 제거 하는 방법을 설명합니다. 절제의 지역화 좌표 지도 사후를 사용 하 여 평가 됩니다.

비디오: Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain

Simultaneous fMRI and Electrophysiology in the Rodent Brain

To examine the neural basis of the blood oxygenation level dependent (BOLD) magnetic resonance imaging (MRI) signal, we have developed a rodent model in which functional MRI data and in vivo intracortical recording can be performed simultaneously. The combination of MRI and electrical recording is technically challenging because the electrodes used for recording distort the MRI images and the MRI acquisition induces noise in the electrical recording. To minimize the mutual interference of the two modalities, glass microelectrodes were used rather than metal and a noise removal algorithm was implemented for the electrophysiology data. In our studies, two microelectrodes were separately implanted in bilateral primary somatosensory cortices (SI) of the rat and fixed in place. One coronal slice covering the electrode tips was selected for functional MRI. Electrode shafts and fixation positions were not included in the image slice to avoid imaging artifacts. The removed scalp was replaced with toothpaste to reduce susceptibility mismatch and prevent Gibbs ringing artifacts in the images. The artifact structure induced in the electrical recordings by the rapidly-switching magnetic fields during image acquisition was characterized by averaging all cycles of scans for each run. The noise structure during imaging was then subtracted from original recordings. The denoised time courses were then used for further analysis in combination with the fMRI data. As an example, the simultaneous acquisition was used to determine the relationship between spontaneous fMRI BOLD signals and band-limited intracortical electrical activity. Simultaneous fMRI and electrophysiological recording in the rodent will provide a platform for many exciting applications in neuroscience in addition to elucidating the relationship between the fMRI BOLD signal and neuronal activity.

We have developed a method for simultaneous functional magnetic resonance imaging and electrophysiological recording in the rodent brain, providing a platform for the investigation of the relationship between neural activity and the blood oxygenation level dependent (BOLD) MRI signal.

쥐 두뇌에 동시 fMRI와 전기 생리학

To examine the neural basis of the blood oxygenation level dependent (BOLD) magnetic resonance imaging (MRI) signal, we have developed a rodent model in ...

연구

신경과학

A Wireless, Bidirectional Interface for In Vivo Recording and Stimulation of Neural Activity in Freely Behaving Rats

In vivo electrophysiology is a powerful technique to investigate the relationship between brain activity and behavior at a millisecond and micrometer scale. However, current methods mostly rely on tethered cable recordings or only use unidirectional systems, allowing either recording or stimulation of neural activity, but not at the same time or same target. Here, a new wireless, bidirectional device for simultaneous multichannel recording and stimulation of neural activity in freely behaving rats is described. The system operates through a single portable head stage that both transmits recorded activity and can be targeted in real-time for brain stimulation using a telemetry-based multichannel software. The head stage is equipped with a preamplifier and a rechargeable battery, allowing stable long-term recordings or stimulation for up to 1 h. Importantly, the head stage is compact, weighs 12 g (including battery) and thus has minimal impact on the animal&#180;s behavioral repertoire, making the method applicable to a broad set of behavioral tasks. Moreover, the method has the major advantage that the effect of brain stimulation on neural activity and behavior can be measured simultaneously, providing a tool to assess the causal relationships between specific brain activation patterns and behavior. This feature makes the method particularly valuable for the field of deep brain stimulation, allowing precise assessment, monitoring, and adjustment of stimulation parameters during long-term behavioral experiments. The applicability of the system has been validated using the inferior colliculus as a model structure.

A Wireless, Bidirectional Interface for In Vivo Recording and Stimulation of Neural Activity in Freely Behaving Rats

A wireless, bidirectional system for multi-channel neural recordings and stimulation in freely behaving rats is introduced. The system is light and compact, thus having minimal impact on the animal&#180;s behavioral repertoire. Moreover, this bidirectional system provides a sophisticated tool to assess causal relationships between brain activation patterns and behavior.

무선, Vivo에서 녹음 하 고 자유롭게 행동 하는 쥐에서 신경 활동의 자극에 대 한 양방향 인터페이스

In vivo electrophysiology is a powerful technique to investigate the relationship between brain activity and behavior at a millisecond and micrometer ...

행동분석학

Stereotaxic Surgery for Excitotoxic Lesion of Specific Brain Areas in the Adult Rat

Many behavioral functions in mammals, including rodents and humans, are mediated principally by discrete brain regions. A common method for discerning the function of various brain regions for behavior or other experimental outcomes is to implement a localized ablation of function. In humans, patient populations with localized brain lesions are often studied for deficits, in hopes of revealing the underlying function of the damaged area. In rodents, one can experimentally induce lesions of specific brain regions.
Lesion can be accomplished in several ways. Electrolytic lesions can cause localized damage but will damage a variety of cell types as well as traversing fibers from other brain regions that happen to be near the lesion site. Inducible genetic techniques using cell-type specific promoters may also enable site-specific targeting. These techniques are complex and not always practical depending on the target brain area. Excitotoxic lesion using stereotaxic surgery, by contrast, is one of the most reliable and practical methods of lesioning excitatory neurons without damaging local glial cells or traversing fibers.
Here, we present a protocol for stereotaxic infusion of the excitotoxin, N-methyl-D-aspartate (NMDA), into the basolateral amygdala complex. Using anatomical indications, we apply stereotaxic coordinates to determine the location of our target brain region and lower an injection needle in place just above the target. We then infuse our excitotoxin into the brain, resulting in excitotoxic death of nearby neurons. While our experimental subject of choice is a rat, the same methods can be applied to other mammals, with the appropriate adjustments in equipment and coordinates.
This method can be used on a variety of brain regions, including the basolateral amygdala1-6, other amygdala nuclei6, 7, hippocampus8, entorhinal cortex9 and prefrontal cortex10. It can also be used to infuse biological compounds such as viral vectors1, 11. The basic stereotaxic technique could also be adapted for implantation of more permanent osmotic pumps, allowing more prolonged exposure to a compound of interest.

Targeted ablation of specific brain region(s) by infusion of an excitotoxin using stereotaxic coordinates is described. This technique could also be adapted for infusion of other chemicals into the rat brain.

성인 쥐의 특정 두뇌 영역의 Excitotoxic 병변에 대한 Stereotaxic 외과

Many behavioral functions in mammals, including rodents and humans, are mediated principally by discrete brain regions. A common method for discerning the ...

Deep Brain Stimulation with Simultaneous fMRI in Rodents

In order to visualize the global and downstream neuronal responses to deep brain stimulation (DBS) at various targets, we have developed a protocol for using blood oxygen level dependent (BOLD) functional magnetic resonance imaging (fMRI) to image rodents with simultaneous DBS. DBS fMRI presents a number of technical challenges, including accuracy of electrode implantation, MR artifacts created by the electrode, choice of anesthesia and paralytic to minimize any neuronal effects while simultaneously eliminating animal motion, and maintenance of physiological parameters, deviation from which can confound the BOLD signal.&#160;Our laboratory has developed a set of procedures that are capable of overcoming most of these possible issues. For electrical stimulation, a homemade tungsten bipolar microelectrode is used, inserted stereotactically at the stimulation site in the anesthetized subject. In preparation for imaging, rodents are fixed on a plastic headpiece and transferred to the magnet bore. For sedation and paralysis during scanning, a cocktail of dexmedetomidine and pancuronium is continuously infused, along with a minimal dose of isoflurane; this preparation minimizes the BOLD ceiling effect of volatile anesthetics. In this example experiment, stimulation of the subthalamic nucleus (STN) produces BOLD responses which are observed primarily in ipsilateral cortical regions, centered in motor cortex. Simultaneous DBS and fMRI allows the unambiguous modulation of neural circuits dependent on stimulation location and stimulation parameters, and permits observation of neuronal modulations free of regional bias. This technique may be used to explore the downstream effects of modulating neural circuitry at nearly any brain region, with implications for both experimental and clinical DBS.

This protocol describes a standard method for simultaneous functional magnetic resonance imaging and deep brain stimulation in the rodent. The combined use of these experimental tools allows for the exploration of global downstream activity in response to electrical stimulation at virtually any brain target.

설치류에 동시 fMRI를 깊은 뇌 자극

In order to visualize the global and downstream neuronal responses to deep brain stimulation (DBS) at various targets, we have developed a protocol for ...

Microelectrode Guided Implantation of Electrodes into the Subthalamic Nucleus of Rats for Long-term Deep Brain Stimulation

Deep brain stimulation (DBS) is a widely used and effective therapy for several neurologic disorders, such as idiopathic Parkinson&#8217;s disease, dystonia or tremor. DBS is based on the delivery of electrical stimuli to specific deep anatomic structures of the central nervous system. However, the mechanisms underlying the effect of DBS remain enigmatic. This has led to an interest in investigating the impact of DBS in animal models, especially in rats. As DBS is a long-term therapy, research should be focused on molecular-genetic changes of neural circuits that occur several weeks after DBS. Long-term DBS in rats is challenging because the rats move around in their cage, which causes problems in keeping in place the wire leading from the head of the animal to the stimulator. Furthermore, target structures for stimulation in the rat brain are small and therefore electrodes cannot easily be placed at the required position. Thus, a set-up for long-lasting stimulation of rats using platinum/iridium electrodes with an impedance of about 1 M&#937; was developed for this study. An electrode with these specifications allows for not only adequate stimulation but also recording of deep brain structures to identify the target area for DBS. In our set-up, an electrode with a plug for the wire was embedded in dental cement with four anchoring screws secured onto the skull. The wire from the plug to the stimulator was protected by a stainless-steel spring. A swivel was connected to the circuit to prevent the wire from becoming tangled. Overall, this stimulation set-up offers a high degree of free mobility for the rat and enables the head plug, as well as the wire connection between the plug and the stimulator, to retain long-lasting strength.

A method for implanting electrodes into the subthalamic nucleus (STN) of rats is described. Better localization of the STN was achieved by using a microrecording system. Furthermore, a stimulation set-up is presented that is characterized by long-lasting connections between the head of the animal and the stimulator.

미세 전극은 장기 깊은 뇌 자극 쥐의 Subthalamic 핵에 전극의 주입을 가이드

Deep brain stimulation (DBS) is a widely used and effective therapy for several neurologic disorders, such as idiopathic Parkinson&#8217;s disease, ...

Concurrent Recording of Co-localized Electroencephalography and Local Field Potential in Rodent

Although electroencephalography (EEG) is widely used as a non-invasive technique for recording neural activities of the brain, our understanding of the neurogenesis of EEG is still very limited. Local field potentials (LFPs) recorded via a multi-laminar microelectrode can provide a more detailed account of simultaneous neural activity across different cortical layers in the neocortex, but the technique is invasive. Combining EEG and LFP measurements in a pre-clinical model can greatly enhance understanding of the neural mechanisms involved in the generation of EEG signals, and facilitate the derivation of a more realistic and biologically accurate mathematical model of EEG. A simple procedure for acquiring concurrent and co-localized EEG and multi-laminar LFP signals in the anesthetized rodent is presented here. We also investigated whether EEG signals were significantly affected by a burr hole drilled in the skull for the insertion of a microelectrode. Our results suggest that the burr hole has a negligible impact on EEG recordings.

This protocol describes a simple method for concurrent recording of co-localized electroencephalography (EEG) and multi-laminar local field potential in an anesthetized rat. A burr hole drilled in the skull for the insertion of a microelectrode is shown to produce negligible distortion of the EEG signal.

공동 화 된 Electroencephalography 및 설치류에서 로컬 필드 가능성의 동시 녹음

Although electroencephalography (EEG) is widely used as a non-invasive technique for recording neural activities of the brain, our understanding of the ...

A Micro-CT-based Method for Characterizing Lesions and Locating Electrodes in Small Animal Brains

Lesion and electrode location verification are traditionally done via histological examination of stained brain slices, a time-consuming procedure that requires manual estimation. Here, we describe a simple, straightforward method for quantifying lesions and locating electrodes in the brain that is less laborious and yields more detailed results. Whole brains are stained with osmium tetroxide, embedded in resin, and imaged with a micro-CT scanner. The scans result in 3D digital volumes of the brains with resolutions and virtual section thicknesses dependent on the sample size (12&#8211;15 and 5&#8211;6 &#181;m&#160;per voxel for rat and zebra finch brains, respectively). Surface and deep lesions can be characterized, and single tetrodes, tetrode arrays, electrolytic lesions, and silicon probes can also be localized. Free and proprietary software allows experimenters to examine the sample volume from any plane and segment the volume manually or automatically. Because this method generates whole brain volume, lesions and electrodes can be quantified to a much higher degree than in current methods, which will help standardize comparisons within and across studies.

This article describes a straightforward method to prepare small animal brains for micro-CT imaging, in which lesions can be quantified and electrodes located with high precision in the context of the whole brain.

병 변 특성화 및 작은 동물 두뇌에 전극을 위치에 대 한 마이크로-CT 기반 방법

Lesion and electrode location verification are traditionally done via histological examination of stained brain slices, a time-consuming procedure that ...

In vivo Positron Emission Tomography to Reveal Activity Patterns Induced by Deep Brain Stimulation in Rats

Deep brain stimulation (DBS) is an invasive neurosurgical technique based on the application of electrical pulses to brain structures involved in the patient&#39;s pathophysiology. Despite the long history of DBS, its mechanism of action and appropriate protocols remain unclear, highlighting the need for research aiming to solve these enigmas. In this sense, evaluating the in vivo effects of DBS using functional imaging techniques represents a powerful strategy to determine the impact of stimulation on brain dynamics. Here, an experimental protocol for preclinical models (Wistar rats), combined with a longitudinal study [18F]-fluorodeoxyclucose positron emission tomography (FDG-PET), to assess the acute consequences of DBS on brain metabolism is described. First, animals underwent stereotactic surgery for bilateral implantation of electrodes into the prefrontal cortex. A post-surgical computerized tomography (CT) scan of each animal was acquired to verify electrode placement. After one week of recovery, a first static FDG-PET of each operated animal without stimulation (D1) was acquired, and two days later (D2), a second FDG-PET was acquired while animals were stimulated. For that, the electrodes were connected to an isolated stimulator after administering FDG to the animals. Thus, animals were stimulated during the FDG uptake period (45 min), recording the acute effects of DBS on brain metabolism. Given the exploratory nature of this study, FDG-PET images were analyzed by a voxel-wise approach based on a paired T-test between D1 and D2 studies. Overall, the combination of DBS and imaging studies allows describing the neuromodulation consequences on neural networks, ultimately helping to unravel the conundrums surrounding DBS.

In vivo Positron Emission Tomography to Reveal Activity Patterns Induced by Deep Brain Stimulation in Rats

We describe a preclinical experimental method to evaluate metabolic neuromodulation induced by acute deep brain stimulation with in vivo FDG-PET. This manuscript includes all experimental steps, from stereotaxic surgery to the application of the stimulation treatment and the acquisition, processing, and analysis of PET images.

생체 내 쥐의 심부 뇌 자극에 의해 유도 된 활동 패턴을 밝히기위한 양전자 방출 단층 촬영

Deep brain stimulation (DBS) is an invasive neurosurgical technique based on the application of electrical pulses to brain structures involved in the ...

Implanting a Wireless Bidirectional Microelectrode System in a Rat Brain

Source: Melo-Thomas, L., et al., <a href="https://app.jove.com/v/56299">A Wireless, Bidirectional Interface for In Vivo Recording and Stimulation of Neural Activity in Freely Behaving Rats.</a> J. Vis. Exp. (2017)
The video demonstrates a procedure for implanting a wireless bidirectional multichannel electrode unit into a rat brain to record and stimulate multichannel neural networks.

쥐의 뇌에 무선 양방향 미세전극 시스템 이식

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
1. ...

JoVE Encyclopedia of Experiments

Neuroscience

Neurophysiology

Electrophysiology Techniques

A Stereotactically Guided Ablation Technique for Auditory Cortex Removal in Rats

Source: Lamas, V., et al. <a href="https://app.jove.com/v/56429">Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain.</a>&#160;J. Vis. Exp. (2017).
This video demonstrates a stereotactically-guided surgical procedure for ablating the auditory cortex in a rat. The steps include identifying anatomical landmarks in an anesthetized rat secured in a stereotactic frame, creating a window on the skull above the auditory cortex, aspirating the cortical layers, and providing post-operative care to assess the impact of the ablation on sound processing.

Source: Lamas, V., et al. Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain.&#160;J. Vis. Exp. ...