This work was supported by NIH AI099854 and AI126742 to KEY.

1. Annealing of vDNA
<ol>
	<li>Combine 1X TEN Buffer (10X TEN stock: 100 mM Tris-HCl, pH 8.0, 1 M NaCl, 10 mM EDTA), 10 &#181;M Oligo 1 (5&#39; ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3&#39;, 100 &#181;M stock), and 10 &#181;M Oligo 2 (5&#39; CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3&#39;, 100 &#181;M stock) in a final volume of 1.5 mL. Aliquot 25 &#181;L into sixty 0.2-mL polymerase chain reaction (PCR) tubes. 
	NOTE: Depending on the application, oligomers may be modified with fluorophores or tags at the 5&#39;-end of Oligo 2 or as an internal amino-T at base 13 from the 5&#39;-end of Oligo 1. Modified oligomers should be purified by high-performance liquid chromatography (HPLC) before annealing. We have found that 5&#39;-end Cy3 or Cy5 fluorophore labeling of Oligo 2 reduces the intasome assembly efficiency 10-fold. Internal fluorophore labeling does not reduce assembly efficiency.</li>
	<li>Anneal using a thermocycler with the following times and temperatures: 1 cycle at 94.0 &#730;C 3 min, 99 cycles at (94.0 &#730;C 1 min, 93.6 &#730;C 1 min) decreasing both temperatures by 0.8 &#730;C per cycle (the last cycle is 14.8 &#730;C 1 min, 14.4 &#730;C 1 min), and store at 4.0 &#730;C.</li>
	<li>Combine the annealing reactions from all sixty tubes. Load 500 &#181;L to two 0.5-mL 3 kDa molecular weight cutoff (MWCO) ultracentrifugal filter concentration units. Concentrate the annealed vDNA by centrifugation in a microcentrifuge at 14,000 x g for 10 min at room temperature (RT). 
	NOTE: The retentate volume should be ~50 &#181;L in each concentration unit.</li>
	<li>Discard the flow through. Add 250 &#181;L of the remaining annealed vDNA to each filter unit. Repeat the spin and discard the flow through. Buffer exchange into TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) by washing three times with 450 &#181;L TE.</li>
	<li>Invert the filter unit and spin at 1,000 x g for 2 min at RT. The final retentate volume for each filter unit should be ~50 &#181;L. Combine the retentates and transfer to a 1.5 mL screw cap tube.</li>
	<li>Measure the 260-nm ultraviolet (UV) absorbance of the vDNA. Use this value to calculate the final molar DNA concentration. The extinction coefficient (&#949;260) of this vDNA is 622,803 cm-1 M-1 and its molecular weight is 23,972 Da. Store at -20 &#730;C.</li>
</ol>
2. Intasome Assembly
<ol>
	<li>If possible, perform the intasome assembly in a small room with a variable thermostat. Adjust the thermostat to approximately 18-22 &#730;C. 
	NOTE: In our experience, intasome assembly at 4 &#730;C is inefficient.</li>
	<li>Prepare 1 L of dialysis buffer (20 mM Bis-tris propane, pH 7.5, 200 mM NaCl, 2 mM dithiothreitol (DTT), 25 &#181;M ZnCl2) in a 2 L beaker with a stir bar on a stir plate. Equilibrate the buffer in the 18-22 &#730;C room for at least 6 h.</li>
	<li>To assemble the intasomes, combine 50 mM Bis-tris propane, pH 7.5, 500 mM NaCl, 120 &#181;M PFV IN, and 50 &#181;M vDNA in a total volume of 150 &#181;L. 
	NOTE: The PFV IN should be free of contaminating nuclease activity7,8. If the concentration of PFV IN is too dilute to accommodate 120 &#181;M IN in 150 &#181;L volume, then it is possible to increase the final volume to 200 &#181;L. The critical factors of this step are to maintain the molar ratio of IN to vDNA (2.4:1) and to have enough complex to visualize during chromatography.</li>
	<li>Clean a ~10-cm long piece of 10-mm 6-8 kDa MWCO dialysis tubing and clips with double distilled water (ddH2O), or the highest purity water available. Clip one end of the tubing. 
	NOTE: Dialysis tubing should be handled with care to prevent any possible contamination from the lab space.</li>
	<li>Make 15 mL of dialysis tubing rinse buffer (50 mM Bis-tris propane, pH 7.5, 500 mM NaCl). Rinse the inside of the dialysis tubing three times with 1-2 mL rinse buffer. Remove as much of the rinse buffer as possible with a pipette and thin gel loading tip.</li>
	<li>If necessary, use a clean razor blade or scalpel to cut the dialysis tubing so that a thin gel loading tip may reach the end of the tubing.</li>
	<li>Transfer the intasome assembly from step 2.3 to the dialysis tubing with a pipette and a thin gel loading tip. Clip the open end of the dialysis tubing, minimizing the amount of air introduced within the tubing. Place the tubing into the dialysis buffer.</li>
	<li>Dialyze overnight (16-20 h) with gentle stirring so that the tubing rotates but is not in a vortex. Ensure that the dialysis tubing is submerged and mobile. After approximately one hour, observe a visible precipitate inside the tubing. 
	NOTE: With Cy3 or Cy5 fluorescently labeled vDNA, the precipitate is more obvious. This is true for both end labeled and internally labeled fluorescent vDNA.</li>
</ol>
3. Intasome Solubilization
<ol>
	<li>Prepare two wide bore pipette tips by removing 2-4 mm from the end of a 200 &#181;L tip with a new razor or scalpel blade on a clean surface. 
	NOTE: The tips will be used in step 3.3 and 3.5.</li>
	<li>Remove the dialysis tubing from the dialysis buffer. In order to prevent dilution of the intasome sample with dialysis buffer that may remain at the end of the tubing near the clip, use a micropipette with a small pipette tip to remove any excess dialysis buffer. Remove the clip from one end of the dialysis tubing.</li>
	<li>Use a wide bore pipette tip from step 3.1 to transfer the sample including the precipitate inside the dialysis tubing to a 1.5-mL tube on ice. Note the total volume of the recovered material; the total volume is typically ~140 &#181;L.</li>
	<li>The sample with precipitate is at 200 mM NaCl; increase the salt to a final concentration of 320 mM NaCl by adding the appropriate volume of a stock 5 M NaCl solution. For example, for a sample of 150 &#181;L, add 3.9 &#181;L 5 M NaCl and 1.1 &#181;L ddH2O for a final volume of 155 &#181;L. Transfer ice bucket with sample into a 4 &#730;C cold room.</li>
	<li>Use a wide bore pipette tip from step 3.1 to resuspend and solubilize the precipitate by pipetting. Repeat every 20 min for at least 1 h. Observe that most of the precipitate should go into solution. 
	NOTE: Pipetting to resuspend the precipitate can be stopped when it is apparent that the precipitate is no longer noticeably reduced between time points. When vDNA is not labeled or is internally labeled, the precipitate is reduced by ~90% based on visual inspection. In the case of Cy5 end labeled vDNA, the precipitate is reduced by only ~20%; most of the precipitate with fluorophore end labeled vDNA will not solubilize. The amount of precipitate that is effectively solubilized is variable and should be empirically determined.</li>
</ol>
4. Intasome Purification
<ol>
	<li>Prepare 250 mL of size exclusion chromatography (SEC) running buffer (20 mM Bis-tris propane, pH 7.5, 320 mM NaCl, 10% glycerol). Sterile filter the buffer with a 0.2-&#181;m filter unit and store at 4 &#730;C. 
	NOTE: All purification steps are performed in a 4 &#730;C cold room.</li>
	<li>Equilibrate a cross-linked agarose SEC column (diameter = 10 mm; length = 300 mm; bed volume = 24 mL; sample volume = 25 - 500 &#181;L; maximum pressure = 1.5 MPa; exclusion limit = 4 x 107 Da; separates molecular weights between 5 and 5,000 kDa, see the Table of Materials) with SEC running buffer at a flow rate of 0.4 mL/min. 
	NOTE: This purification may be adapted to different size exclusion columns if they are able to effectively separate 300 kDa from 44 kDa, such as Superose 12 10/300 GL or Superose 6 Increase. Superose 12 10/300 GL has lower resolution, leading to more overlap of peaks. Conversely, Superose 6 Increase has higher resolution and offers better separation.</li>
	<li>Centrifuge the intasome sample in a microfuge at 14,000 x g for 10 min at 4 &#730;C to pellet any remaining precipitate. Carefully remove the supernatant. Load the supernatant to a 200 &#181;L injection loop (tubing that can hold ~200 &#956;L). Apply the sample to the SEC column. 
	NOTE: Smaller load volumes allow greater resolution by SEC.</li>
	<li>Elute with 25 mL SEC running buffer and collect 95 fractions of 270 &#181;L. Observe that the SEC chromatogram displays three A280/A260 peaks (Figure 1). 
	NOTE: The first should be an aggregate (~9.0 - 11.5 mL elution), followed by the PFV tetramer intasome peak (~12.0 - 14.75 mL elution) and PFV IN monomer with free vDNA peak (~15.0 - 18.0 mL).</li>
</ol>
5. Integration Strand Transfer Assay, Fraction Selection, and Storage
<ol>
	<li>Combine 2 &#181;L of each intasome peak fraction and 50 ng 3 kb supercoiled plasmid DNA (stock concentration is 50 ng/&#181;L) in reaction buffer (10 mM Bis-tris propane, pH 7.5, 110 mM NaCl, 5 mM MgSO4, 4 &#181;M ZnCl2, 10 mM DTT) in a final reaction volume of 15 &#181;L. Incubate at 37 &#730;C for 5 min.</li>
	<li>Include a negative control with no added PFV intasome. Stop the reaction with 0.75 &#181;L proteinase K (20 mg/mL stock solution) and 0.75 &#181;L SDS (10% stock solution). Incubate at 55 &#730;C for 1 h. Store samples as needed at -20 &#730;C for later analyses. 
	NOTE: This assay is a qualitative assessment of integration activity. The intasome molar concentration of each fraction is not determined prior to this assay. Fractions included in the integration strand transfer assay can be stored on ice (including overnight storage) until integration activity is confirmed and selected fractions are aliquoted. Here we use pMP2, a pUC19 derivative9. We have also successfully used the 5.4 kb plasmid pcDNA 3.1. Any plasmid that may be resolved to relaxed circle, linear, and supercoiled forms may be used as a target for integration.</li>
	<li>Prepare a 120 mL 1% weight per volume (w/v) agarose gel in 1X TAE buffer (40 mM Tris-acetate, 1 mM EDTA) with 0.1 &#956;g/mL ethidium bromide (EtBr, 10 mg/mL stock solution)10. Melt the agarose solution and pour it into a 15 cm x 10 cm gel casting tray. Insert a 15-well comb with 5-mm wide, 0.75-mm thick wells. 
	NOTE: Narrower wells yield better band resolution compared to 1.5-mm thick wells.</li>
	<li>Allow the gel to solidify at ambient temperature. Immerse the gel in 1X TAE with 0.1 &#956;g/mL EtBr.</li>
	<li>Add 3 &#181;L 50% glycerol to each integration reaction from step 5.2. Load the entire reaction volume to the gel. Load 1 &#181;L of 10 kb DNA size marker (150 ng/&#181;L stock concentration) to lanes on either side of the samples; in other words, the DNA size marker should flank the sample lanes.</li>
	<li>In an outer lane, load 6 &#181;L Orange G dye (0.25% Orange G, 30% glycerol). Run the gel at constant voltage, 10 V/cm (100 V) at ambient temperature for 1 h, or until the Orange G dye front reaches the end of the gel.</li>
	<li>Immediately image the agarose gel with a fluorescent scanner set to detect EtBr (532 nm excitation, 610 nm emission filter). If fluorophore labeled vDNAs were used, also image with appropriate fluorophore settings. 
	NOTE: For example, to detect Cy5 labeled DNA, image using 633 nm excitation and 670 nm emission filters. Concerted integration products (CI, linear DNA) should run true to size at ~3 kb, unreacted supercoiled plasmid (SC) should run faster (~2 kb), and half-site integration products (HSI, relaxed circle DNA) should run slower (~3.5 kb). Unreacted vDNA should run true to size at ~40 bp.</li>
	<li>Quantify the bands in each lane with imaging software7. Calculate the fraction of DNA in each lane that is CI, HSI, or SC; vDNA is not included in this calculation. 
	NOTE: Integration efficiency, or the fraction of SC converted to a linear product, was calculated by dividing the pixel volume of concerted integration products (CI) by the total pixel volume of three bands (HSI+CI+SC). If intasomes are fluorophore labeled, the HSI and CI products may also be quantitated by fluorescence.</li>
	<li>Select fractions that have the most concerted integration activity. 
	NOTE: In our experience, the peak concerted integration activity coincides with the protein peak identified as tetrameric PFV intasomes. Measure the A280 of each of these fractions and calculate the final intasome concentration. The &#949;280 for a tetramer of wild type PFV IN with two vDNAs described here is 908,339 cm-1M-1 and the molecular weight is 225.5 kDa. The concentrations should follow the same pattern as the SEC chromatogram peak and in the strand transfer assay.</li>
	<li>Distribute each fraction in 5 &#181;L aliquots and snap freeze in liquid nitrogen. Store aliquots at -80 &#730;C. Fractions selected for storage are typically between 200 - 600 nM.</li>
</ol>

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

The authors have nothing to disclose.

Retroviral INs form a multimeric complex with viral genomic DNA to perform integration and continue the viral life cycle. The number of IN monomers per intasome may be tetramers, octamers, or possibly higher order multimers11,12,13,14. PFV intasomes are a tetramer of recombinant IN with double-stranded DNA oligomers that mimic viral genomic DNA ends3. These inta...

Integration of the viral genome into the host genome is a mandatory step in the life cycle of all retroviruses1. The viral enzyme integrase (IN) catalyzes the covalent joining of each end of the viral DNA genome to the host DNA. During a cellular infection, IN is part of a pre-integration complex that mediates integration. Recombinant IN complexed with double stranded DNA oligomers mimicking the viral DNA ends can also perform integration into a target DNA in vitro2. A common integration assay in vitro utilizes a supercoiled plasmid as the target DNA. Integration of both viral DNA oligomers (vDNA) to the plasmid results in a linear product and is termed concerted integration (Figure 2A). The integration assay in vitro may also yield products with only one vDNA covalently joined to the target plasmid resulting in a relaxed circle. This half-site integration product appears to be an artefact of the assay in vitro.
Recombinant IN and vDNA may perform integration in vitro, but they are not ideal reagents for the study of the dynamics or structure of integration complexes when monomeric IN would obscure relevant visualization. Purified integration complexes, or &#34;intasomes,&#34;&#160;are required for dynamic single molecule analysis or structural studies. PFV IN and vDNAs may be assembled by dialysis from a relatively high salt concentration buffer to a lower salt concentration3,4. During dialysis, a precipitate forms. This precipitate is removed from dialysis and the salt concentration is increased. The higher salt concentration solubilizes the precipitate containing PFV intasomes. The intasomes are then purified by size exclusion chromatography (SEC). Recombinant prototype foamy virus (PFV) IN has been shown to exist as a monomer in solution at concentrations up to 225 &#181;M5. SEC fractionation effectively separates the PFV intasomes (225.5 kDa), which includes a tetramer of PFV IN and two vDNAs, from monomeric PFV IN (44.4 kDa) and free vDNA (24.0 kDa). The PFV intasomes may be frozen and retain integration activity for at least six months of storage at -80 &#730;C.
Recombinant PFV intasomes may also be modified to include IN amino acid substitutions or truncation mutations or vDNAs labeled with fluorophores or biotin4,6. The purified PFV intasomes readily perform integration into a supercoiled plasmid target DNA in vitro. Bulk biochemical integration assays with intasomes may test the effects of IN mutations, IN inhibitors, or other chemical additives. Biotinylated intasomes can be used to probe affinity with nucleic acids or proteins. PFV intasomes are functional at ambient temperature allowing for single molecule microscopy analysis by magnetic tweezers to measure the time between joining of the two vDNA ends or total internal reflection fluorescence to visualize the intasome search on target DNA6. In addition, PFV intasomes were the first to be structurally characterized significantly impacting the field of retroviral integration3.

<table><tbody><tr><td>DNA Oligomers</td><td>IDT</td><td>N/A</td><td>Custom DNA Oligos</td></tr><tr><td>Tris Ultra Pure</td><td>Gojira Fine Chemicals</td><td>UTS1003</td><td></td></tr><tr><td>NaCl</td><td>P212121</td><td>RP-S23020</td><td></td></tr><tr><td>UltraPure EDTA</td><td>Invitrogen/Gibco</td><td>15575</td><td></td></tr><tr><td>Amicon Ultra 0.5 mL centrifugal filters</td><td>Sigma-Aldrich</td><td>Z677094-24EA</td><td>3 kDa MWCO</td></tr><tr><td>DTT</td><td>P212121</td><td>SV-DTT</td><td></td></tr><tr><td>BIS-TRIS propane,&gt;=99.0% (titration)</td><td>Sigma-Aldrich</td><td>B6755-500G</td><td></td></tr><tr><td>ZnCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>208086</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;</td><td>Amresco</td><td>0662</td><td></td></tr><tr><td>Glycerol</td><td>Thermo Fisher Scientific</td><td>G37-20</td><td></td></tr><tr><td>Gel-loading tips, 1 - 200 &amp;mu;L</td><td>Corning</td><td>CLS4853-400EA</td><td></td></tr><tr><td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td><td>Fisher Scientific</td><td>12-640</td><td></td></tr><tr><td>Sterile Disposable Filter Units with PES Membrane &gt; 250mL</td><td>Thermo Fisher Scientific</td><td>568-0020</td><td></td></tr><tr><td>Dialysis tubing clips</td><td>Spectrum Labs</td><td>132734</td><td></td></tr><tr><td>6-8 kDa 10 mm Dialysis Tubing</td><td>Spectrum Medical</td><td>132645</td><td></td></tr><tr><td>Superose 6 10/300 GL</td><td>GE Healthcare Life Sciences</td><td>17517201</td><td></td></tr><tr><td>Hi-Res Standard Agarose</td><td>AGTC Bioproducts</td><td>AG500D1</td><td></td></tr><tr><td>Ethidium bromide</td><td>Thermo Fisher Scientific</td><td>BP1302</td><td></td></tr><tr><td>Orange G</td><td>Fisher Scientific</td><td>0-267</td><td></td></tr><tr><td>Hyladder 10kb, 500 lanes</td><td>Denville Scientific</td><td>CB4225-4</td><td></td></tr></tbody></table>

assembly and purification of prototype foamy virus intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an integrase (IN) enzyme that catalyzes the covalent joining of viral to host DNA, which is known as strand transfer. Integration may be modeled in vitro with recombinant retroviral IN and DNA oligomers mimicking the ends of the viral genome. In order to more closely recapitulate the integration reaction that occurs in vivo, integration complexes are assembled from recombinant IN and synthetic oligomers by dialysis in a reduced salt concentration buffer. The integration complex, called an intasome, may be purified by size exclusion chromatography. In the case of prototype foamy virus (PFV), the intasome is a tetramer of IN and two DNA oligomers and is readily separated from monomeric IN and free oligomer DNA. The integration efficiency of PFV intasomes may be assayed under a variety of experimental conditions to better understand the dynamics and mechanics of retroviral integration.

PFV intasomes are assembled from recombinant IN and vDNA. After assembly, intasomes are purified by SEC (Figure 1). Integration activity of each fraction is assayed with a supercoiled DNA target and agarose gel electrophoresis (Figure 2). This gel is imaged with a fluorescent scanner set to detect EtBr (and fluorophore, if fluorophore-labeled vDNA is used). Using image analysis software, band pixel volumes can be used to calculat...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Recombinant retroviral integrase and DNA oligomers mimicking viral DNA ends can form an enzymatically active complex known as an intasome. Intasomes may be used for biochemical, structural, and kinetic studies. This protocol details how to assemble and purify prototype foamy virus intasomes.

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Research

JoVE Journal

Immunology and Infection

5.4K Views.  The Ohio State University College of Medicine. Recombinante retrovirale integrase en DNA oligomeren nabootsen van virale DNA uiteinden kunnen een enzymatisch actieve complex bekend als een intasome vormen. Intasomes kan worden gebruikt voor biochemische, structurele en kinetische studies. Dit protocol detailleert hoe te monteren en te zuiveren van prototype schuimend virus intasomes.

Video: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States alone, an average of 41,400 deaths and 1.86 million hospitalizations are caused by influenza virus infection each year 1. Point mutations in the polymerase basic protein 2 subunit (PB2) have been linked to the adaptation of the viral infection in humans 2. Findings from such studies have revealed the biological significance of PB2 as a virulence factor, thus highlighting its potential as an antiviral drug target.
The structural genomics program put forth by the National Institute of Allergy and Infectious Disease (NIAID) provides funding to Emerald Bio and three other Pacific Northwest institutions that together make up the Seattle Structural Genomics Center for Infectious Disease (SSGCID). The SSGCID is dedicated to providing the scientific community with three-dimensional protein structures of NIAID category A-C pathogens. Making such structural information available to the scientific community serves to accelerate structure-based drug design.
Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for new lead discovery by targeting a pathway or an entire protein family. Emerald Bio has developed a high-throughput, multi-target parallel processing pipeline (MTPP) for gene-to-structure determination to support the consortium. Here we describe the protocols used to determine the structure of the PB2 subunit from four different influenza A strains.

Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for lead discovery. The following article highlights how the Seattle Structural Genomics Center for Infectious Disease utilizes a multi-target approach for gene-to-structure determination of the PB2 influenza A subunit.

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States ...

Detergent-assisted Reconstitution of Recombinant Drosophila Atlastin into Liposomes for Lipid-mixing Assays

Membrane fusion is a crucial process in the eukaryotic cell. Specialized proteins are necessary to catalyze fusion. Atlastins are endoplasmic reticulum (ER) resident proteins implicated in homotypic fusion of the ER. We detail here a method for purifying a glutathione S-transferase (GST) and poly-histidine tagged Drosophila atlastin by two rounds of affinity chromatography. Studying fusion reactions in vitro requires purified fusion proteins to be inserted into a lipid bilayer. Liposomes are ideal model membranes, as lipid composition and size may be adjusted. To this end, we describe a reconstitution method by detergent removal for Drosophila atlastin into preformed liposomes. While several reconstitution methods are available, reconstitution by detergent removal has several advantages that make it suitable for atlastins and other similar proteins. The advantage of this method includes a high reconstitution yield and correct orientation of the reconstituted protein. This method can be extended to other membrane proteins and for other applications that require proteoliposomes. Additionally, we describe a FRET based lipid mixing assay of proteoliposomes used as a measurement of membrane fusion.

Detergent-assisted Reconstitution of Recombinant Drosophila Atlastin into Liposomes for Lipid-mixing Assays

Biological membrane fusion is catalyzed by specialized fusion proteins. Measuring the fusogenic properties of proteins can be achieved by lipid mixing assays. We present a method for purifying recombinant Drosophila atlastin, a protein that mediates homotypic fusion of the ER, reconstituting it to preformed liposomes, and testing for fusion capacity.

Membrane fusion is a crucial process in the eukaryotic cell. Specialized proteins are necessary to catalyze fusion. Atlastins are endoplasmic reticulum ...

Biochemistry

Generation and Assembly of Virus-Specific Nucleocapsids of the Respiratory Syncytial Virus

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and assay development in virology. The RNA template of nonsegmented negative-sense (NNS) RNA viruses, such as the respiratory syncytial virus (RSV), is not an RNA molecule alone but rather a nucleoprotein (N) encapsidated ribonucleoprotein complex. Despite the importance of the authentic RNA template, the generation and assembly of such a ribonucleoprotein complex remain sophisticated and require in-depth elucidation. The main challenge is that the overexpressed RSV N binds non-specifically to cellular RNAs to form random nucleocapsid-like particles (NCLPs). Here, we established a protocol to obtain RNA-free N (N0) first by co-expressing N with a chaperone phosphoprotein (P), then assembling N0 with RNA oligos with the RSV-specific RNA sequence to obtain virus-specific nucleocapsids (NCs). This protocol shows how to overcome the difficulty in the preparation of this traditionally challenging viral ribonucleoprotein complex.

For in-depth mechanistic analysis of the respiratory syncytial virus (RSV) RNA synthesis, we report a protocol of utilizing the chaperone phosphoprotein (P) for coexpression of the RNA-free nucleoprotein (N0) for subsequent in vitro assembly of the virus-specific nucleocapsids (NCs).

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and ...

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus (IAV), virus fusion with the endosomal membrane as well as the subsequent disassembly of the viral capsid, called uncoating, is governed by the ionic conditions inside endocytic vesicles. The early steps in the virus life cycle are hard to study because endosomes cannot be directly accessed experimentally, creating the need for an in vitro approach. Here, we describe a method based on velocity gradient centrifugation of purified virions through a two-layer glycerol gradient, which enables analysis of the IAV core and its stability. The gradient contains a non-ionic detergent (NP-40) in its lower layer to remove the viral membrane by solubilization as the virus sediments toward the bottom. At neutral pH, viral cores are pelleted as stable structures. The major core components, matrix protein (M1) and the viral ribonucleoproteins (vRNPs), can be clearly identified in the pellet fraction by SDS-PAGE. Decreasing the pH to 6.0 or lower in the bottom layer selectively removes M1 from the pellet followed by release of vRNPs at more acidic conditions. Viral protein bands on Coomassie-stained gels can be subjected to densitometric quantification to monitor intermediate states of IAV disassembly. Besides pH, other factors that influence viral core stability can be assessed, such as salt concentration and putative viral uncoating factors, simply by modifying the detergent-containing glycerol layer accordingly. Taken together, the presented technique allows highly reproducible and quantitative analysis of viral uncoating in vitro. It can be applied to other enveloped viruses that undergo complex uncoating processes.

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Disassembly of influenza A virus cores during virus entry into host cells is a multistep process. We describe an in vitro method to analyze the early stages of viral uncoating. In this approach, velocity gradient centrifugation is used to biochemically dissect the steps that initiate uncoating under defined conditions.

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus ...

Advancing High-Resolution Imaging of Virus Assemblies in Liquid and Ice

Interest in liquid-electron microscopy (liquid-EM) has skyrocketed in recent years as scientists can now observe real-time processes at the nanoscale. It is extremely desirable to pair high-resolution cryo-EM information with dynamic observations as many events occur at rapid timescales - in the millisecond range or faster. Improved knowledge of flexible structures can also assist in the design of novel reagents to combat emerging pathogens, such as SARS-CoV-2. More importantly, viewing biological materials in a fluid environment provides a unique glimpse of their performance in the human body. Presented here are newly developed methods to investigate the nanoscale properties of virus assemblies in liquid and vitreous ice. To accomplish this goal, well-defined samples were used as model systems. Side-by-side comparisons of sample preparation methods and representative structural information are presented. Sub-nanometer features are shown for structures resolved in the range of ~3.5-&#197;-10 &#197;. Other recent results that support this complementary framework include dynamic insights of vaccine candidates and antibody-based therapies imaged in liquid. Overall, these correlative applications advance our ability to visualize molecular dynamics, providing a unique context for their use in human health and disease.

Here protocols are described to prepare virus assemblies suitable for liquid-EM and cryo-EM analysis at the nanoscale using transmission electron microscopy.

Interest in liquid-electron microscopy (liquid-EM) has skyrocketed in recent years as scientists can now observe real-time processes at the nanoscale. It ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

In Vitro Reconstitution of the Actin Cytoskeleton Inside Giant Unilamellar Vesicles

The actin cytoskeleton, the principal mechanical machinery in the cell, mediates numerous essential physical cellular activities, including cell deformation, division, migration, and adhesion. However, studying the dynamics and structure of the actin network in vivo is complicated by the biochemical and genetic regulation within live cells. To build a minimal model devoid of intracellular biochemical regulation, actin is encapsulated inside giant unilamellar vesicles (GUVs, also called liposomes). The biomimetic liposomes are cell-sized and facilitate a quantitative insight into the mechanical and dynamical properties of the cytoskeleton network, opening a viable route for bottom-up synthetic biology. To generate liposomes for encapsulation, the inverted emulsion method (also referred to as the emulsion transfer method) is utilized, which is one of the most successful techniques for encapsulating complex solutions into liposomes to prepare various cell-mimicking systems. With this method, a mixture of proteins of interest is added to the inner buffer, which is later emulsified in a phospholipid-containing mineral oil solution to form monolayer lipid droplets. The desired liposomes are generated from monolayer lipid droplets crossing a lipid/oil-water interface. This method enables the encapsulation of concentrated actin polymers into the liposomes with desired lipid components, paving the way for in vitro reconstitution of a biomimicking cytoskeleton network.

In Vitro Reconstitution of the Actin Cytoskeleton Inside Giant Unilamellar Vesicles

In this manuscript, we demonstrate the experimental techniques to encapsulate the F-actin cytoskeleton into giant unilamellar lipid vesicles (also called liposomes), and the method to form a cortex-biomimicking F-actin layer at the inner leaflet of the liposome membrane.

The actin cytoskeleton, the principal mechanical machinery in the cell, mediates numerous essential physical cellular activities, including cell ...

Bioengineering

Sample Preparation for Single Virion Atomic Force Microscopy and Super-resolution Fluorescence Imaging

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule imaging assays which allows adhesion of single virions to glass surfaces with specificity. This preparation is based on grafting the surface of the glass with a mixture of PLL-g-PEG and PLL-g-PEG-Biotin, adding a layer of avidin, and finally creating virion anchors through attachment of biotinylated virus specific antibodies. We have applied this technique across a range of experiments including atomic force microscopy (AFM) and super-resolution fluorescence imaging. This sample preparation method results in a control adhesion of the virions to the surface.

The attachment of virions to a surface is a requirement for single virion imaging by Super-resolution fluorescence imaging or atomic force microscopy (AFM). Here we demonstrate a sample preparation method for controlled adhesion of virions to glass surfaces suitable for use in AFM and super-resolution fluorescence imaging.

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule ...

Biology

Expression and Purification of Virus-like Particles for Vaccination

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased biosafety and stability over use of live pathogens. Non-infectious and self-assembling, VLPs are used to present structural proteins as immunogens, bypassing the need for live pathogens or recombinant viral vectors for antigen delivery. In this article, we demonstrate the different stages of VLP design and development for future applications in preclinical animal testing. The procedure includes the following stages: selection of antigen, expression of antigen in cell line of choice, purification of VLPs/SVPs, and quantification for antigen dosing. We demonstrate use of both mammalian and insect cell lines for expression of our antigens and demonstrate how methodologies differ in yield. The methodology presented may apply to a variety of pathogens and can be achieved by substituting the antigens with immunogenic structural proteins of the user&#39;s microorganism of interest. VLPs and SVPs assist with antigen characterization and selection of the best vaccine candidates.

Here, we present a protocol for synthesizing virus-like particles using either baculovirus or mammalian expression systems, and ultracentrifugation purification. This highly customizable approach is used to identify viral antigens as vaccine targets in a safe and flexible manner.

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased ...

Assembly and Purification of Prototype Foamy Virus Intasomes

Samenvatting

Meer video's verkennen