이 작품은 이스라엘 과학 재단 부여 514415 (대표)와 BSF NSF (MCB) 그랜트 2016707 (대표)에 의해 지원 되었다. 지 그 프 리드와 Irma Ullman 교수의 자 (제) 또한 인정에서 지원 합니다.

1. 조사 설계
참고:이 프로토콜 이미 fluorophores 태그로 상용 oligonucleotide 프로브를 사용 합니다. 프로브는 특정 시퀀스를 대상으로 보완 집합의 구성 mRNA, 단 하나 형광 성 분자를 활용 되 고 각 프로브. 또는,5,16설명 되어 있는 대로 프로브를 형광 마커를 연결 가능 하다.
<ol>
	<li>디자인 smFISH 프로브 Arjun Raj (밴 Oudenaarden 연구소, 매사 추세 츠 공대);에 의해 개발 된 프로브 디자이너16 알고리즘을 사용 하 시퀀스 smFISH 프로브이 원고에 사용 되는 재료의 테이블에 나열 됩니다. 참고: 최소 감지 신호에 대 한 집합에 프로브 수 ~ 30입니다. 정확한 숫자는 매우 짧은 성적 측정 하는 경우에 특히 관심의 유전자에 따라 달라질 수 있습니다.</li>
	<li>광 설치에 맞는 염료를 선택 (재료의 표 참조). 참고: Cy3 염료 또는 사진 표백 낮은 민감도와 광학 동일한 염료가 좋습니다. 듀얼 라벨에 대 한 후보는 Cy5 또는 광학 동일한 염료 (재료의 표 참조). 레이블이 지정 된 mRNA의 폭풍 이미징에 대 한 적합 한 염료 형광 방출의 여러 사이클에 대 한 그들의 능력에 의해 특징. 일부 smFISH 염료를 사용할 수 있는 스톰 이미징 (재료의 표 참조). 두 가지 (또는 그 이상) 성적표 같은 셀에 서로 다른 유전자에 해당 이미지를 하나 그 스펙트럼이 거의 없거나 전혀 없는 중복 염료를 활용 하는 oligonucleotide 프로브를 선택 해야 합니다.</li>
</ol>
2. 시 약 준비
참고: 필터링 된 피 펫 팁 등 튜브, RNase 무료 소모품을 사용 하 여 샘플 RNAse 무료를 유지 하 고 모든 작업 환경을 깨끗 하 게 유지 하는 것이 중요입니다. 대상 성적 저하를 방지 하려면 셀 고정 다음 사용 하는 모든 시 약 nuclease 무료 되어야 합니다 (재료의 표 참조) 또는 diethylpyrocarbonate (DEPC)-치료 및 살 균.
<ol>
	<li>SmFISH에 대 한 버퍼
	<ol>
		<li>1 x PBS RNase 무료 (버퍼링 인산 염, 인산 염 버퍼 농도 0.01 M의와 염화 나트륨 농도 0.154 m, (pH 7.4) 솔루션)을 준비 합니다. 10 x PBS RNase 무료 희석 (재료의 표 참조) nuclease 무료 물 (재료의 표 참조)에 1시 10분 v/v 비율.<ol>
			<li>DEPC 처리 1을 준비 또는 PBS x.</li>
		</ol>
		</li>
		<li>RNase 무료 준비 2 x SSC (염 분 나트륨 구 연산 염 버퍼, 0.03 M 나트륨 시트르산, (pH 7.0)에 0.3 M NaCl). RNase 무료 희석 20 x SSC (재료의 표 참조) nuclease 무료 물 1:10 v/v 비율.<ol>
			<li>DEPC 처리 2를 준비 하는 또는 x SSC.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Oligonucleotide 조사 재고 솔루션입니다.
	<ol>
		<li>다시 25 µ M. 프로브 재고를 만들려고 테 버퍼 (10 mM Tris HCl, 1 mM EDTA, pH 8.0)의 200 µ L에 말린된 oligonucleotide 조사 조화 분해를 위아래로 pipetting 다음 소용돌이 그리고 짧게 원심 분리기에 의해 잘 믹스.</li>
		<li>동결 및 재고 솔루션 튜브의 해빙을 방지 하려면 단일 실험 실행에 사용 될 것으로 예상 하는 금액을 해당 재고 솔루션의 여러 aliquots를 확인 합니다. -20 ° C에 또는 아래 재고 솔루션을 저장 하 고 빛 으로부터 보호. 참고: 5 nmol의 프로브 세트 최대 250 교 잡 반응을 제공할 수 있습니다.</li>
	</ol>
	</li>
	<li>교 잡 버퍼 (다음 스키 너 외. 7 ):
	<ol>
		<li>50ml 폴 리 프로필 렌 원뿔 하단 튜브를 nuclease 무료 물 5 mL를 추가 합니다. 물 1 g dextran 황산의 추가 하 고 활발 한 vortexing에 의해 해산. 거품 (~ 30 분) 사라질 때까지 궤도 셰이 커에 내용을 혼합.</li>
		<li>20x SSC의 1 mL, 200mm vanadyl ribonucleoside 복합물의 100 µ L, 50 mg/mL BSA의 40 µ L 이온된 formamide, 대장균 tRNA의 10 mg의 솔루션 3,530 µ L를 추가 합니다. 최종 볼륨을 가져올 10 mL DEPC 처리 물 또는 nuclease 무료 물, 그리고 소용돌이의 추가 의해 솔루션 동 질 때까지. 참고: 동결과 솔루션의 해빙을 방지 하려면 단일 실험 실행에 사용 될 것으로 예상 하는 금액을 해당 재고 솔루션의 여러 aliquots 확인 합니다. -20 ° c.에 재고 솔루션 저장 병을 열기 전에 formamide 실내 온도에 온난 하 게 해야 합니다. 백그라운드를 줄이기 위해, 그것은 최적의 formamide 농도 (10-40 %v / v 비율)을 보정 하기 위해 좋습니다. 
		주의: 경고! Formamide은 매우 독성이 고 알려진된 기형 발생 물질. 눈 또는 피부, 흡입 또는 섭취와 접촉을 하지 마십시오. 연기 후드 랩 코트와 보호 장갑을 착용 하는 동안 처리 합니다.</li>
		<li>0.22 μ m 필터를 통해 그것을 전달 하 여 솔루션을 소독. Aliquots에서 유지 하 고 1 년에-20 ° C에서 저장.</li>
	</ol>
	</li>
	<li>1 x PBS를 37% 포름알데히드 (v/v)을 추가 하 여 고정 버퍼 (1 x PBS에 4.6% 포름알데히드) 준비 (2.1.1 참조)는 1:8 비율 v/v와 소용돌이에. 주의: 경고! 포름알데히드는 매우 독성이 고 알려진된 발암 물질. 연기 후드 랩 코트와 보호 장갑을 착용 하는 동안 처리 합니다.</li>
	<li>SmFISH 워시 버퍼 준비 (2에서 20% formamide x SSC) 2 하 이온된 formamide를 추가 하 여 x SSC (2.1.2 참조) 1:4 비율 v/v 및 소용돌이.</li>
	<li>5mm 시스테 및 산소 청소부 (7 µ M 포도 당 산화 효소, 56 nM catalase 및 10% 포도 당 (w/v)) 워시 버퍼를 추가 하 여 이미지 버퍼 smFISH에 대 한 준비 (2에서 20% formamide x SSC)</li>
	<li>폭풍에 대 한 버퍼
	<ol>
		<li>50 mM Tris HCl과 10 mM NaCl nuclease 무료 물에 추가 하 여 버퍼 A를 준비 합니다. 참고: 저장소 년 RT에서.</li>
		<li>Nuclease 무료 물 포도 당 50 mM Tris HCl, 10 mM NaCl, 그리고 10 %w / v를 추가 하 여 버퍼 B을 준비 합니다. 참고: 저장소 최대 1 년에 4 ° C에서.</li>
		<li>77 mg 시스테 버퍼 A (은 1 M 솔루션)의 1 mL에 용 해 하 여 MEA 버퍼를 준비 합니다. 참고: 그것은 저장할 수 있습니다 4 ° C에서 1 개월.</li>
		<li>Gloxy 버퍼 8,440 AU (임의의 단위) 포도 당 산화 효소를 추가 하 여 준비 하 고 1 ml 70,200 AU catalase 버퍼 a. 참고: 재고 솔루션 x 50은 1 개월 4 ° C에서 저장 될 수 있다.</li>
		<li>50mm MEA 버퍼와 버퍼를 버퍼 B에 Gloxy x 1을 추가 하 여 이미지 버퍼 폭풍우를 위한 준비 참고: 폭풍에 대 한 이미징 버퍼 5mm 시스테, 10 mm NaCl, 50 mm Tris 산소 청소부 (7 µ M 포도 당 산화 효소와 56 nM catalase) 및 10% 포도 당 pH 8.0에서 구성 됩니다. 바로 영상 전에 준비, 저장 고 약 2 시간에 대 한 RT에 사용 될 수 있습니다.</li>
	</ol>
	</li>
</ol>
3. 샘플 고정
<ol>
	<li>세균성 세포 (예를들면, E. 성장</li></ol>대장균 MG1655) 선택 (예를 들어, 파운드 매체) 하룻밤 inan 궤도 흔드는 260 rpm 및 37 ° c.의 성장 매체에 참고: 확인 하려면 조사의 일반적인 바인딩 인해 배경에 있는 관심사의 유전자 삭제 된 스트레인 측정 실시 해야, (Δgalk 에 그림 1 과 ΔsodB 에서 참조 하는 동일한 절차에 따라 그림 2)입니다.
	<li>신선한 매체에 하룻밤 문화 1: 100 희석 하 고 그것의 광학 밀도 (OD600) 분 광 광도 계는 0.2-까지 모든 ~ 1 h에서 측정 0.4; 4 mL 문화 충분 해야 한다입니다. 참고: 선택한 현미경 단계 대조 또는 차동 간섭 콘트라스트 기능 없는 경우 대장균 외부 막 수 표시 2 μ M 닥터지 형광 표시와 함께 (재료의 표 참조)에 추가 해야 하는 세균 현 탁 액 고정17전에 20 분. 고정 및 추가 치료는 아래 설명 된 대로 수행 됩니다. 형광 마커 표시 프로브 세트와 스펙트럼 중복을 최소화 하기 위해 다른 방출 스펙트럼을 데 주의 해야 합니다.</li>
	<li>4 ° c.에 4, 500 g에 5 분 동안 원심 분리 하 여 펠 릿 셀 모든 튜브에서에서 상쾌한을 제거 합니다.</li>
	<li>각 관 1 x PBS의 1 mL을 추가 하 고 셀 셀 집계를 최소화 하기 위해 펠 렛 resuspend. 부드럽게 고정 버퍼와 소용돌이의 4 mL를 추가 합니다.</li>
	<li>24 ° c.에 30 분 동안 260 rpm에서 궤도 통에 샘플을 품 어</li>
	<li>10 분, 1000 g, 4 ° c.에 대 한 원심 분리 하 여 펠 릿 셀 상쾌한을 제거 합니다. 1 mL 1 x PBS를 추가 합니다.</li>
	<li>1.8 µ L 원뿔 아래쪽 마이크로 원심 관 (재료의 표 참조)에 정지를 전송 하 고 단계 3.6를 두 번 반복 합니다.</li>

4. 샘플 Permeabilization
<ol>
	<li>매우 신중 하 게 상쾌한을 제거 합니다. 작은 볼륨 펫을 사용 하 여 펠 릿 밖에 서 모든 액체를 제거 하는 데 필요한 경우.</li>
	<li>300 µ L DEPC 처리 물 또는 nuclease 무료 물 resuspend. 350 µ L 고급 절대 에탄올 (99%)를 추가 하 고 부드럽게 튜브를 거꾸로 하 여 혼합. 에탄올과 혼합 다시, 70% (v/v 비율)의 최종 에탄올 농도 도달의 또 다른 350 µ L를 추가 합니다. 주의: 경고! 에탄올은 가연성 이다.</li>
	<li>(RT), 실 온에서 1 h 20 rpm에서 튜브 회전자와 함께 샘플을 회전 또는 4 ° C에서 하룻밤. 샘플 4 ° C에서 1 주일에 저장할 수 있습니다.</li>
</ol>
5입니다. 교 잡
<ol>
	<li>7 분, 750 x g, 4 ° c.에 대 한 원심 분리 하 여 펠 릿 셀 상쾌한을 제거 합니다.</li>
	<li>1 mL 20% 샘플에 버퍼를 세척 하 고 두고 서 몇 분, 또는 펠 릿을 완전히 해산 피 펫에 대 한 추가 합니다.</li>
	<li>750 x g, 4 ° c.에 7 분 동안 원심 분리 하 여 펠 릿 셀</li>
	<li>매우 부드럽게 pipetting 여는 상쾌한을 제거 합니다. 작은 볼륨 펫을 사용 하 여 펠 릿 밖에 서 모든 액체를 제거 하는 데 필요한 경우.</li>
	<li>Oligonucleotide 조사 최종 oligonucleotide 농도 250 교 잡 버퍼 약 수를 재고 솔루션 설정 추가 nM; 소용돌이 적극적으로. 참고: 하나의 동일한 셀에 한 번에 두 개 이상의 다른 대상 mRNAs 레이블을 수 있습니다. 교 잡 버퍼를 두 대상의 프로브 세트를 추가 합니다. 염료 (예를 들어, Cy3와 Cy5) 스펙트럼 오버랩을 최소화 하기 위해 다른 방출 스펙트럼을가지고 선택할 수 주의 해야 합니다. 폭풍 이미징을 위한 샘플 스톰 (예를 들면, 자료의 테이블에서)에 대 한 적합 한 염료와 활용을 설정 하는 oligonucleotide 프로브 때 교배는 다는 것을 확인 하십시오.</li>
	<li>거품 (솔루션은 아주 점성)의 생성을 피하는 동안 oligonucleotide 조사를 포함 하는 50 µ L 교 잡 버퍼에 샘플 (단계 5.4 참조)를 일시 중단 합니다.</li>
	<li>어둠 속에서 30 ° C에서 뜨거운 블록에 샘플을 하룻밤 둡니다. 참고:이 다음 샘플 저장 될 수 있습니다 4 ° c.에서 최대 6 개월까지</li>
</ol>
6입니다. 세척
<ol>
	<li>1 새로운 microcentrifuge 튜브를 사용 하 여 이미지에 각 샘플에 대 한. 1 mL 워시 버퍼를 추가 합니다.</li>
	<li>워시 버퍼와 혼합/소용돌이 포함 하는 새 튜브를 교배 시킨된 견본에서 10-15 µ L를 추가 합니다.</li>
	<li>7 분 동안 원심 분리, 4 ° c.에 750 x g 펠 릿 셀 상쾌한을 제거 합니다. 참고: 배경을 줄이기 위해, 품 어 1 h 30 ° c.에 대 한</li>
	<li>두 번 더 세척 (1 mL 워시 버퍼에서 resuspend, 원심 및 펠 릿을 제거).</li>
	<li>25 µ L 워시 버퍼에 resuspend. 참고: 사진 표백 한 줄이기 위해 추가할 수 워시 버퍼에 단일 분자 형광 실험6염료 안정성 향상을 위해 시스템 (2.6) 청소는 산소.</li>
</ol>
7입니다. 영상에 대 한 샘플의 준비
참고: 셀 형광 및 위상 대비 현미경 적절 한 이미징 할 수 있도록 움직일 필요가 있다. 다음 방법 다른 초점 비행기에서 보기의 다른 분야 수 군데 샘플 준비를 사용할 수 있습니다.
<ol>
	<li>Agarose 젤 준비
	<ol>
		<li>10 mL 2 x SSC 버퍼에 150mg agarose를 추가 합니다. 2를 추가 하지 마십시오 x SSC agarose, 아니면 그것을 제대로 분해 되지 것입니다.</li>
		<li>10-15 s 큰 거품 형태로 시작 될 때까지 각 시간에 대 한 전자 렌지. 몇 분 동안 냉각을 정해.</li>
		<li>슬라이드의 센터 노출 되도록 슬라이드에 분리 실리콘 프레임을 놓습니다.</li>
		<li>슬라이드의 중심에서 10 m m 와이드 (1-2 m m 두께) 엄밀한 반지를 놓고 씰링에, 젤의 작은 금액을 입금 합니다. 강화에 그것에 대 일 분 정도 기다립니다.</li>
		<li>높은 돔 모양 형성 될 때까지 더 많은 젤을 추가 합니다. 강화 하 고, 그것을 위해 10 분을 기다려 하 고 (를 사용 하 여 정밀한 핀셋 또는 다른 방법) 반지를 제거.</li>
		<li>젤에 #0 coverslip 슬라이드 인감 (6.5 참조) 씻어 세균 세포의 ~ 10 μ를 입금.</li>
	</ol>
	</li>
	<li>SmFISH에 대 한 챔버 샘플 준비
	<ol>
		<li>또는 (단계로 7.1) immobilizing 씻어 세균 세포 (6.5 참조) 폴 리 D-라이 신-코팅 유리 하단 일회용 플라스틱 접시에 의해 이미징에 대 한 샘플을 준비.</li>
		<li>어둠 속에서, 실내 온도에, 하룻밤 시각화 표면에 세포의 접착을 허용 하기 전에 샘플을 품 어. 시각화 하기 전에 세척 한 번 워시 버퍼 (. 5); 예제 smFISH (2.6)에 대 한 세척 buffer(2.5) 또는 이미징 버퍼와 젖은 유지.</li>
	</ol>
	</li>
	<li>폭풍에 대 한 챔버 샘플 준비
	<ol>
		<li>폴 리 D-라이 신-코팅 유리 하단 일회용 플라스틱 접시에 이미징에 대 한 폭풍에 대 한 샘플을 준비 합니다.</li>
		<li>하룻밤에 RT, 어둠 속에서 샘플을 품 어. 워시 버퍼 smFISH (2.5);에 대 한 시각화 세척 한 번 하기 전에 고 스톰 (2.7.5)에 대 한 이미징 버퍼를 추가 합니다.</li>
	</ol>
	</li>
</ol>
8입니다.대 본 시각화
<ol>
	<li>전동된 스테이지를 갖춘 넓은 필드 형광 현미경으로 세포를 이미지 (자료의 표 참조). 참고: 폭풍 수정에 대 한 염료 형광 방출의 여러 사이클의 가능으로 표시 하는 셀을 사용 합니다. 3D 슈퍼 해상도 이미징 시스템을 사용 하 여 샘플 이미지 (예를 들어, 재료의 표 참조).</li>
	<li>사용 (권장)를 한다 x 60-100 &#62; 1.3 기름 침수 단계 대비 목표 렌즈는 강한 광원, 수은 또는 금속 할로겐 램프; 광원 LED 기반은 또한 것이 좋습니다.</li>
	<li>사용 표준 냉각 CCD 카메라, 이상적으로 낮은 조명 수평 영상 보다는 속도 (우리 16 µ m 픽셀 크기와 카메라를 사용)에 대 한 최적화 (재료의 표 참조). 참고: 사용 냉각된 EMCCD (전자 멀티 충전 결합 장치)의 카메라 CCD 카메라는 특히 단일 분자의 검출을 방지 하는 열 잡음을 줄이기 위해 필요 하다.</li>
	<li>사용 필터 설정 선택한 fluorophores에 적합 합니다.</li>
	<li>셀 경계를 제대로 확인 하려면 각 샘플 단계 대조 광학, 또는 라벨 붙일 외부 세포 막에서에서 보기의 다른 분야의 이미지를 취득 합니다. 모든 채널에 대 한 서로 다른 초점 평면 (z-스택)에서 이미지 (보통 13 조각 구분 기준: 250 nm 촬영). 참고: 필터 집합 및 현미경의 전동된 스테이지 상업에 의해 제어 해야한다 (재료의 표 참조) 또는 사내 소프트웨어를 순서 대로 스택 이미지를 캡처할 수 있습니다.</li>
</ol>
9. 데이터 분석
<ol>
	<li>이미지 스택 데이터 분석에 대 한 적합 한 형식으로 변환 합니다.</li>
	<li>대상의 복사본 수를 추정 mRNA 아닌 셀에 형광 foci의 총 강도에서 다른 현재 사용할 수 있는 프로토콜에서 이산 '관광 명소' 세.</li>
	<li>오픈 소스 소프트웨어18 또는 사용자 프로그램 이미지 분석을 실시 합니다. 자세한 내용은 데이터의 이미징 및 분석 참조 스키 너 외. 7</li>
</ol>

<ol>
	<li>Tsimring, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noise+in+biology.">Noise in biology.</a> Reports Prog. Phys. 77 (2), 26601 (2014).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+degradation+and+noise+of+small+RNA-controlled+genes+in+a+switch+activated+network+in+Escherichia+coli.">Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.</a> Nucleic Acids Res. 44 (14), 6707-6720 (2016).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+post-transcriptional+regulation+on+phenotypic+noise+in+Escherichia+coli.">Effects of post-transcriptional regulation on phenotypic noise in Escherichia coli.</a> Nucleic Acids Res. 41 (9), 4825-4834 (2013).</li><li>van Gijtenbeek, L. A., Robinson, A., van Oijen, A. M., Poolman, B., Kok, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+Spatial+Organization+of+mRNA,+Plasmids,+and+Ribosomes+in+a+Bacterial+Host+Overexpressing+Membrane+Proteins.">On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins.</a> PLOS Genet. 12 (12), e1006523 (2016).</li><li>Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes.">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nat. Methods. 5 (10), 877-879 (2008).</li><li>Raj, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+individual+endogenous+RNA+transcripts+in+situ+using+multiple+singly+labeled+probes.">Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes.</a> Methods Enzymol. 472 (10), (2010).</li><li>Skinner, S. O., La Sep&#250;lveda, ., Xu, H., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+mRNA+copy+number+in+individual+Escherichia+coli+cells+using+single-molecule+fluorescent+in+situ+hybridization.">Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization.</a> Nat. Protoc. 8 (6), 1100-1113 (2013).</li><li>Barakat, T. S., Gribnau, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+DNA-RNA+fluorescent+in+situ+hybridization+(FISH)+to+study+X+chromosome+inactivation+in+differentiated+female+mouse+embryonic+stem+cells.">Combined DNA-RNA fluorescent in situ hybridization (FISH) to study X chromosome inactivation in differentiated female mouse embryonic stem cells.</a> J. Vis. Exp. (88), e51628 (2014).</li><li>Chen, K. H., Boettiger, A. N., Moffitt, J. R., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+imaging.+Spatially+resolved,+highly+multiplexed+RNA+profiling+in+single+cells.">RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells.</a> Science. 348 (6233), aaa6090 (2015).</li><li>van Gijtenbeek, L. A., Kok, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+messengers:+An+update+and+outlook+on+RNA+visualization+in+bacteria.">Illuminating messengers: An update and outlook on RNA visualization in bacteria.</a> Front. Microbiol. 8, 1-19 (2017).</li><li>Fei, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+in+vivo+target+search+kinetics+of+regulatory+noncoding+RNA.">Determination of in vivo target search kinetics of regulatory noncoding RNA.</a> Science. 347 (6228), 1371-1374 (2015).</li><li>Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+organization+shapes+the+turnover+of+a+bacterial+transcriptome.">Spatial organization shapes the turnover of a bacterial transcriptome.</a> Elife. 5, 1-22 (2016).</li><li>Ong, W. Q., Citron, Y. R., Sekine, S., Huang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+Cell+Imaging+of+Endogenous+mRNA+Using+RNA-Based+Fluorescence+"Turn-On"+Probe.">Live Cell Imaging of Endogenous mRNA Using RNA-Based Fluorescence "Turn-On" Probe.</a> ACS Chem. Biol. , (2016).</li><li>Golding, I., Paulsson, J., Zawilski, S. M., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+kinetics+of+gene+activity+in+individual+bacteria.">Real-time kinetics of gene activity in individual bacteria.</a> Cell. 123 (6), 1025-1036 (2005).</li><li>Golding, I., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+8+Spatiotemporal+Dynamics+in+Bacterial+Cells:+Real-Time+Studies+with+Single-Event+Resolution.">Chapter 8 Spatiotemporal Dynamics in Bacterial Cells: Real-Time Studies with Single-Event Resolution.</a> Methods Cell Biol. 89 (8), (2008).</li><li>So, L. H., Ghosh, A., Zong, C., Sepulveda, L. A., Segev, R., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+properties+of+transcriptional+time+series+in+Escherichia+coli.">General properties of transcriptional time series in Escherichia coli.</a> Nat. Genet. 43 (6), 554-560 (2011).</li><li>Spahn, C., Endesfelder, U., Heilemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-resolution+imaging+of+Escherichia+coli+nucleoids+reveals+highly+structured+and+asymmetric+segregation+during+fast+growth.">Super-resolution imaging of Escherichia coli nucleoids reveals highly structured and asymmetric segregation during fast growth.</a> J. Struct. Biol. 185 (3), 243-249 (2014).</li><li>Sliusarenko, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbetracker+software.">Microbetracker software.</a> Mol Microbiol. 80 (3), 612-627 (2012).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, 8 (2006).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+degradation+and+noise+of+small+RNA-controlled+genes+in+a+switch+activated+network+in+Escherichia+coli.">Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.</a> Nucleic Acids Res. 44 (14), 6707-6720 (2016).</li><li>Brandt, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+two-state+stabilization-change+mechanism+for+proton-pumping+complex+I.">A two-state stabilization-change mechanism for proton-pumping complex I.</a> Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1807 (10), 1364-1369 (2011).</li></ol>

저자는 공개 없다.

우리 smFISH 방법2를 사용 하 여 대장균 세포에 다른 유전자의 사본 수 우리의 실험실에서 측정 했습니다. 간단히,이 절차는 다음 단계로 구성 됩니다: 셀 고정, 프로브 삽입을 허용 하는 세포 막의 permeabilization 교 잡, 프로브 및 영상 표준 형광 현미경을 사용 하 여 샘플. 이 절차는 일부 수정6,,716게시 했?...

Stochasticity는 유전자 발현의 근본적이 고 피할 수 없는 측면 이며 셀 셀이1, 성적 및 단백질2,3의 수준에서 모두 증가 제공 합니다. 잘 정의 된 조건 하에서 세포 사이 가변성을 측정 독특한 창 유전자 발현 및 그것의 규칙의 기반이 되는 기본 프로세스에 제공 합니다. 셀이 박테리아에의 한 중요 한 소스는 transcriptional 수준에서 일어난다. 사본 숫자 규정 등 post-transcriptional 프로세스 뿐만 아니라 전사의 stochasticity 때문에 뿐만 아니라 작은 RNAs 및 RNAases2마다 다릅니다. 양적 패션에서이 성분에 직접 액세스 하는 한 가지 방법은 붙일 smFISH에 주어진된 유전자의 개별 성적표를 태그입니다. 이 방법론 검색 및 특정 RNA 분자의 subcellular 지 방화, 개별 박테리아 세포4고정 수 있습니다. mRNAs는 붙일 표시 된 관심5,6의 성적표에 선택적으로 바인딩할 디자인 된 ~ 20 자료-긴 oligonucleotides의 세트로 때 교배. 여러 라벨 배경 형광, 위에 검출 및 개별 mRNA 분자 형광 현미경7 (참조 그림 1) 회절 제한 된 반점으로 나타납니다. MRNA 분자, 상호 보완적인 올리고 머 프로브 보조 붙일 레이블 기자 기법8을 사용 하 여 검색 된 활용된 haptens (예를 들어, biotin 또는 digoxigenin)를가지고 라벨에 대 한 다른 접근이 있다.
SmFISH 이외에 성적에 대 한 정량적 인 정보를 제공 하는 다른 방법이 있다. 북부 등 일부 오 점 또는 양이 많은 PCR 일괄 프로브 따라서 mRNA 사본의 수 없으며 개별 셀에서 그들의 위치를 측정할 수 있습니다. 따라서 이러한 방법은 셀 변화 척도를 적합 하지 않습니다. 최근 이미지 기반 기술은 모두 세포 내 RNAs의 복사본 수로 라는 그들의 세포내 위치의 정량화 다중화 오류 강력한 형광 제자리에서 교 잡 (MERFISH)에 대 한 수 있도록 개발 되었습니다. MERFISH 고정된 개수의 붙일 레이블 oligonucleotide 조사에서 정의 된 조합으로 구성 된 고유 바코드의 할당을 기반으로 합니다. 이러한 바코드는 smFISH 측정의 순차적 라운드에서 밖으로 읽힌다, photobleaching와 함께 다음 각 교 잡, 두 배나9,10처리량 증가의. 이 기술은 시스템 및 프로브 세트의 적절 한 디자인 처리는 자동화 된 유체를 필요로 합니다.
해상도에 ten-fold 증가 있습니다 여러 형광 라벨 확률적 광학 재건 현미경 (폭풍)11, 같은 소설 슈퍼 해상도 기술 함께 개별 성적표의의 subcellular 국산화 성적 증명서 폭풍, 형광 프로브 및 이미징 버퍼의 적당 한 조합 당 (깜박이) 프로브 분자 형광 방출의 여러 사이클에 대 한 수 있습니다. 폭풍은 대장균 transcriptome 이미지 및 관심12의 동시에 모든 성적 증명서를 라벨에 의해 RNA의 게놈 넓은 공간 조직 관찰에 사용할 수 있습니다.
위에 검토 하는 모든 단일 셀 방법 고정된 셀에 녹취 록을 이미징 기반으로 합니다. 따라서, 그들은 세포 내에서 성적 운동 속성에 관한 모든 정보를 제공 하지 않습니다. 라이브 셀13에서 성적에 따라, mRNAs 사이트 바인딩 배열에 관심사의 유전자의 융합에 의해 표시 수 있습니다. 이 후자는 다음에 의해 인식 같은 살 균 소 MS2 외 투 단백질, 녹색 형광 단백질 (GFP)10,,1415등 형광 단백질을 융합 한 RNA 의무적인 단백질.
여기는 특히 대장균에 놓여있는지 표시 된 DNA 프로브, smFISH 실험에 사용 하기 위해 집합으로 개별 mRNAs를 라벨에 대 한 방법에 설명 합니다. 또한, 우리는 동일한 라벨 체계 사소한 수정 폭풍 측정을 위해 사용 될 수 있습니다 보여줍니다.

<table><tbody><tr><td>Dextran sulfate sodium salt</td><td>Sigma-Aldrich</td><td>D8906</td><td></td></tr><tr><td>Pure Ethanol, 99.5%, ACS reagent, absolute</td><td>Mallinckrodt Baker - Avantor</td><td>8025.25</td><td></td></tr><tr><td>Diethylpyrocarbonate (DEPC)</td><td>Sigma-Aldrich</td><td>D5758</td><td></td></tr><tr><td>RNase-free 20X SSC</td><td>Life Technologies/Ambion</td><td>AM9763</td><td></td></tr><tr><td>RNase-free 10X PBS</td><td>Life Technologies/Ambion</td><td>AM9625</td><td></td></tr><tr><td>TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) BioUltra, for molecular biology</td><td>Sigma-Aldrich</td><td>93283</td><td></td></tr><tr><td>nuclease-free water</td><td>Thermo Fisher Scientific</td><td>10977035</td><td></td></tr><tr><td>Formaldehyde solution for molecular biology, 36.5-38% in water</td><td>Sigma-Aldrich</td><td>F8775</td><td></td></tr><tr><td>Deionized formamide, nuclease free</td><td>Thermo Fisher Scientific/Ambion</td><td>AM9342</td><td></td></tr><tr><td>E. coli tRNA (ribonucleic acid, transfer type xx from escherichia)</td><td>Sigma-Aldrich</td><td>R1753-500UN</td><td></td></tr><tr><td>UltraPure BSA (50mg/ml)</td><td>Thermo Fisher Scientific/Ambion</td><td>AM2616</td><td></td></tr><tr><td>Vanadyl-ribonucleoside complex,VRC, 200 mM</td><td>New England Biolab</td><td>S1402S</td><td></td></tr><tr><td>Poly-L-Lysine</td><td>Sigma</td><td>P4707</td><td></td></tr><tr><td>Cysteamine and oxygen</td><td>Sigma-Aldrich</td><td>30070</td><td></td></tr><tr><td>Glucose Oxidase from Aspergillus niger, Type VII, 50KU</td><td>Sigma-Aldrich</td><td>G2133</td><td></td></tr><tr><td>Catalase</td><td>Sigma-Aldrich</td><td>C40</td><td></td></tr><tr><td>D-glucose</td><td>Sigma-Aldrich</td><td>G8270</td><td></td></tr><tr><td>D-fucose</td><td>Sigma-Aldrich</td><td>F8150</td><td></td></tr><tr><td>Vybrant DiO Cell-Labeling Solution</td><td>Life Technologies</td><td>V2286</td><td></td></tr><tr><td>Agarose,low melting reagent</td><td>Sigma-Aldrich</td><td>A9414</td><td></td></tr><tr><td>Adhesive silicone isolator 24-2mm Dia. X 1.8 mm depth JTR24R-A2-2.0</td><td>Grace Bio-Labs</td><td>JTR24R-A2-2.0&lt;span&gt; &lt;/span&gt;666208</td><td></td></tr><tr><td>poly-D-lysine-coated glass bottom Glass Bottom Culture Dishes</td><td>MatTek Corporation</td><td>P35GC-1.5-14-C</td><td></td></tr><tr><td>Super life nitrile powder free examination gloves</td><td>Supermax</td><td>TC-N-9889</td><td></td></tr><tr><td>Brand sterilization incubator tape</td><td>Sigma-Aldrich</td><td>BR61750</td><td></td></tr><tr><td>Microcentrifuge tubes (1.8 ml)</td><td>Axygen - Corning Life Sciences</td><td>MCT-175C</td><td></td></tr><tr><td>Falcon round-bottom polypropylene tubes (14 ml)</td><td>BD Biosciences</td><td>352059</td><td></td></tr><tr><td>Conical-bottom centrifuge polypropylene tubes (50 ml)</td><td>Corning</td><td>430828</td><td></td></tr><tr><td>Serological pipettes (Corning 5 ml)</td><td>Corning Life Sciences</td><td>4051</td><td></td></tr><tr><td>Serological pipettes (Corning 10 ml)</td><td>Corning Life Sciences</td><td>4488</td><td></td></tr><tr><td>Serological pipettes (Corning 25 ml)</td><td>Corning Life Sciences</td><td>4251</td><td></td></tr><tr><td>Spectrophotometer cuvettes</td><td>Sarstedt</td><td>67.742</td><td></td></tr><tr><td>RNase-free pipette tips 0.2 - 20 &amp;mu;l</td><td>FroggaBio</td><td>FT20</td><td></td></tr><tr><td>RNase-free pipette tips 10 - 200 &amp;mu;l</td><td>Axigene/corning</td><td>TF-200</td><td></td></tr><tr><td>RNase-free pipette tips 100 - 1000 &amp;mu;l</td><td>FroggaBio</td><td>FT1000</td><td></td></tr><tr><td>RNase-free pipette tips 100 - 1000 &amp;mu;l</td><td>Sorenson</td><td>14200</td><td></td></tr><tr><td>Syringe disposile 10 mL needle G-21</td><td>Becton Dickinson, Biosciences</td><td>BD-309643</td><td></td></tr><tr><td>Minisart 0.2 um Syringe Filter</td><td>Sartorius</td><td>16534 K</td><td></td></tr><tr><td>Nikon instruments microscope type A immersion oil A, 8cc</td><td>Nikon</td><td>MXA20233</td><td></td></tr><tr><td>Microscope slides 76 x26, 3&quot;x1&quot;x1mm</td><td>Thermo Fisher Scientific</td><td>421-004ET</td><td></td></tr><tr><td>#0 coverslip slide 24x60</td><td>Thermo Fisher Scientific/Menzel</td><td>BNBB024060A0</td><td></td></tr><tr><td>Orbital shaker</td><td>M.R.C</td><td>TOU-50</td><td></td></tr><tr><td>Hot block</td><td>M.R.C</td><td></td><td></td></tr><tr><td>Vortex</td><td>Fried Electric Company</td><td>G-560-E</td><td></td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>5427R</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5810R</td><td></td></tr><tr><td>Portable Pipet-Aid XP2, Pipette Controller</td><td>Drummond Scientific Company</td><td>4-000-501-I</td><td></td></tr><tr><td>OD600 Spectrophotometer for Bacterial Growth Rates DiluPhotometer</td><td>Midsci</td><td>OD600-10</td><td></td></tr><tr><td>iXon X3 EMCCD camera</td><td>Andor</td><td>DU-897E-CS0-#BV</td><td> </td></tr><tr><td>Eclipse Ti microscope</td><td>Nikon</td><td>MEA53100</td><td> </td></tr><tr><td>CFI plan apochromat DM 100X oil objective lambda PH-3 N.A 1.45 WD 0.13</td><td>Nikon</td><td>MRD31905</td><td> </td></tr><tr><td>Filter set (TRITC/CY3): EX - ET545/30X; EM - ET620/60M; BS - T570LP</td><td>Nikon</td><td>49005</td><td> </td></tr><tr><td>Filter set (CY5): EX - ET640/30X; EM - ET690/50M; BS - T660P</td><td>Nikon</td><td>49009</td><td> </td></tr><tr><td>Nis-elements AR auto reaserch software</td><td>Nikon</td><td>MQS31000</td><td> </td></tr><tr><td>STORM microscope</td><td>Vutara</td><td>SR-200</td><td> </td></tr><tr><td>NA 1.2 water immersion objective&lt;span&gt; &lt;/span&gt;</td><td>Olympus</td><td> </td><td> </td></tr><tr><td>SRX image acquisition and analysis software</td><td>Vutara</td><td></td><td></td></tr><tr><td>Evolve 512 EMCCD camera</td><td>Photometrics</td><td></td><td></td></tr><tr><td>Stellaris&amp;reg; FISH Probes, Custom Assay with CAL Fluor&amp;reg; Red 590 Dye</td><td>Biosearch Technologies Inc</td><td>SMF-1083-5</td><td></td></tr><tr><td>&lt;strong&gt;Probe Sequence for galK mRNA:&lt;/strong&gt;</td><td> </td><td> </td><td></td></tr><tr><td>gtgttttttctttcagactc</td><td> </td><td> </td><td></td></tr><tr><td>tagccaaatgcgttggcaaa</td><td> </td><td> </td><td></td></tr><tr><td>ctgaatggtgtgagtggcag</td><td> </td><td> </td><td></td></tr><tr><td>caccaatcaaattcacgcgg</td><td> </td><td> </td><td></td></tr><tr><td>acgaaaccgtcgttgtagtc</td><td> </td><td> </td><td></td></tr><tr><td>tgataatcaatcgcgcaggg</td><td> </td><td> </td><td></td></tr><tr><td>gtggtgcacaactgatcacg</td><td> </td><td> </td><td></td></tr><tr><td>acgcgaactttacggtcatc</td><td> </td><td> </td><td></td></tr><tr><td>gctgattttcataatcggct</td><td> </td><td> </td><td></td></tr><tr><td>gcatcgagggaaaactcgtc</td><td> </td><td> </td><td></td></tr><tr><td>gttttcatgtgcgacaatgg</td><td> </td><td> </td><td></td></tr><tr><td>cacgccacgaacgtagttag</td><td> </td><td> </td><td></td></tr><tr><td>ttacgcagttgcagatgttt</td><td> </td><td> </td><td></td></tr><tr><td>tccagtgaagcggaagaact</td><td> </td><td> </td><td></td></tr><tr><td>tgctgcaatacggttccgac</td><td> </td><td> </td><td></td></tr><tr><td>gtccagcggcagatgataaa</td><td> </td><td> </td><td></td></tr><tr><td>tgaccgttaagcgcgatttg</td><td> </td><td> </td><td></td></tr><tr><td>agcctacaaactggttttct</td><td> </td><td> </td><td></td></tr><tr><td>gcggaaattagctgatccat</td><td> </td><td> </td><td></td></tr><tr><td>aaggcatgatctttcttgcc</td><td> </td><td> </td><td></td></tr><tr><td>cagtgagcggcaatcgatca</td><td> </td><td> </td><td></td></tr><tr><td>tgggcatggaaactgctttg</td><td> </td><td> </td><td></td></tr><tr><td>gatgatgacgacagccacac</td><td> </td><td> </td><td></td></tr><tr><td>gggtacgtttgaagttactg</td><td> </td><td> </td><td></td></tr><tr><td>gtgttgtattcgctgccaac</td><td> </td><td> </td><td></td></tr><tr><td>ggtttcgcactgttcacgac</td><td> </td><td> </td><td></td></tr><tr><td>tggctgctggaagaaacgcg</td><td> </td><td> </td><td></td></tr><tr><td>ttcaatggtgacatcacgca</td><td> </td><td> </td><td></td></tr><tr><td>catgcgcaacagcgttgaac</td><td> </td><td> </td><td></td></tr><tr><td>ggcgttttcagtcagtatat</td><td> </td><td> </td><td></td></tr><tr><td>atacgtttcaggtcgccttg</td><td> </td><td> </td><td></td></tr><tr><td>tgagactccgccatcaactc</td><td> </td><td> </td><td></td></tr><tr><td>gaaatcatcgcgcatagagg</td><td> </td><td> </td><td></td></tr><tr><td>caatttgcggcacggtgatt</td><td> </td><td> </td><td></td></tr><tr><td>ttgacgatttctaccagagt</td><td> </td><td> </td><td></td></tr><tr><td>acctttgtcgccaatcacag</td><td> </td><td> </td><td></td></tr><tr><td>ggatcagcgcgacgatacag</td><td> </td><td> </td><td></td></tr><tr><td>atattgttcagcgacagctt</td><td> </td><td> </td><td></td></tr><tr><td>gtctctttaatacctgtttt</td><td> </td><td> </td><td></td></tr><tr><td>ctccttgtgatggtttacaa</td><td> </td><td> </td><td></td></tr><tr><td>Stellaris&amp;reg; FISH Probes, Custom Assay with Quaser Fluor&amp;reg; Red 670 Dye</td><td>Biosearch Technologies Inc</td><td>SMF-1083-5</td><td></td></tr><tr><td>&lt;strong&gt;Probe Sequence for sodB mRNA:&lt;/strong&gt;</td><td> </td><td> </td><td></td></tr><tr><td>gtgttttttctttcagactc</td><td> </td><td> </td><td></td></tr><tr><td>tagccaaatgcgttggcaaa</td><td> </td><td> </td><td></td></tr><tr><td>ctgaatggtgtgagtggcag</td><td> </td><td> </td><td></td></tr><tr><td>caccaatcaaattcacgcgg</td><td> </td><td> </td><td></td></tr><tr><td>acgaaaccgtcgttgtagtc</td><td> </td><td> </td><td></td></tr><tr><td>tgataatcaatcgcgcaggg</td><td> </td><td> </td><td></td></tr><tr><td>gtggtgcacaactgatcacg</td><td> </td><td> </td><td></td></tr><tr><td>acgcgaactttacggtcatc</td><td> </td><td> </td><td></td></tr><tr><td>gctgattttcataatcggct</td><td> </td><td> </td><td></td></tr><tr><td>gcatcgagggaaaactcgtc</td><td> </td><td> </td><td></td></tr><tr><td>gttttcatgtgcgacaatgg</td><td> </td><td> </td><td></td></tr><tr><td>cacgccacgaacgtagttag</td><td> </td><td> </td><td></td></tr><tr><td>ttacgcagttgcagatgttt</td><td> </td><td> </td><td></td></tr><tr><td>tccagtgaagcggaagaact</td><td> </td><td> </td><td></td></tr><tr><td>tgctgcaatacggttccgac</td><td> </td><td> </td><td></td></tr><tr><td>gtccagcggcagatgataaa</td><td> </td><td> </td><td></td></tr><tr><td>tgaccgttaagcgcgatttg</td><td> </td><td> </td><td></td></tr><tr><td>agcctacaaactggttttct</td><td> </td><td> </td><td></td></tr><tr><td>gcggaaattagctgatccat</td><td> </td><td> </td><td></td></tr><tr><td>aaggcatgatctttcttgcc</td><td> </td><td> </td><td></td></tr><tr><td>cagtgagcggcaatcgatca</td><td> </td><td> </td><td></td></tr><tr><td>tgggcatggaaactgctttg</td><td> </td><td> </td><td></td></tr><tr><td>gatgatgacgacagccacac</td><td> </td><td> </td><td></td></tr><tr><td>gggtacgtttgaagttactg</td><td> </td><td> </td><td></td></tr><tr><td>gtgttgtattcgctgccaac</td><td> </td><td> </td><td></td></tr><tr><td>ggtttcgcactgttcacgac</td><td> </td><td> </td><td></td></tr><tr><td>tggctgctggaagaaacgcg</td><td> </td><td> </td><td></td></tr><tr><td>ttcaatggtgacatcacgca</td><td> </td><td> </td><td></td></tr><tr><td>catgcgcaacagcgttgaac</td><td> </td><td> </td><td></td></tr><tr><td>ggcgttttcagtcagtatat</td><td> </td><td> </td><td></td></tr><tr><td>atacgtttcaggtcgccttg</td><td> </td><td> </td><td></td></tr><tr><td>tgagactccgccatcaactc</td><td> </td><td> </td><td></td></tr><tr><td>gaaatcatcgcgcatagagg</td><td> </td><td> </td><td></td></tr><tr><td>caatttgcggcacggtgatt</td><td> </td><td> </td><td></td></tr><tr><td>ttgacgatttctaccagagt</td><td> </td><td> </td><td></td></tr><tr><td>acctttgtcgccaatcacag</td><td> </td><td> </td><td></td></tr><tr><td>ggatcagcgcgacgatacag</td><td> </td><td> </td><td></td></tr><tr><td>atattgttcagcgacagctt</td><td> </td><td> </td><td></td></tr><tr><td>gtctctttaatacctgtttt</td><td> </td><td> </td><td></td></tr><tr><td>ctccttgtgatggtttacaa</td><td> </td><td> </td><td></td></tr></tbody></table>

method for labeling transcripts in individual escherichia coli cells for single-molecule fluorescence in situ hybridization experiments

고정된 박테리아 대장균에 있는 단일 분자 형광 제자리에서 교 잡 (smFISH) 실험에 사용 하기 위해 성적 증명서 개별 메신저 RNA (mRNA)를 라벨에 대 한 방법을 설명 합니다. smFISH는 성적 증명서의 subcellular 위치 뿐 아니라 관심의 유전자의 mRNA 사본 수에 셀 다양성의 측정을 허용 한다. 주요 단계는 세균성 세포 배양의 고정, 세포 막의 permeabilization 및 상업적으로 사용 가능한 짧은 붙일 레이블 oligonucleotide 조사 세트와 함께 대상 증명서의 교 잡. smFISH는 다른 형광 마커 사이의 스펙트럼 중복에 의해 부과 된 제한 같은 셀에 여러 유전자의 성적 이미지를 허용할 수 있습니다. 아래 설명 하는 프로토콜의 완료, 다음 셀 수 있을 쉽게 몇 군데 낮은 강도의 형광을 위해 적당 한 카메라와 함께 결합 하는 현미경을 사용 하 여. 셀 윤곽선 세분화 단계 대비 프레임, 또는 세포 막 얼룩에서 함께 이러한 이미지 오픈 소스 또는 사용자 작성 소프트웨어를 사용 하 여 셀의 샘플의 mRNA 사본 숫자 분포의 계산을 허용 한다. 여기 설명 하는 표기 방법은 확률적 광학 재건 현미경 (스톰)와 성적 증명서 이미지에 적용할 수 있습니다.

우리는 대장균 세포에 galK 및 sodB 내용은의 smFISH 측정에 실시 한다. 녹취 록은 특정 시퀀스 단 하나 형광 성 분자를 활용 되 고 각 조사 대상 시퀀스를 보완의 세트로 때 교배 (재료의 표 참조). 형광 및 위상 대비 MG1655 야생-타입의 이미지 E. 콜라이 긴장 (WT) 또는 JW0740 (게이오 컬렉션)19 galK 삭제 긴장 (ΔgalK) 2 m m D-fucose 그...

Watch this Scientific Journal Video about Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments at JoVE.com

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

단일 분자 형광 제자리에서 교 잡 실험에 대 한 개별 대장균 세포에 성적표를 라벨에 대 한 방법

이 원고 붙일 표시 된 DNA 프로브, 대장균에 있는 단일 분자 형광 제자리에서 교 잡 (smFISH) 실험에 사용 하기 위해 개별 메신저 RNA (mRNA) 성적표를 라벨에 대 한 방법을 설명 합니다. smFISH 동시 탐지, 지역화, 고 고정된 개별 셀에 단일 mRNA 분자의 정량화를 허용 하는 시각화 방법입니다.

A method is described for labeling individual messenger RNA (mRNA) transcripts in fixed bacteria for use in single-molecule fluorescence in situ ...

method-for-labeling-transcripts-individual-escherichia-coli-cells-for

Research

JoVE Journal

Biology

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

8.1K 조회수.  Weizmann Institute of Science. 이 원고 붙일 표시 된 DNA 프로브, 대장균에 있는 단일 분자 형광 제자리에서 교 잡 (smFISH) 실험에 사용 하기 위해 개별 메신저 RNA (mRNA) 성적표를 라벨에 대 한 방법을 설명 합니다. smFISH 동시 탐지, 지역화, 고 고정된 개별 셀에 단일 mRNA 분자의 정량화를 허용 하는 시각화 방법입니다.

비디오: Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

Single Molecule Fluorescence In Situ Hybridization (smFISH) Analysis in Budding Yeast Vegetative Growth and Meiosis

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect and count individual RNA molecules. Complementary to deep sequencing-based methods, smFISH provides information about the cell-to-cell variation in transcript abundance and the subcellular localization of a given RNA. Recently, we have used smFISH to study the expression of the gene&#160;NDC80&#160;during meiosis in budding yeast, in which two transcript isoforms exist and the short transcript isoform has its entire sequence shared with the long isoform. To confidently identify each transcript isoform, we optimized known smFISH protocols and obtained high consistency and quality of smFISH data for the samples acquired during budding yeast meiosis. Here, we describe this optimized protocol, the criteria that we use to determine whether high quality of smFISH data is obtained, and some tips for implementing this protocol in&#160;other yeast strains and growth conditions.

Single Molecule Fluorescence In Situ Hybridization smFISH Analysis in Budding Yeast Vegetative Growth and Meiosis

This single molecule fluorescence in situ hybridization protocol is optimized to quantify the number of RNA molecules in budding yeast during vegetative growth and meiosis.

단일 분자 형광에서 제자리 교 잡 (smFISH) 신진 효 모 무성 한 성장 및 감수 분열 분석

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect ...

연구

유전학

Use of Single Molecule Fluorescent In Situ Hybridization (SM-FISH) to Quantify and Localize mRNAs in Murine Oocytes

Current methods routinely used to quantify mRNA in oocytes and embryos include digital reverse-transcription polymerase chain reaction (dPCR), quantitative, real-time RT-PCR (RT-qPCR) and RNA sequencing. When these techniques are performed using a single oocyte or embryo, low-copy mRNAs are not reliably detected. To overcome this problem, oocytes or embryos can be pooled together for analysis; however, this often leads to high variability amongst samples. In this protocol, we describe the use of fluorescence in situ hybridization (FISH) using branched DNA chemistry. This technique identifies the spatial pattern of mRNAs in individual cells. When the technique is coupled with Spot Finding and Tracking&#160;computer software, the abundance of mRNAs in the cell can also be quantified. Using this technique, there is reduced variability within an experimental group and fewer oocytes and embryos are required to detect significant differences between experimental groups. Commercially available branched-DNA SM-FISH kits have been optimized to detect mRNAs in sectioned tissues or adherent cells on slides. However, oocytes do not effectively adhere to slides and some reagents in the kit were too harsh resulting in oocyte lysis. To prevent this lysis, several modifications were made to the FISH kit. Specifically, oocyte permeabilization and wash&#160;buffers designed for the immunofluorescence of oocytes and embryos replaced the proprietary buffers. The permeabilization, washes, and incubations with probes and amplifier were performed in 6-well plates and oocytes were placed on slides at the end of the protocol using mounting media. These modifications were able to overcome the limitations of the commercially available kit, in particular, the oocyte lysis. To accurately and reproducibly count the number of mRNAs in individual oocytes, computer software was used. Together, this protocol represents an alternative to PCR and sequencing to compare the expression of specific transcripts in single cells.

Use of Single Molecule Fluorescent In Situ Hybridization SM-FISH to Quantify and Localize mRNAs in Murine Oocytes

To reproducibly count the numbers of mRNAs in individual oocytes, single molecule RNA fluorescence in situ hybridization (RNA-FISH) was optimized for non-adherent cells. Oocytes were collected, hybridized with the transcript specific probes, and quantified using an image quantification software.

Murine Oocytes에 계량 및 방화 mRNAs 단일 분자 형광에서 제자리 교 잡 (SM-물고기)의 사용

Current methods routinely used to quantify mRNA in oocytes and embryos include digital reverse-transcription polymerase chain reaction (dPCR), ...

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic acid (sRNA) molecules and target messenger RNAs (mRNAs). In addition, site-directed mutagenesis is used to map specific protein binding sites to RNA. A 2-step and 3-step PCR based introduction of mutations is described. The approach is relevant to all protein-RNA and RNA-RNA interaction studies. In short, the technique relies on designing primers with the desired mutation(s), and through 2 or 3 steps of PCR synthesizing a PCR product with the mutation. The PCR product is then used for cloning. Here, we describe how to perform site-directed mutagenesis with both the 2- and 3-step approach to introduce mutations to the sRNA, McaS, and the mRNA, csgD, to investigate RNA-RNA and RNA-protein interactions. We apply this technique to investigate RNA interactions; however, the technique is applicable to all mutagenesis studies (e.g., DNA-protein interactions, amino-acid substitution/deletion/addition). It is possible to introduce any kind of mutation except for non-natural bases but the technique is only applicable if a PCR product can be used for downstream application (e.g., cloning and template for further PCR).

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in deoxyribonucleic acid (DNA). This protocol describes how to do site-directed mutagenesis with a 2-step and 3-step polymerase chain reaction (PCR) based approach, which is applicable to any DNA fragment of interest.

사이트 감독 Mutagenesis에 대 한 생체 외에서 그리고 Vivo 실험 대장균 RNA 상호 Exemplified에서

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic ...

생화학

Proteome-wide Quantification of Labeling Homogeneity at the Single Molecule Level

Cell proteomes are often characterized using electrophoresis assays, where all species of proteins in the cells are non-specifically labeled with a fluorescent dye and are spotted by a photodetector following their separation. Single molecule fluorescence imaging can provide ultrasensitive protein detection with its ability for visualizing individual fluorescent molecules. However, the application of this powerful imaging method to electrophoresis assays is hampered by the lack of ways to characterize the homogeneity of fluorescent labeling of each protein species across the proteome. Here, we developed a method to evaluate the labeling homogeneity across the proteome based on a single molecule fluorescence imaging assay. In our measurement using a HeLa cell sample, the proportion of proteins labeled with at least one dye, which we termed &#8216;labeling occupancy&#8217; (LO), was determined to range from 50% to 90%, supporting the high potential of the application of single molecule imaging to sensitive and precise proteome analysis.

Here, we present a protocol to assess the labeling homogeneity for each protein species in a complex protein sample at the single molecule level.

단일 분자 수준에서 동질성을 라벨의 프로테옴 와이드 정량화

Cell proteomes are often characterized using electrophoresis assays, where all species of proteins in the cells are non-specifically labeled with a ...

Single Cell Analysis Of Transcriptionally Active Alleles By Single Molecule FISH

Gene transcription is an essential process in cell biology, and allows cells to interpret and respond to internal and external cues. Traditional bulk population methods (Northern blot, PCR, and RNAseq) that measure mRNA levels lack the ability to provide information on cell-to-cell variation in responses. Precise single cell and allelic visualization and quantification is possible via single molecule RNA fluorescence in situ hybridization (smFISH). RNA-FISH is performed by hybridizing target RNAs with labeled oligonucleotide probes. These can be imaged in medium/high throughput modalities, and, through image analysis pipelines, provide quantitative data on both mature and nascent RNAs, all at the single cell level. The fixation, permeabilization, hybridization and imaging steps have been optimized in the lab over many years using the model system described herein, which results in successful and robust single cell analysis of smFISH labeling. The main goal with sample preparation and processing is to produce high quality images characterized by a high signal-to-noise ratio to reduce false positives and provide data that are more accurate. Here, we present a protocol describing the pipeline from sample preparation to data analysis in conjunction with suggestions and optimization steps to tailor to specific samples.&#160;

Single molecule RNA fluorescence in situ hybridization (smFISH) is a method to accurately quantify levels and localization of specific RNAs at the single cell level. Here, we report our validated lab protocols for wet-bench processing, imaging and image analysis for single cell quantification of specific RNAs.

단일 분자 물고기에 의한 전사 활성 알레일의 단일 세포 분석

Gene transcription is an essential process in cell biology, and allows cells to interpret and respond to internal and external cues. Traditional bulk ...

<meta charset="utf8"></head><body>smFRET-TIRF 연구를 위한 RNA의 이중 색상 말단 표지 및 소포 캡슐화

Fluorescent End-Labeling and Encapsulation of Long RNAs for Single-Molecule FRET-TIRF Microscopy

Single-molecule F&#246;rster Resonance Energy Transfer (smFRET) excels in studying dynamic biomolecules by allowing precise observation of their conformational changes over time. To monitor RNA dynamics with smFRET, we developed a method to covalently label RNAs at their termini with a FRET pair of fluorophores. This direct end-labeling strategy targets the 5&#39;-phosphate by carbodiimide (EDC)/N-hydroxysuccinimide (NHS) activation and the 3&#39;-ribose by periodate oxidation, which can be adapted to other RNAs regardless of their size and sequence to study them independently of artificial modifications. Furthermore, the 5&#39;-EDC/NHS activation is of general interest to all nucleic acids with a 5&#39;-phosphate. The use of commercially available chemicals eliminates the need to synthesize RNA-specific probes.
Total Internal Reflection Fluorescence (TIRF) microscopy requires the surface-immobilized molecules of interest to be within the evanescent field to be illuminated. A sophisticated way of keeping the RNA molecules within the evanescent field is to encapsulate them in phospholipid vesicles. Encapsulation benefits from the best of both worlds, tethering the molecule to the surface while enabling free diffusion of the molecule. We ensure that each vesicle contains only a single RNA molecule, enabling single-molecule imaging. Upon dual-end labeling and encapsulation of the RNA of interest, smFRET measurements offer a dynamic and detailed view of RNA behavior.

<meta charset="utf8"></head><body>Fluorescent end-labeling and encapsulation of long RNAs for single-molecule FRET-TIRF microscopy(단일 분자 FRET-TIRF 현미경을 위한 Long RNA의 형광 말단 라벨링 및 캡슐화)

This article describes the dual-color labeling of long RNAs at termini positions and their surface immobilization via encapsulation in phospholipid vesicles for single-molecule FRET TIRF microscopy applications. Combining these techniques enables precise visualization and analysis of RNA dynamics at the single-molecule level.

Fluorescent end-labeling and encapsulation of long RNAs for single-molecule FRET-TIRF microscopy(단일 분자 FRET-TIRF 현미경을 위한 Long RNA의 형광 말단 라벨링 및 캡슐화)

Single-molecule F&#246;rster Resonance Energy Transfer (smFRET) excels in studying dynamic biomolecules by allowing precise observation of their ...

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes.
The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE1.
Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System2 (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types.

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization FISH

Fluorescent in situ hybridization (FISH) to identify mRNA transcripts in individual cells allows analysis of polygenic activity such as the simultaneous transcription of more than one member of the var multigene family in Plasmodium falciparum infected erythrocytes 1. The technique is adaptable and can be used on different types of genes, cells and organisms.

RNA 형광하여 단일 세포 유전자 전사의 분석<em&gt; 현장에서</em&gt; 하이브리드 (물고기)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 ...

생물학

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for using FISH to quantify the number of mRNAs in single yeast cells. Cells can be grown in any condition of interest and then fixed and made permeable. Subsequently, multiple single-stranded deoxyoligonucleotides conjugated to fluorescent dyes are used to label and visualize mRNAs. Diffraction-limited fluorescence from single mRNA molecules is quantified using a spot-detection algorithm to identify and count the number of mRNAs per cell. While the more standard quantification methods of northern blots, RT-PCR and gene expression microarrays provide information on average mRNAs in the bulk population, FISH facilitates both the counting and localization of these mRNAs in single cells at single-molecule resolution.

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

This protocol describes an experimental procedure for performing Fluorescence in situ Hybridization (FISH) for counting mRNAs in single cells at single-molecule resolution.

형광을 사용하여 mRNA의 분자의 시각화 및 분석<em&gt; 제자리에서</em에서&gt; 하이브리드<em&gt; 사카 cerevisiae의</em

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for ...

단일 분자 형광 제자리에서 교 잡 실험에 대 한 개별 대장균 세포에 성적표를 라벨에 대 한 방법

요약

더 많은 비디오 탐색

이 비디오의 챕터

단일 분자 형광에서 제자리 교 잡 (smFISH) 신진 효 모 무성 한 성장 및 감수 분열 분석

Murine Oocytes에 계량 및 방화 mRNAs 단일 분자 형광에서 제자리 교 잡 (SM-물고기)의 사용

사이트 감독 Mutagenesis에 대 한 생체 외에서 그리고 Vivo 실험 대장균 RNA 상호 Exemplified에서

단일 분자 수준에서 동질성을 라벨의 프로테옴 와이드 정량화

단일 분자 물고기에 의한 전사 활성 알레일의 단일 세포 분석

Fluorescent end-labeling and encapsulation of long RNAs for single-molecule FRET-TIRF microscopy(단일 분자 FRET-TIRF 현미경을 위한 Long RNA의 형광 말단 라벨링 및 캡슐화)

Fluorescent end-labeling and encapsulation of long RNAs for single-molecule FRET-TIRF microscopy(단일 분자 FRET-TIRF 현미경을 위한 Long RNA의 형광 말단 라벨링 및 캡슐화)

Fluorescent end-labeling and encapsulation of long RNAs for single-molecule FRET-TIRF microscopy(단일 분자 FRET-TIRF 현미경을 위한 Long RNA의 형광 말단 라벨링 및 캡슐화)

RNA 형광하여 단일 세포 유전자 전사의 분석

형광을 사용하여 mRNA의 분자의 시각화 및 분석